Incidental Mutation 'R8756:Zdhhc2'
ID664172
Institutional Source Beutler Lab
Gene Symbol Zdhhc2
Ensembl Gene ENSMUSG00000039470
Gene Namezinc finger, DHHC domain containing 2
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8756 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location40423815-40510268 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 40467510 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 270 (V270E)
Ref Sequence ENSEMBL: ENSMUSP00000041727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049389] [ENSMUST00000128166] [ENSMUST00000167766]
Predicted Effect probably damaging
Transcript: ENSMUST00000049389
AA Change: V270E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041727
Gene: ENSMUSG00000039470
AA Change: V270E

DomainStartEndE-ValueType
transmembrane domain 16 38 N/A INTRINSIC
Pfam:zf-DHHC 66 248 4.1e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000128166
AA Change: V270E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123070
Gene: ENSMUSG00000039470
AA Change: V270E

DomainStartEndE-ValueType
transmembrane domain 16 38 N/A INTRINSIC
transmembrane domain 48 70 N/A INTRINSIC
Pfam:zf-DHHC 122 248 1.8e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167766
AA Change: V270E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129996
Gene: ENSMUSG00000039470
AA Change: V270E

DomainStartEndE-ValueType
transmembrane domain 16 38 N/A INTRINSIC
Pfam:zf-DHHC 66 248 4.1e-43 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Antxr1 A T 6: 87,188,253 S401T probably damaging Het
Armh1 T A 4: 117,237,664 I60L probably benign Het
Atp8b5 T C 4: 43,342,439 V370A probably damaging Het
Atraid T A 5: 31,054,041 Y184N probably damaging Het
Cp G C 3: 20,005,572 probably null Het
Crebbp A G 16: 4,085,903 I1824T probably benign Het
Cyp2c65 A T 19: 39,061,108 R27* probably null Het
Dtl T C 1: 191,539,259 H725R probably benign Het
Dync1h1 G T 12: 110,616,827 A453S probably benign Het
Fat3 T A 9: 16,376,589 D546V probably damaging Het
Flt1 T C 5: 147,639,414 T595A probably benign Het
Gtf2ird2 C T 5: 134,197,249 P179S possibly damaging Het
Hoga1 A G 19: 42,060,277 I145V probably benign Het
Igfn1 G T 1: 135,967,960 Q1623K probably benign Het
Jsrp1 T A 10: 80,812,106 probably null Het
Krt90 A C 15: 101,562,344 probably null Het
Lrch3 T A 16: 32,988,440 S514T probably benign Het
Mad2l1 T C 6: 66,535,585 V20A probably damaging Het
Malrd1 T C 2: 15,752,895 probably null Het
Matn2 A C 15: 34,423,730 E578A possibly damaging Het
Myof A T 19: 37,939,952 W1050R probably benign Het
Nemp1 T A 10: 127,692,976 I183N probably benign Het
Nid1 A G 13: 13,508,801 T1155A probably benign Het
Nsd1 T C 13: 55,313,693 S2681P probably benign Het
Olfr1191-ps1 T A 2: 88,642,839 V24E possibly damaging Het
Olfr715 T C 7: 107,128,812 T194A probably benign Het
Onecut3 C A 10: 80,513,916 R415S probably damaging Het
Pclo T A 5: 14,714,384 S1005R Het
Ppp1r16b G A 2: 158,751,178 D226N probably damaging Het
R3hcc1l G A 19: 42,563,634 V357M probably damaging Het
Sec63 C T 10: 42,810,909 T475M possibly damaging Het
Serpinh1 A G 7: 99,347,152 Y242H probably damaging Het
Slit2 G T 5: 48,302,487 E1370* probably null Het
Sos2 C A 12: 69,648,536 L142F probably damaging Het
Spag4 T C 2: 156,066,573 L141P possibly damaging Het
Sun1 T C 5: 139,236,689 L570P probably damaging Het
Tars2 A G 3: 95,741,360 V662A probably benign Het
Tmem245 C A 4: 56,899,025 probably null Het
Tpp2 T A 1: 43,960,135 Y356* probably null Het
Trafd1 T C 5: 121,375,815 E303G probably damaging Het
Trim71 T C 9: 114,513,537 E559G possibly damaging Het
Ush2a T A 1: 188,911,944 V4501E possibly damaging Het
Vegfa T C 17: 46,031,539 T118A probably damaging Het
Vmn2r124 A T 17: 18,073,832 H727L probably benign Het
Zfp112 T C 7: 24,125,572 S326P probably benign Het
Zfp37 T C 4: 62,192,134 D272G possibly damaging Het
Other mutations in Zdhhc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01697:Zdhhc2 APN 8 40467419 splice site probably benign
IGL01751:Zdhhc2 APN 8 40473001 missense probably benign
IGL01752:Zdhhc2 APN 8 40473001 missense probably benign
IGL01800:Zdhhc2 APN 8 40464243 missense probably damaging 1.00
IGL02475:Zdhhc2 APN 8 40473025 missense probably null 1.00
IGL02554:Zdhhc2 APN 8 40462114 missense probably damaging 1.00
R0662:Zdhhc2 UTSW 8 40447098 missense probably damaging 1.00
R0720:Zdhhc2 UTSW 8 40472907 splice site probably null
R1511:Zdhhc2 UTSW 8 40467972 missense probably benign 0.00
R4738:Zdhhc2 UTSW 8 40464142 splice site probably null
R5114:Zdhhc2 UTSW 8 40445784 missense probably benign 0.06
R5935:Zdhhc2 UTSW 8 40464236 missense probably damaging 0.96
R6029:Zdhhc2 UTSW 8 40472927 missense probably null
R7210:Zdhhc2 UTSW 8 40467439 missense probably damaging 0.96
R7792:Zdhhc2 UTSW 8 40447141 missense probably benign 0.02
R8805:Zdhhc2 UTSW 8 40445805 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATGACAACTCCCGGGAGATG -3'
(R):5'- GGAACAGCCATCACCTTGACTG -3'

Sequencing Primer
(F):5'- CAGTTGTTGGAGTTCCCCC -3'
(R):5'- TCAGGATATCTGATAGGTGACCCC -3'
Posted On2021-03-08