Incidental Mutation 'R8768:Asph'
ID664211
Institutional Source Beutler Lab
Gene Symbol Asph
Ensembl Gene ENSMUSG00000028207
Gene Nameaspartate-beta-hydroxylase
Synonymsaspartyl beta-hydroxylase, BAH, calsequestrin-binding protein, jumbug, 2310005F16Rik, 3110001L23Rik, junctate, cI-37, Junctin
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8768 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location9448069-9669344 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 9453417 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 702 (F702L)
Ref Sequence ENSEMBL: ENSMUSP00000077273 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038841] [ENSMUST00000078139] [ENSMUST00000108339] [ENSMUST00000108340] [ENSMUST00000108348]
Predicted Effect probably benign
Transcript: ENSMUST00000038841
SMART Domains Protein: ENSMUSP00000035649
Gene: ENSMUSG00000041216

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
CRAL_TRIO_N 72 97 5.34e-6 SMART
SEC14 118 276 1.98e-36 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000078139
AA Change: F702L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000077273
Gene: ENSMUSG00000028207
AA Change: F702L

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Asp-B-Hydro_N 52 307 7e-104 PFAM
Pfam:TPR_6 326 357 4.4e-5 PFAM
Pfam:TPR_16 328 398 1.3e-9 PFAM
Pfam:TPR_2 439 470 2.6e-4 PFAM
Pfam:TPR_8 441 470 1.7e-3 PFAM
Pfam:Asp_Arg_Hydrox 574 728 7.6e-58 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108339
AA Change: F619L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103976
Gene: ENSMUSG00000028207
AA Change: F619L

DomainStartEndE-ValueType
Pfam:Asp-B-Hydro_N 1 224 1.6e-80 PFAM
Pfam:TPR_6 243 274 1.4e-4 PFAM
Pfam:TPR_16 245 315 2.5e-9 PFAM
Pfam:TPR_2 356 387 7e-4 PFAM
Pfam:Asp_Arg_Hydrox 489 646 5.3e-64 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108340
AA Change: F686L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000103977
Gene: ENSMUSG00000028207
AA Change: F686L

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Asp-B-Hydro_N 52 291 8.6e-96 PFAM
Pfam:TPR_6 310 341 1.9e-4 PFAM
Pfam:TPR_16 312 382 2.9e-9 PFAM
Pfam:TPR_2 423 454 6.8e-4 PFAM
Pfam:Asp_Arg_Hydrox 556 713 3.8e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108348
SMART Domains Protein: ENSMUSP00000103985
Gene: ENSMUSG00000041216

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
CRAL_TRIO_N 72 97 5.34e-6 SMART
SEC14 118 276 1.98e-36 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is thought to play an important role in calcium homeostasis. The gene is expressed from two promoters and undergoes extensive alternative splicing. The encoded set of proteins share varying amounts of overlap near their N-termini but have substantial variations in their C-terminal domains resulting in distinct functional properties. The longest isoforms (a and f) include a C-terminal Aspartyl/Asparaginyl beta-hydroxylase domain that hydroxylates aspartic acid or asparagine residues in the epidermal growth factor (EGF)-like domains of some proteins, including protein C, coagulation factors VII, IX, and X, and the complement factors C1R and C1S. Other isoforms differ primarily in the C-terminal sequence and lack the hydroxylase domain, and some have been localized to the endoplasmic and sarcoplasmic reticulum. Some of these isoforms are found in complexes with calsequestrin, triadin, and the ryanodine receptor, and have been shown to regulate calcium release from the sarcoplasmic reticulum. Some isoforms have been implicated in metastasis. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for a mutation lacking aspartyl beta-hydroxylase expression exhibit syndactyly, facial dysmorphology, mild hard palate defects, and reduced female fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr1b A T 1: 36,701,507 C222S probably benign Het
Actrt3 T G 3: 30,597,843 R367S probably damaging Het
Alg1 T C 16: 5,242,552 V379A probably damaging Het
Ankrd36 A G 11: 5,643,763 E456G probably benign Het
Arhgef33 G T 17: 80,373,719 A763S possibly damaging Het
Armc5 T G 7: 128,242,611 V597G probably benign Het
Asb10 G T 5: 24,533,692 R456S probably damaging Het
Atf7 T A 15: 102,540,889 T326S probably benign Het
Atxn7l2 T C 3: 108,206,934 N171D probably benign Het
BC049715 T A 6: 136,839,981 M73K possibly damaging Het
C2cd6 A G 1: 59,066,153 V322A probably benign Het
Cadps2 A C 6: 23,382,939 C807W probably damaging Het
Ccdc57 C T 11: 120,897,962 R353H probably benign Het
Ccdc89 T C 7: 90,426,585 M1T probably null Het
Cntn1 G A 15: 92,234,466 V148M probably damaging Het
Csmd3 T A 15: 47,698,176 I1335F Het
Dap3 A G 3: 88,927,027 M294T probably damaging Het
Dbh A G 2: 27,170,316 D168G probably benign Het
Dchs2 C A 3: 83,346,285 A2334E probably benign Het
Dhtkd1 T C 2: 5,898,722 T918A probably benign Het
Dmgdh C T 13: 93,688,610 T147I possibly damaging Het
Dmxl2 T G 9: 54,393,821 K2335N possibly damaging Het
Efna5 T C 17: 62,881,130 M1V probably null Het
Fpr-rs3 T C 17: 20,624,682 N66D probably damaging Het
Gas2l2 C A 11: 83,423,173 A438S probably benign Het
Hivep3 T C 4: 120,132,324 S1991P probably damaging Het
Hsp90b1 A T 10: 86,705,305 probably null Het
Iars T A 13: 49,724,626 N875K probably damaging Het
Jag1 A C 2: 137,101,601 M225R possibly damaging Het
Kcnn2 C T 18: 45,559,435 S26L possibly damaging Het
Kctd2 T C 11: 115,420,453 S96P probably damaging Het
Klhl25 A G 7: 75,866,611 N422D probably damaging Het
Lhx8 A T 3: 154,322,249 V222E possibly damaging Het
Lrig1 A T 6: 94,654,859 V120D possibly damaging Het
Manba T A 3: 135,551,234 S553T probably damaging Het
Mllt10 T A 2: 18,162,772 S503T probably damaging Het
Nxpe4 A G 9: 48,392,750 N46D probably benign Het
Olfr364-ps1 C T 2: 37,147,004 S264L probably benign Het
Olfr914 A C 9: 38,607,145 K227Q probably benign Het
Pdzd2 C T 15: 12,437,166 E450K probably damaging Het
Phrf1 T A 7: 141,258,738 F615L unknown Het
Plch2 C A 4: 154,998,867 G538V probably damaging Het
Ppp2r2d T A 7: 138,874,168 I235N probably damaging Het
Prdm15 A T 16: 97,837,688 D57E probably benign Het
Psd3 T C 8: 67,964,351 D45G probably damaging Het
Ptger4 T A 15: 5,242,657 R185S probably benign Het
Ptp4a2 T A 4: 129,846,506 M121K probably damaging Het
Ptpre T G 7: 135,681,577 F659V possibly damaging Het
Rad54l2 T G 9: 106,719,610 D199A probably benign Het
Rap1gds1 T C 3: 138,941,760 M556V probably benign Het
Scaf8 T C 17: 3,193,074 V711A probably benign Het
Sesn3 G A 9: 14,314,668 C233Y probably damaging Het
Slc45a1 T A 4: 150,629,749 I680F probably damaging Het
Slco1a6 C T 6: 142,133,171 V133M probably benign Het
Syt6 T C 3: 103,585,534 L119P probably benign Het
Szt2 A C 4: 118,369,416 S2974R unknown Het
Taok1 A T 11: 77,553,886 H454Q probably damaging Het
Tbx10 G A 19: 3,997,303 V136M probably damaging Het
Tespa1 A G 10: 130,362,158 T350A probably benign Het
Tnks1bp1 T A 2: 85,070,636 Y1562* probably null Het
Trank1 T A 9: 111,389,276 F1908Y probably benign Het
Trav6d-4 A T 14: 52,753,786 H96L possibly damaging Het
Tspoap1 T C 11: 87,778,371 I1490T probably benign Het
Ttc21a T C 9: 119,941,220 F119S probably damaging Het
Ttll3 T G 6: 113,408,988 M594R probably damaging Het
Ttn T A 2: 76,968,446 R495* probably null Het
Twf1 A C 15: 94,581,229 L250V probably damaging Het
Ubr4 A T 4: 139,421,765 E458D Het
Unc50 T C 1: 37,437,163 F135L probably benign Het
Vwa3a T A 7: 120,776,076 I371N probably damaging Het
Zfp180 T C 7: 24,105,736 S527P probably damaging Het
Zfp512 T A 5: 31,473,538 I408N probably damaging Het
Zfp57 A G 17: 37,006,185 T52A probably benign Het
Other mutations in Asph
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Asph APN 4 9639322 missense probably damaging 1.00
IGL00928:Asph APN 4 9594675 missense probably benign 0.07
IGL01022:Asph APN 4 9601344 missense possibly damaging 0.63
IGL01677:Asph APN 4 9607853 missense probably damaging 1.00
IGL01907:Asph APN 4 9514643 missense possibly damaging 0.59
IGL01958:Asph APN 4 9474904 missense possibly damaging 0.93
IGL01976:Asph APN 4 9475471 missense probably damaging 0.98
IGL01989:Asph APN 4 9602462 splice site probably benign
IGL02379:Asph APN 4 9474980 missense probably damaging 1.00
IGL02444:Asph APN 4 9542319 splice site probably benign
IGL02652:Asph APN 4 9529984 missense probably benign 0.11
IGL02679:Asph APN 4 9601349 missense possibly damaging 0.63
IGL02735:Asph APN 4 9598759 missense probably damaging 1.00
IGL02875:Asph APN 4 9595380 missense probably damaging 1.00
IGL03022:Asph APN 4 9517668 missense possibly damaging 0.48
R0026:Asph UTSW 4 9601361 missense probably damaging 0.97
R0121:Asph UTSW 4 9635918 missense probably damaging 1.00
R0357:Asph UTSW 4 9453314 missense probably benign 0.01
R0410:Asph UTSW 4 9595415 missense probably damaging 1.00
R0554:Asph UTSW 4 9604581 missense probably damaging 0.99
R0577:Asph UTSW 4 9604620 missense probably benign 0.02
R0718:Asph UTSW 4 9514683 splice site probably benign
R0725:Asph UTSW 4 9542275 missense probably damaging 1.00
R1383:Asph UTSW 4 9537807 splice site probably null
R1654:Asph UTSW 4 9453315 missense probably benign 0.31
R1694:Asph UTSW 4 9610869 missense probably damaging 0.99
R1771:Asph UTSW 4 9598773 missense probably damaging 0.99
R1776:Asph UTSW 4 9598773 missense probably damaging 0.99
R1840:Asph UTSW 4 9601340 missense possibly damaging 0.60
R1911:Asph UTSW 4 9453335 missense probably damaging 1.00
R1912:Asph UTSW 4 9453335 missense probably damaging 1.00
R2117:Asph UTSW 4 9517671 nonsense probably null
R2860:Asph UTSW 4 9598277 missense probably damaging 1.00
R2861:Asph UTSW 4 9598277 missense probably damaging 1.00
R2937:Asph UTSW 4 9542314 splice site probably benign
R3907:Asph UTSW 4 9474934 missense probably benign 0.23
R4154:Asph UTSW 4 9639250 nonsense probably null
R4623:Asph UTSW 4 9622005 missense possibly damaging 0.50
R4871:Asph UTSW 4 9531968 missense probably benign 0.02
R5196:Asph UTSW 4 9607830 missense probably damaging 0.99
R5540:Asph UTSW 4 9635906 missense probably damaging 1.00
R5757:Asph UTSW 4 9637722 splice site probably null
R6063:Asph UTSW 4 9531960 missense probably benign 0.05
R6072:Asph UTSW 4 9643533 critical splice donor site probably null
R7016:Asph UTSW 4 9630604 splice site probably null
R7133:Asph UTSW 4 9484575 missense probably benign 0.01
R7154:Asph UTSW 4 9630930 missense possibly damaging 0.85
R7201:Asph UTSW 4 9474917 missense probably damaging 1.00
R7316:Asph UTSW 4 9537746 missense probably benign 0.11
R7455:Asph UTSW 4 9531732 splice site probably null
R7516:Asph UTSW 4 9630940 missense possibly damaging 0.92
R7517:Asph UTSW 4 9517697 missense probably damaging 1.00
R7736:Asph UTSW 4 9621930 missense possibly damaging 0.81
R7818:Asph UTSW 4 9475015 missense probably damaging 1.00
R8356:Asph UTSW 4 9537722 missense probably benign 0.04
R8456:Asph UTSW 4 9537722 missense probably benign 0.04
R8856:Asph UTSW 4 9630947 missense possibly damaging 0.71
Z1088:Asph UTSW 4 9630715 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- TAGAGGTCTCCAGCTGCATG -3'
(R):5'- GCTGTCCCTAATAAGAAAGAAGCC -3'

Sequencing Primer
(F):5'- AAGAGTCATGGTACTTGGACTTC -3'
(R):5'- CCTAATAAGAAAGAAGCCTGAAGTTC -3'
Posted On2021-03-08