Incidental Mutation 'R8756:Flt1'
ID 664166
Institutional Source Beutler Lab
Gene Symbol Flt1
Ensembl Gene ENSMUSG00000029648
Gene Name FMS-like tyrosine kinase 1
Synonyms Flt-1, VEGFR1, vascular endothelial growth factor receptor-1, sFlt1, VEGFR-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8756 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 147561604-147726011 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 147639414 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 595 (T595A)
Ref Sequence ENSEMBL: ENSMUSP00000031653 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031653] [ENSMUST00000110529]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000031653
AA Change: T595A

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000031653
Gene: ENSMUSG00000029648
AA Change: T595A

DomainStartEndE-ValueType
IG 38 130 1.74e-3 SMART
IG 144 225 1.49e-2 SMART
IG 238 330 2.23e-10 SMART
IG 345 426 2.43e-2 SMART
IG 440 554 2.6e-2 SMART
IGc2 569 644 1.76e-8 SMART
IGc2 674 739 6.29e-19 SMART
low complexity region 769 786 N/A INTRINSIC
TyrKc 828 1154 9.54e-144 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110529
AA Change: T595A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106158
Gene: ENSMUSG00000029648
AA Change: T595A

DomainStartEndE-ValueType
IG 38 130 1.74e-3 SMART
IG 144 225 1.49e-2 SMART
IG 238 330 2.23e-10 SMART
IG 345 426 2.43e-2 SMART
IG 440 554 2.6e-2 SMART
IGc2 569 644 1.76e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vascular endothelial growth factor receptor (VEGFR) family. VEGFR family members are receptor tyrosine kinases (RTKs) which contain an extracellular ligand-binding region with seven immunoglobulin (Ig)-like domains, a transmembrane segment, and a tyrosine kinase (TK) domain within the cytoplasmic domain. This protein binds to VEGFR-A, VEGFR-B and placental growth factor and plays an important role in angiogenesis and vasculogenesis. Expression of this receptor is found in vascular endothelial cells, placental trophoblast cells and peripheral blood monocytes. Multiple transcript variants encoding different isoforms have been found for this gene. Isoforms include a full-length transmembrane receptor isoform and shortened, soluble isoforms. The soluble isoforms are associated with the onset of pre-eclampsia.[provided by RefSeq, May 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit an excess of hemangioblasts resulting in an overgrowth of endothelial cells, abnormalities of vascular channels and blood islands, and lethality at the mid-somite developmental stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Antxr1 A T 6: 87,188,253 S401T probably damaging Het
Armh1 T A 4: 117,237,664 I60L probably benign Het
Atp8b5 T C 4: 43,342,439 V370A probably damaging Het
Atraid T A 5: 31,054,041 Y184N probably damaging Het
Cp G C 3: 20,005,572 probably null Het
Crebbp A G 16: 4,085,903 I1824T probably benign Het
Cyp2c65 A T 19: 39,061,108 R27* probably null Het
Dtl T C 1: 191,539,259 H725R probably benign Het
Dync1h1 G T 12: 110,616,827 A453S probably benign Het
Fat3 T A 9: 16,376,589 D546V probably damaging Het
Gtf2ird2 C T 5: 134,197,249 P179S possibly damaging Het
Hoga1 A G 19: 42,060,277 I145V probably benign Het
Igfn1 G T 1: 135,967,960 Q1623K probably benign Het
Jsrp1 T A 10: 80,812,106 probably null Het
Krt90 A C 15: 101,562,344 probably null Het
Lrch3 T A 16: 32,988,440 S514T probably benign Het
Mad2l1 T C 6: 66,535,585 V20A probably damaging Het
Malrd1 T C 2: 15,752,895 probably null Het
Matn2 A C 15: 34,423,730 E578A possibly damaging Het
Myof A T 19: 37,939,952 W1050R probably benign Het
Nemp1 T A 10: 127,692,976 I183N probably benign Het
Nid1 A G 13: 13,508,801 T1155A probably benign Het
Nsd1 T C 13: 55,313,693 S2681P probably benign Het
Olfr1191-ps1 T A 2: 88,642,839 V24E possibly damaging Het
Olfr715 T C 7: 107,128,812 T194A probably benign Het
Onecut3 C A 10: 80,513,916 R415S probably damaging Het
Pclo T A 5: 14,714,384 S1005R Het
Ppp1r16b G A 2: 158,751,178 D226N probably damaging Het
R3hcc1l G A 19: 42,563,634 V357M probably damaging Het
Sec63 C T 10: 42,810,909 T475M possibly damaging Het
Serpinh1 A G 7: 99,347,152 Y242H probably damaging Het
Slit2 G T 5: 48,302,487 E1370* probably null Het
Sos2 C A 12: 69,648,536 L142F probably damaging Het
Spag4 T C 2: 156,066,573 L141P possibly damaging Het
Sun1 T C 5: 139,236,689 L570P probably damaging Het
Tars2 A G 3: 95,741,360 V662A probably benign Het
Tmem245 C A 4: 56,899,025 probably null Het
Tpp2 T A 1: 43,960,135 Y356* probably null Het
Trafd1 T C 5: 121,375,815 E303G probably damaging Het
Trim71 T C 9: 114,513,537 E559G possibly damaging Het
Ush2a T A 1: 188,911,944 V4501E possibly damaging Het
Vegfa T C 17: 46,031,539 T118A probably damaging Het
Vmn2r124 A T 17: 18,073,832 H727L probably benign Het
Zdhhc2 T A 8: 40,467,510 V270E probably damaging Het
Zfp112 T C 7: 24,125,572 S326P probably benign Het
Zfp37 T C 4: 62,192,134 D272G possibly damaging Het
Other mutations in Flt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Flt1 APN 5 147580300 critical splice donor site probably null
IGL00469:Flt1 APN 5 147603605 missense probably damaging 0.99
IGL00897:Flt1 APN 5 147589854 missense probably benign 0.25
IGL01111:Flt1 APN 5 147578336 missense probably damaging 1.00
IGL01154:Flt1 APN 5 147576156 missense possibly damaging 0.63
IGL01744:Flt1 APN 5 147571461 missense probably benign 0.01
IGL01973:Flt1 APN 5 147683889 missense probably benign 0.01
IGL02079:Flt1 APN 5 147568831 splice site probably benign
IGL02143:Flt1 APN 5 147578436 missense probably benign 0.00
IGL02156:Flt1 APN 5 147681741 missense probably damaging 0.99
IGL02345:Flt1 APN 5 147582626 missense probably benign 0.20
IGL02548:Flt1 APN 5 147639248 missense probably benign 0.00
IGL02631:Flt1 APN 5 147673574 nonsense probably null
IGL02686:Flt1 APN 5 147588602 missense probably damaging 1.00
IGL02938:Flt1 APN 5 147678299 missense possibly damaging 0.47
IGL03057:Flt1 APN 5 147681924 nonsense probably null
IGL03196:Flt1 APN 5 147615127 critical splice donor site probably null
IGL03205:Flt1 APN 5 147699821 missense probably benign 0.00
IGL03255:Flt1 APN 5 147588521 splice site probably benign
flywheels UTSW 5 147599646 missense probably damaging 1.00
BB008:Flt1 UTSW 5 147588572 missense probably damaging 1.00
BB018:Flt1 UTSW 5 147588572 missense probably damaging 1.00
IGL02837:Flt1 UTSW 5 147655170 missense probably benign 0.32
PIT4402001:Flt1 UTSW 5 147678239 missense probably damaging 1.00
R0013:Flt1 UTSW 5 147571014 splice site probably benign
R0380:Flt1 UTSW 5 147588572 missense probably damaging 1.00
R0448:Flt1 UTSW 5 147566394 splice site probably benign
R0789:Flt1 UTSW 5 147639483 missense probably damaging 1.00
R1005:Flt1 UTSW 5 147681885 missense probably damaging 0.99
R1241:Flt1 UTSW 5 147599646 missense probably damaging 1.00
R1302:Flt1 UTSW 5 147564240 missense possibly damaging 0.93
R1411:Flt1 UTSW 5 147580316 missense probably damaging 1.00
R1615:Flt1 UTSW 5 147639288 missense probably damaging 1.00
R1634:Flt1 UTSW 5 147676430 missense probably damaging 1.00
R1749:Flt1 UTSW 5 147655119 missense probably benign 0.00
R1768:Flt1 UTSW 5 147672709 missense probably damaging 1.00
R1972:Flt1 UTSW 5 147655093 splice site probably benign
R2074:Flt1 UTSW 5 147599606 missense possibly damaging 0.82
R2081:Flt1 UTSW 5 147639422 missense probably damaging 1.00
R2864:Flt1 UTSW 5 147594621 missense possibly damaging 0.68
R2865:Flt1 UTSW 5 147594621 missense possibly damaging 0.68
R3740:Flt1 UTSW 5 147599593 missense probably damaging 1.00
R3820:Flt1 UTSW 5 147700017 splice site probably benign
R4089:Flt1 UTSW 5 147564241 missense probably benign 0.03
R4299:Flt1 UTSW 5 147683907 missense probably benign 0.00
R4570:Flt1 UTSW 5 147594613 missense probably damaging 1.00
R4812:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4853:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4865:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4900:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4906:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4907:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4909:Flt1 UTSW 5 147683939 missense probably benign 0.30
R5072:Flt1 UTSW 5 147683939 missense probably benign 0.30
R5073:Flt1 UTSW 5 147683939 missense probably benign 0.30
R5074:Flt1 UTSW 5 147683939 missense probably benign 0.30
R5218:Flt1 UTSW 5 147681928 missense probably damaging 1.00
R5547:Flt1 UTSW 5 147655138 missense probably damaging 1.00
R5731:Flt1 UTSW 5 147678152 missense probably benign 0.16
R5732:Flt1 UTSW 5 147634483 nonsense probably null
R5804:Flt1 UTSW 5 147580437 splice site probably null
R6107:Flt1 UTSW 5 147603593 missense probably benign 0.15
R6440:Flt1 UTSW 5 147564305 missense possibly damaging 0.79
R6453:Flt1 UTSW 5 147683941 missense possibly damaging 0.80
R6539:Flt1 UTSW 5 147578376 missense probably benign 0.27
R7068:Flt1 UTSW 5 147673634 missense probably damaging 1.00
R7112:Flt1 UTSW 5 147603569 missense probably damaging 1.00
R7195:Flt1 UTSW 5 147603576 missense probably damaging 1.00
R7255:Flt1 UTSW 5 147580406 missense probably damaging 1.00
R7347:Flt1 UTSW 5 147580381 missense probably damaging 1.00
R7469:Flt1 UTSW 5 147603569 missense probably damaging 1.00
R7473:Flt1 UTSW 5 147594595 missense probably damaging 1.00
R7663:Flt1 UTSW 5 147655120 missense probably benign
R7688:Flt1 UTSW 5 147676325 missense probably benign
R7729:Flt1 UTSW 5 147700367 missense probably benign 0.00
R7931:Flt1 UTSW 5 147588572 missense probably damaging 1.00
R8051:Flt1 UTSW 5 147582691 missense probably benign 0.02
R8275:Flt1 UTSW 5 147678147 missense probably damaging 0.99
R8434:Flt1 UTSW 5 147639443 missense probably damaging 0.97
R8442:Flt1 UTSW 5 147576173 missense probably damaging 1.00
R8855:Flt1 UTSW 5 147570872 missense probably benign 0.00
R8855:Flt1 UTSW 5 147681650 missense probably damaging 1.00
R9165:Flt1 UTSW 5 147615237 missense probably damaging 0.99
R9240:Flt1 UTSW 5 147681866 missense probably benign
R9439:Flt1 UTSW 5 147578397 missense probably damaging 1.00
X0064:Flt1 UTSW 5 147673613 missense probably damaging 1.00
Z1088:Flt1 UTSW 5 147681649 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- AACGAGAACTTCTGTCTTCCG -3'
(R):5'- TCCTGCTGAGAGAATCCAAATGTG -3'

Sequencing Primer
(F):5'- CGAAGGATGTCTTCCCCTGTG -3'
(R):5'- TGTACCATGTCTGAGTATCTCATTG -3'
Posted On 2021-03-08