Incidental Mutation 'R8768:Tnks1bp1'
ID 664201
Institutional Source Beutler Lab
Gene Symbol Tnks1bp1
Ensembl Gene ENSMUSG00000033955
Gene Name tankyrase 1 binding protein 1
Synonyms TAB182
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8768 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 85048022-85073048 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 85070636 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 1562 (Y1562*)
Ref Sequence ENSEMBL: ENSMUSP00000107232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048400] [ENSMUST00000111605]
AlphaFold P58871
Predicted Effect probably null
Transcript: ENSMUST00000048400
AA Change: Y900*
SMART Domains Protein: ENSMUSP00000045767
Gene: ENSMUSG00000033955
AA Change: Y900*

DomainStartEndE-ValueType
low complexity region 77 96 N/A INTRINSIC
low complexity region 292 298 N/A INTRINSIC
low complexity region 809 827 N/A INTRINSIC
low complexity region 868 875 N/A INTRINSIC
Tankyrase_bdg_C 883 1055 1.98e-79 SMART
Predicted Effect probably null
Transcript: ENSMUST00000111605
AA Change: Y1562*
SMART Domains Protein: ENSMUSP00000107232
Gene: ENSMUSG00000033955
AA Change: Y1562*

DomainStartEndE-ValueType
low complexity region 37 44 N/A INTRINSIC
low complexity region 59 72 N/A INTRINSIC
low complexity region 296 316 N/A INTRINSIC
low complexity region 380 391 N/A INTRINSIC
low complexity region 496 518 N/A INTRINSIC
low complexity region 739 758 N/A INTRINSIC
low complexity region 954 960 N/A INTRINSIC
low complexity region 1471 1489 N/A INTRINSIC
low complexity region 1530 1537 N/A INTRINSIC
Tankyrase_bdg_C 1545 1717 1.98e-79 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (76/77)
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr1b A T 1: 36,701,507 C222S probably benign Het
Actrt3 T G 3: 30,597,843 R367S probably damaging Het
Alg1 T C 16: 5,242,552 V379A probably damaging Het
Ankrd36 A G 11: 5,643,763 E456G probably benign Het
Arhgef33 G T 17: 80,373,719 A763S possibly damaging Het
Armc5 T G 7: 128,242,611 V597G probably benign Het
Asb10 G T 5: 24,533,692 R456S probably damaging Het
Asph A G 4: 9,453,417 F702L probably damaging Het
Atf7 T A 15: 102,540,889 T326S probably benign Het
Atxn7l2 T C 3: 108,206,934 N171D probably benign Het
BC049715 T A 6: 136,839,981 M73K possibly damaging Het
C2cd6 A G 1: 59,066,153 V322A probably benign Het
Cadps2 A C 6: 23,382,939 C807W probably damaging Het
Ccdc57 C T 11: 120,897,962 R353H probably benign Het
Ccdc89 T C 7: 90,426,585 M1T probably null Het
Cntn1 G A 15: 92,234,466 V148M probably damaging Het
Csmd3 T A 15: 47,698,176 I1335F Het
Dap3 A G 3: 88,927,027 M294T probably damaging Het
Dbh A G 2: 27,170,316 D168G probably benign Het
Dchs2 C A 3: 83,346,285 A2334E probably benign Het
Dcun1d4 T A 5: 73,520,967 Y102N probably benign Het
Dhtkd1 T C 2: 5,898,722 T918A probably benign Het
Dmgdh C T 13: 93,688,610 T147I possibly damaging Het
Dmxl2 T G 9: 54,393,821 K2335N possibly damaging Het
Efna5 T C 17: 62,881,130 M1V probably null Het
Fpr-rs3 T C 17: 20,624,682 N66D probably damaging Het
Gas2l2 C A 11: 83,423,173 A438S probably benign Het
Hivep3 T C 4: 120,132,324 S1991P probably damaging Het
Hsp90b1 A T 10: 86,705,305 probably null Het
Iars T A 13: 49,724,626 N875K probably damaging Het
Jag1 A C 2: 137,101,601 M225R possibly damaging Het
Jag1 T C 2: 137,090,788 probably benign Het
Kcnn2 C T 18: 45,559,435 S26L possibly damaging Het
Kctd2 T C 11: 115,420,453 S96P probably damaging Het
Klhl25 A G 7: 75,866,611 N422D probably damaging Het
Lhx8 A T 3: 154,322,249 V222E possibly damaging Het
Lrig1 A T 6: 94,654,859 V120D possibly damaging Het
Manba T A 3: 135,551,234 S553T probably damaging Het
Mllt10 T A 2: 18,162,772 S503T probably damaging Het
Nxpe4 A G 9: 48,392,750 N46D probably benign Het
Olfr364-ps1 C T 2: 37,147,004 S264L probably benign Het
Olfr914 A C 9: 38,607,145 K227Q probably benign Het
Pdzd2 C T 15: 12,437,166 E450K probably damaging Het
Phrf1 T A 7: 141,258,738 F615L unknown Het
Plch2 C A 4: 154,998,867 G538V probably damaging Het
Ppp2r2d T A 7: 138,874,168 I235N probably damaging Het
Prdm15 A T 16: 97,837,688 D57E probably benign Het
Psd3 T C 8: 67,964,351 D45G probably damaging Het
Ptger4 T A 15: 5,242,657 R185S probably benign Het
Ptp4a2 T A 4: 129,846,506 M121K probably damaging Het
Ptpre T G 7: 135,681,577 F659V possibly damaging Het
Rad54l2 T G 9: 106,719,610 D199A probably benign Het
Rap1gds1 T C 3: 138,941,760 M556V probably benign Het
Scaf8 T C 17: 3,193,074 V711A probably benign Het
Sesn3 G A 9: 14,314,668 C233Y probably damaging Het
Slc45a1 T A 4: 150,629,749 I680F probably damaging Het
Slco1a6 C T 6: 142,133,171 V133M probably benign Het
Syt6 T C 3: 103,585,534 L119P probably benign Het
Szt2 A C 4: 118,369,416 S2974R unknown Het
Taok1 A T 11: 77,553,886 H454Q probably damaging Het
Tbx10 G A 19: 3,997,303 V136M probably damaging Het
Tespa1 A G 10: 130,362,158 T350A probably benign Het
Trank1 T A 9: 111,389,276 F1908Y probably benign Het
Trav6d-4 A T 14: 52,753,786 H96L possibly damaging Het
Tspoap1 T C 11: 87,778,371 I1490T probably benign Het
Ttc21a T C 9: 119,941,220 F119S probably damaging Het
Ttll3 T G 6: 113,408,988 M594R probably damaging Het
Ttn T A 2: 76,968,446 R495* probably null Het
Twf1 A C 15: 94,581,229 L250V probably damaging Het
Ubr4 A T 4: 139,421,765 E458D Het
Unc50 T C 1: 37,437,163 F135L probably benign Het
Vwa3a T A 7: 120,776,076 I371N probably damaging Het
Zfp180 T C 7: 24,105,736 S527P probably damaging Het
Zfp512 T A 5: 31,473,538 I408N probably damaging Het
Zfp57 A G 17: 37,006,185 T52A probably benign Het
Zranb2 A G 3: 157,541,690 probably benign Het
Other mutations in Tnks1bp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00870:Tnks1bp1 APN 2 85062236 nonsense probably null
IGL00974:Tnks1bp1 APN 2 85062882 missense possibly damaging 0.86
IGL01874:Tnks1bp1 APN 2 85058447 missense probably benign 0.01
IGL02419:Tnks1bp1 APN 2 85071781 missense possibly damaging 0.60
IGL02441:Tnks1bp1 APN 2 85071799 missense probably damaging 1.00
IGL02475:Tnks1bp1 APN 2 85059377 missense probably damaging 1.00
IGL03181:Tnks1bp1 APN 2 85062714 missense probably benign 0.00
K3955:Tnks1bp1 UTSW 2 85062411 missense probably benign 0.01
P0038:Tnks1bp1 UTSW 2 85062411 missense probably benign 0.01
PIT4791001:Tnks1bp1 UTSW 2 85062558 missense probably benign 0.03
R0068:Tnks1bp1 UTSW 2 85062352 missense probably benign 0.12
R0068:Tnks1bp1 UTSW 2 85062352 missense probably benign 0.12
R0164:Tnks1bp1 UTSW 2 85059221 missense possibly damaging 0.94
R0164:Tnks1bp1 UTSW 2 85059221 missense possibly damaging 0.94
R0189:Tnks1bp1 UTSW 2 85070929 missense possibly damaging 0.77
R0454:Tnks1bp1 UTSW 2 85072137 missense probably damaging 1.00
R0650:Tnks1bp1 UTSW 2 85062630 missense possibly damaging 0.68
R0737:Tnks1bp1 UTSW 2 85052536 missense possibly damaging 0.93
R1718:Tnks1bp1 UTSW 2 85071738 missense probably benign 0.44
R1749:Tnks1bp1 UTSW 2 85063067 missense probably benign
R2194:Tnks1bp1 UTSW 2 85063065 missense probably benign 0.06
R2314:Tnks1bp1 UTSW 2 85058915 missense probably benign 0.01
R2379:Tnks1bp1 UTSW 2 85063838 missense probably benign 0.16
R3056:Tnks1bp1 UTSW 2 85070000 nonsense probably null
R3433:Tnks1bp1 UTSW 2 85071016 splice site probably benign
R3751:Tnks1bp1 UTSW 2 85058722 start gained probably benign
R4502:Tnks1bp1 UTSW 2 85062647 nonsense probably null
R4694:Tnks1bp1 UTSW 2 85071722 missense probably damaging 1.00
R4785:Tnks1bp1 UTSW 2 85063034 missense probably damaging 1.00
R5079:Tnks1bp1 UTSW 2 85062626 missense probably damaging 1.00
R5208:Tnks1bp1 UTSW 2 85070632 missense probably damaging 0.96
R5265:Tnks1bp1 UTSW 2 85062754 missense probably benign 0.01
R5512:Tnks1bp1 UTSW 2 85062834 missense probably benign 0.00
R5557:Tnks1bp1 UTSW 2 85063800 missense probably damaging 0.97
R6016:Tnks1bp1 UTSW 2 85052390 missense probably damaging 1.00
R6177:Tnks1bp1 UTSW 2 85059280 start gained probably benign
R6516:Tnks1bp1 UTSW 2 85070727 missense probably damaging 0.97
R6517:Tnks1bp1 UTSW 2 85059345 missense probably benign 0.00
R7032:Tnks1bp1 UTSW 2 85061953 missense probably benign 0.00
R7120:Tnks1bp1 UTSW 2 85072097 missense probably damaging 1.00
R7302:Tnks1bp1 UTSW 2 85052354 missense probably benign 0.24
R7393:Tnks1bp1 UTSW 2 85062866 missense probably benign
R7535:Tnks1bp1 UTSW 2 85063280 nonsense probably null
R7596:Tnks1bp1 UTSW 2 85062713 missense probably benign 0.14
R7680:Tnks1bp1 UTSW 2 85059241 missense probably benign 0.36
R8345:Tnks1bp1 UTSW 2 85062882 missense possibly damaging 0.86
R8413:Tnks1bp1 UTSW 2 85062278 missense probably damaging 1.00
R8936:Tnks1bp1 UTSW 2 85063976 missense probably benign 0.00
R8991:Tnks1bp1 UTSW 2 85063946 missense probably benign 0.00
R9007:Tnks1bp1 UTSW 2 85070704 missense probably damaging 1.00
R9118:Tnks1bp1 UTSW 2 85063376 missense probably damaging 1.00
Z1176:Tnks1bp1 UTSW 2 85063530 missense probably damaging 0.99
Z1177:Tnks1bp1 UTSW 2 85059003 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTCCTGAGCAGTCATGGGAG -3'
(R):5'- TCGAGACCTGAGCAACATGC -3'

Sequencing Primer
(F):5'- GACAGACATAGGCTGTGGGGTATC -3'
(R):5'- GACCTGAGCAACATGCCAGAC -3'
Posted On 2021-03-08