Incidental Mutation 'R8756:Cyp2c65'
ID664190
Institutional Source Beutler Lab
Gene Symbol Cyp2c65
Ensembl Gene ENSMUSG00000067231
Gene Namecytochrome P450, family 2, subfamily c, polypeptide 65
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R8756 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location39061015-39093944 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 39061108 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 27 (R27*)
Ref Sequence ENSEMBL: ENSMUSP00000084489 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087236]
Predicted Effect probably null
Transcript: ENSMUST00000087236
AA Change: R27*
SMART Domains Protein: ENSMUSP00000084489
Gene: ENSMUSG00000067231
AA Change: R27*

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:p450 30 487 2.1e-160 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Antxr1 A T 6: 87,188,253 S401T probably damaging Het
Armh1 T A 4: 117,237,664 I60L probably benign Het
Atp8b5 T C 4: 43,342,439 V370A probably damaging Het
Atraid T A 5: 31,054,041 Y184N probably damaging Het
Cp G C 3: 20,005,572 probably null Het
Crebbp A G 16: 4,085,903 I1824T probably benign Het
Dtl T C 1: 191,539,259 H725R probably benign Het
Dync1h1 G T 12: 110,616,827 A453S probably benign Het
Fat3 T A 9: 16,376,589 D546V probably damaging Het
Flt1 T C 5: 147,639,414 T595A probably benign Het
Gtf2ird2 C T 5: 134,197,249 P179S possibly damaging Het
Hoga1 A G 19: 42,060,277 I145V probably benign Het
Igfn1 G T 1: 135,967,960 Q1623K probably benign Het
Jsrp1 T A 10: 80,812,106 probably null Het
Krt90 A C 15: 101,562,344 probably null Het
Lrch3 T A 16: 32,988,440 S514T probably benign Het
Mad2l1 T C 6: 66,535,585 V20A probably damaging Het
Malrd1 T C 2: 15,752,895 probably null Het
Matn2 A C 15: 34,423,730 E578A possibly damaging Het
Myof A T 19: 37,939,952 W1050R probably benign Het
Nemp1 T A 10: 127,692,976 I183N probably benign Het
Nid1 A G 13: 13,508,801 T1155A probably benign Het
Nsd1 T C 13: 55,313,693 S2681P probably benign Het
Olfr1191-ps1 T A 2: 88,642,839 V24E possibly damaging Het
Olfr715 T C 7: 107,128,812 T194A probably benign Het
Onecut3 C A 10: 80,513,916 R415S probably damaging Het
Pclo T A 5: 14,714,384 S1005R Het
Ppp1r16b G A 2: 158,751,178 D226N probably damaging Het
R3hcc1l G A 19: 42,563,634 V357M probably damaging Het
Sec63 C T 10: 42,810,909 T475M possibly damaging Het
Serpinh1 A G 7: 99,347,152 Y242H probably damaging Het
Slit2 G T 5: 48,302,487 E1370* probably null Het
Sos2 C A 12: 69,648,536 L142F probably damaging Het
Spag4 T C 2: 156,066,573 L141P possibly damaging Het
Sun1 T C 5: 139,236,689 L570P probably damaging Het
Tars2 A G 3: 95,741,360 V662A probably benign Het
Tmem245 C A 4: 56,899,025 probably null Het
Tpp2 T A 1: 43,960,135 Y356* probably null Het
Trafd1 T C 5: 121,375,815 E303G probably damaging Het
Trim71 T C 9: 114,513,537 E559G possibly damaging Het
Ush2a T A 1: 188,911,944 V4501E possibly damaging Het
Vegfa T C 17: 46,031,539 T118A probably damaging Het
Vmn2r124 A T 17: 18,073,832 H727L probably benign Het
Zdhhc2 T A 8: 40,467,510 V270E probably damaging Het
Zfp112 T C 7: 24,125,572 S326P probably benign Het
Zfp37 T C 4: 62,192,134 D272G possibly damaging Het
Other mutations in Cyp2c65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Cyp2c65 APN 19 39072177 critical splice acceptor site probably null
IGL01124:Cyp2c65 APN 19 39093510 utr 3 prime probably benign
IGL01895:Cyp2c65 APN 19 39072232 missense possibly damaging 0.90
IGL02544:Cyp2c65 APN 19 39090638 missense probably damaging 1.00
R0172:Cyp2c65 UTSW 19 39087656 missense possibly damaging 0.86
R0378:Cyp2c65 UTSW 19 39073218 missense probably benign 0.19
R0517:Cyp2c65 UTSW 19 39082348 splice site probably benign
R0585:Cyp2c65 UTSW 19 39069242 missense probably benign 0.00
R1770:Cyp2c65 UTSW 19 39082198 missense probably benign 0.07
R2051:Cyp2c65 UTSW 19 39082231 missense probably benign 0.12
R2310:Cyp2c65 UTSW 19 39093382 missense probably benign 0.02
R2911:Cyp2c65 UTSW 19 39087682 missense probably damaging 0.96
R4208:Cyp2c65 UTSW 19 39090655 missense probably damaging 1.00
R4258:Cyp2c65 UTSW 19 39093428 missense probably benign 0.41
R4734:Cyp2c65 UTSW 19 39072334 missense probably benign 0.00
R4821:Cyp2c65 UTSW 19 39072191 missense probably damaging 1.00
R4926:Cyp2c65 UTSW 19 39061153 missense probably benign 0.00
R5060:Cyp2c65 UTSW 19 39061070 missense unknown
R5091:Cyp2c65 UTSW 19 39087565 critical splice acceptor site probably null
R5433:Cyp2c65 UTSW 19 39093484 missense probably benign 0.00
R6051:Cyp2c65 UTSW 19 39061166 missense probably benign 0.29
R6182:Cyp2c65 UTSW 19 39061162 missense probably benign 0.18
R6400:Cyp2c65 UTSW 19 39061114 missense possibly damaging 0.80
R6586:Cyp2c65 UTSW 19 39082218 missense possibly damaging 0.89
R6672:Cyp2c65 UTSW 19 39087674 missense probably damaging 1.00
R6850:Cyp2c65 UTSW 19 39069091 missense probably benign 0.15
R8075:Cyp2c65 UTSW 19 39072238 missense probably benign 0.10
R9006:Cyp2c65 UTSW 19 39082270 missense probably damaging 1.00
R9031:Cyp2c65 UTSW 19 39073219 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTGTTTTGTATCAGAGAATCACGG -3'
(R):5'- GCCCATCAAGCTTAGGTAACAG -3'

Sequencing Primer
(F):5'- ATCACGGATGTATTAGCAGTTGTCC -3'
(R):5'- TCTATTGTATAGAGCAGGCCCAGC -3'
Posted On2021-03-08