Incidental Mutation 'R8768:Cadps2'
ID 664220
Institutional Source Beutler Lab
Gene Symbol Cadps2
Ensembl Gene ENSMUSG00000017978
Gene Name Ca2+-dependent activator protein for secretion 2
Synonyms Caps2, cpd2, A230044C21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8768 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 23262773-23839421 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 23382939 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tryptophan at position 807 (C807W)
Ref Sequence ENSEMBL: ENSMUSP00000111018 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018122] [ENSMUST00000069074] [ENSMUST00000115358] [ENSMUST00000115361] [ENSMUST00000125350] [ENSMUST00000142913] [ENSMUST00000163871] [ENSMUST00000166458]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000018122
AA Change: C807W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000018122
Gene: ENSMUSG00000017978
AA Change: C807W

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 1.14e-52 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000069074
AA Change: C810W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064876
Gene: ENSMUSG00000017978
AA Change: C810W

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 895 5.54e-51 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115358
AA Change: C807W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111015
Gene: ENSMUSG00000017978
AA Change: C807W

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 1.14e-52 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115361
AA Change: C807W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111018
Gene: ENSMUSG00000017978
AA Change: C807W

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 892 1.9e-49 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000125350
AA Change: C452W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115866
Gene: ENSMUSG00000017978
AA Change: C452W

DomainStartEndE-ValueType
C2 14 112 1.51e-1 SMART
PH 137 241 2.94e-11 SMART
DUF1041 446 537 1.9e-49 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000142913
AA Change: C778W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138167
Gene: ENSMUSG00000017978
AA Change: C778W

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 22 39 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
coiled coil region 236 256 N/A INTRINSIC
C2 340 438 1.51e-1 SMART
PH 463 567 2.94e-11 SMART
DUF1041 772 873 1.14e-52 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000163871
AA Change: C807W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128905
Gene: ENSMUSG00000017978
AA Change: C807W

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 7.2e-50 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166458
AA Change: C778W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125972
Gene: ENSMUSG00000017978
AA Change: C778W

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
coiled coil region 236 256 N/A INTRINSIC
C2 340 438 1.51e-1 SMART
PH 463 567 2.94e-11 SMART
DUF1041 772 873 1.05e-51 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calcium-dependent activator of secretion (CAPS) protein family, which are calcium binding proteins that regulate the exocytosis of synaptic and dense-core vesicles in neurons and neuroendocrine cells. Mutations in this gene may contribute to autism susceptibility. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit defects in cerebellum, Purkinje cell and interneuron morphology, paired-pulse facilitation, and behaviors including emotional behavior, vestibuoocular reflex, circadium and sleep patterns, social investigation and nurturing behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr1b A T 1: 36,701,507 C222S probably benign Het
Actrt3 T G 3: 30,597,843 R367S probably damaging Het
Alg1 T C 16: 5,242,552 V379A probably damaging Het
Ankrd36 A G 11: 5,643,763 E456G probably benign Het
Arhgef33 G T 17: 80,373,719 A763S possibly damaging Het
Armc5 T G 7: 128,242,611 V597G probably benign Het
Asb10 G T 5: 24,533,692 R456S probably damaging Het
Asph A G 4: 9,453,417 F702L probably damaging Het
Atf7 T A 15: 102,540,889 T326S probably benign Het
Atxn7l2 T C 3: 108,206,934 N171D probably benign Het
BC049715 T A 6: 136,839,981 M73K possibly damaging Het
C2cd6 A G 1: 59,066,153 V322A probably benign Het
Ccdc57 C T 11: 120,897,962 R353H probably benign Het
Ccdc89 T C 7: 90,426,585 M1T probably null Het
Cntn1 G A 15: 92,234,466 V148M probably damaging Het
Csmd3 T A 15: 47,698,176 I1335F Het
Dap3 A G 3: 88,927,027 M294T probably damaging Het
Dbh A G 2: 27,170,316 D168G probably benign Het
Dchs2 C A 3: 83,346,285 A2334E probably benign Het
Dcun1d4 T A 5: 73,520,967 Y102N probably benign Het
Dhtkd1 T C 2: 5,898,722 T918A probably benign Het
Dmgdh C T 13: 93,688,610 T147I possibly damaging Het
Dmxl2 T G 9: 54,393,821 K2335N possibly damaging Het
Efna5 T C 17: 62,881,130 M1V probably null Het
Fpr-rs3 T C 17: 20,624,682 N66D probably damaging Het
Gas2l2 C A 11: 83,423,173 A438S probably benign Het
Hivep3 T C 4: 120,132,324 S1991P probably damaging Het
Hsp90b1 A T 10: 86,705,305 probably null Het
Iars T A 13: 49,724,626 N875K probably damaging Het
Jag1 A C 2: 137,101,601 M225R possibly damaging Het
Jag1 T C 2: 137,090,788 probably benign Het
Kcnn2 C T 18: 45,559,435 S26L possibly damaging Het
Kctd2 T C 11: 115,420,453 S96P probably damaging Het
Klhl25 A G 7: 75,866,611 N422D probably damaging Het
Lhx8 A T 3: 154,322,249 V222E possibly damaging Het
Lrig1 A T 6: 94,654,859 V120D possibly damaging Het
Manba T A 3: 135,551,234 S553T probably damaging Het
Mllt10 T A 2: 18,162,772 S503T probably damaging Het
Nxpe4 A G 9: 48,392,750 N46D probably benign Het
Olfr364-ps1 C T 2: 37,147,004 S264L probably benign Het
Olfr914 A C 9: 38,607,145 K227Q probably benign Het
Pdzd2 C T 15: 12,437,166 E450K probably damaging Het
Phrf1 T A 7: 141,258,738 F615L unknown Het
Plch2 C A 4: 154,998,867 G538V probably damaging Het
Ppp2r2d T A 7: 138,874,168 I235N probably damaging Het
Prdm15 A T 16: 97,837,688 D57E probably benign Het
Psd3 T C 8: 67,964,351 D45G probably damaging Het
Ptger4 T A 15: 5,242,657 R185S probably benign Het
Ptp4a2 T A 4: 129,846,506 M121K probably damaging Het
Ptpre T G 7: 135,681,577 F659V possibly damaging Het
Rad54l2 T G 9: 106,719,610 D199A probably benign Het
Rap1gds1 T C 3: 138,941,760 M556V probably benign Het
Scaf8 T C 17: 3,193,074 V711A probably benign Het
Sesn3 G A 9: 14,314,668 C233Y probably damaging Het
Slc45a1 T A 4: 150,629,749 I680F probably damaging Het
Slco1a6 C T 6: 142,133,171 V133M probably benign Het
Syt6 T C 3: 103,585,534 L119P probably benign Het
Szt2 A C 4: 118,369,416 S2974R unknown Het
Taok1 A T 11: 77,553,886 H454Q probably damaging Het
Tbx10 G A 19: 3,997,303 V136M probably damaging Het
Tespa1 A G 10: 130,362,158 T350A probably benign Het
Tnks1bp1 T A 2: 85,070,636 Y1562* probably null Het
Trank1 T A 9: 111,389,276 F1908Y probably benign Het
Trav6d-4 A T 14: 52,753,786 H96L possibly damaging Het
Tspoap1 T C 11: 87,778,371 I1490T probably benign Het
Ttc21a T C 9: 119,941,220 F119S probably damaging Het
Ttll3 T G 6: 113,408,988 M594R probably damaging Het
Ttn T A 2: 76,968,446 R495* probably null Het
Twf1 A C 15: 94,581,229 L250V probably damaging Het
Ubr4 A T 4: 139,421,765 E458D Het
Unc50 T C 1: 37,437,163 F135L probably benign Het
Vwa3a T A 7: 120,776,076 I371N probably damaging Het
Zfp180 T C 7: 24,105,736 S527P probably damaging Het
Zfp512 T A 5: 31,473,538 I408N probably damaging Het
Zfp57 A G 17: 37,006,185 T52A probably benign Het
Zranb2 A G 3: 157,541,690 probably benign Het
Other mutations in Cadps2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Cadps2 APN 6 23496874 missense possibly damaging 0.84
IGL01105:Cadps2 APN 6 23321700 splice site probably benign
IGL01317:Cadps2 APN 6 23314173 missense possibly damaging 0.76
IGL01409:Cadps2 APN 6 23587441 missense probably damaging 1.00
IGL01477:Cadps2 APN 6 23263673 missense probably damaging 1.00
IGL01620:Cadps2 APN 6 23587462 missense probably benign 0.19
IGL01674:Cadps2 APN 6 23355852 missense probably damaging 1.00
IGL01675:Cadps2 APN 6 23382905 missense probably damaging 1.00
IGL01895:Cadps2 APN 6 23427275 missense probably damaging 0.98
IGL02095:Cadps2 APN 6 23427310 missense probably benign 0.01
IGL02200:Cadps2 APN 6 23385528 missense probably damaging 1.00
IGL02380:Cadps2 APN 6 23287732 missense probably benign 0.11
IGL02680:Cadps2 APN 6 23838896 missense probably damaging 0.99
IGL02814:Cadps2 APN 6 23321707 missense probably damaging 1.00
IGL02940:Cadps2 APN 6 23496809 missense probably benign 0.08
IGL03061:Cadps2 APN 6 23287660 splice site probably null
IGL03233:Cadps2 APN 6 23263601 missense probably benign 0.10
R0193:Cadps2 UTSW 6 23599440 missense probably benign 0.00
R0389:Cadps2 UTSW 6 23321782 missense possibly damaging 0.88
R0571:Cadps2 UTSW 6 23583412 missense probably damaging 1.00
R0595:Cadps2 UTSW 6 23321704 critical splice donor site probably null
R0620:Cadps2 UTSW 6 23583396 missense probably damaging 1.00
R0723:Cadps2 UTSW 6 23287698 missense probably damaging 0.99
R0831:Cadps2 UTSW 6 23321740 missense possibly damaging 0.88
R0836:Cadps2 UTSW 6 23328776 splice site probably benign
R0942:Cadps2 UTSW 6 23263562 missense probably damaging 1.00
R1099:Cadps2 UTSW 6 23599479 missense probably damaging 1.00
R1120:Cadps2 UTSW 6 23838794 missense probably damaging 1.00
R1216:Cadps2 UTSW 6 23583473 splice site probably benign
R1575:Cadps2 UTSW 6 23429218 missense probably damaging 1.00
R1780:Cadps2 UTSW 6 23320932 critical splice donor site probably null
R1924:Cadps2 UTSW 6 23688858 missense probably damaging 0.99
R1944:Cadps2 UTSW 6 23599480 missense probably damaging 0.99
R1956:Cadps2 UTSW 6 23287686 missense probably damaging 1.00
R1986:Cadps2 UTSW 6 23323380 missense probably damaging 1.00
R2045:Cadps2 UTSW 6 23839122 missense possibly damaging 0.73
R2146:Cadps2 UTSW 6 23838999 intron probably benign
R2147:Cadps2 UTSW 6 23838999 intron probably benign
R2148:Cadps2 UTSW 6 23838999 intron probably benign
R2150:Cadps2 UTSW 6 23838999 intron probably benign
R2219:Cadps2 UTSW 6 23410832 missense probably damaging 1.00
R2264:Cadps2 UTSW 6 23323340 missense probably benign 0.15
R2338:Cadps2 UTSW 6 23838978 splice site probably benign
R3861:Cadps2 UTSW 6 23355861 missense probably damaging 1.00
R3898:Cadps2 UTSW 6 23528126 missense probably damaging 1.00
R3982:Cadps2 UTSW 6 23263531 utr 3 prime probably benign
R4213:Cadps2 UTSW 6 23599463 missense probably damaging 1.00
R4384:Cadps2 UTSW 6 23412988 missense probably benign 0.18
R4432:Cadps2 UTSW 6 23626738 missense probably damaging 0.99
R4609:Cadps2 UTSW 6 23587579 missense probably damaging 1.00
R4806:Cadps2 UTSW 6 23688860 missense probably damaging 0.96
R4977:Cadps2 UTSW 6 23599479 missense probably damaging 1.00
R5174:Cadps2 UTSW 6 23287743 missense probably damaging 1.00
R5267:Cadps2 UTSW 6 23626668 missense possibly damaging 0.79
R5389:Cadps2 UTSW 6 23329104 missense probably damaging 1.00
R5737:Cadps2 UTSW 6 23328805 missense probably benign 0.28
R6074:Cadps2 UTSW 6 23626671 missense probably damaging 1.00
R6254:Cadps2 UTSW 6 23329163 critical splice acceptor site probably null
R6323:Cadps2 UTSW 6 23263578 missense probably benign 0.04
R6463:Cadps2 UTSW 6 23323334 nonsense probably null
R6907:Cadps2 UTSW 6 23599506 missense probably damaging 1.00
R6940:Cadps2 UTSW 6 23302492 missense probably damaging 1.00
R6964:Cadps2 UTSW 6 23583459 missense probably damaging 1.00
R7079:Cadps2 UTSW 6 23323409 missense probably damaging 1.00
R7139:Cadps2 UTSW 6 23410889 missense probably damaging 1.00
R7156:Cadps2 UTSW 6 23688956 missense probably benign 0.02
R7184:Cadps2 UTSW 6 23583429 missense probably benign 0.18
R7325:Cadps2 UTSW 6 23409935 missense unknown
R7526:Cadps2 UTSW 6 23496851 missense probably damaging 1.00
R7546:Cadps2 UTSW 6 23626608 missense probably benign 0.15
R7772:Cadps2 UTSW 6 23390446 missense probably benign 0.00
R7870:Cadps2 UTSW 6 23263642 missense probably benign 0.14
R8040:Cadps2 UTSW 6 23412943 splice site probably benign
R8048:Cadps2 UTSW 6 23838863 missense probably benign 0.14
R8082:Cadps2 UTSW 6 23323314 missense probably damaging 1.00
R8100:Cadps2 UTSW 6 23838809 missense probably damaging 1.00
R8115:Cadps2 UTSW 6 23328898 missense probably benign 0.00
R8497:Cadps2 UTSW 6 23355919 missense probably benign 0.27
R8783:Cadps2 UTSW 6 23302304 missense possibly damaging 0.57
R8804:Cadps2 UTSW 6 23496806 missense probably damaging 1.00
R8832:Cadps2 UTSW 6 23587537 missense possibly damaging 0.52
R8848:Cadps2 UTSW 6 23344257 missense probably damaging 1.00
R8854:Cadps2 UTSW 6 23385508 missense probably damaging 1.00
R8896:Cadps2 UTSW 6 23410877 missense probably damaging 1.00
R8910:Cadps2 UTSW 6 23344224 missense probably benign 0.11
R8921:Cadps2 UTSW 6 23302301 missense probably benign 0.00
R9228:Cadps2 UTSW 6 23688928 missense probably benign 0.00
R9297:Cadps2 UTSW 6 23496888 missense probably benign
R9318:Cadps2 UTSW 6 23496888 missense probably benign
R9348:Cadps2 UTSW 6 23344263 missense probably benign 0.20
Z1176:Cadps2 UTSW 6 23321801 missense probably benign 0.24
Z1177:Cadps2 UTSW 6 23385478 missense possibly damaging 0.88
Z1177:Cadps2 UTSW 6 23626695 missense probably damaging 1.00
Z1177:Cadps2 UTSW 6 23838818 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGCCAGCTGAGATTTTAATGAG -3'
(R):5'- CAAGTTACAGAAGGCCCCTC -3'

Sequencing Primer
(F):5'- GCTGAGATTTTAATGAGACATTTCCC -3'
(R):5'- TTCCCAGGAACACTCAGGG -3'
Posted On 2021-03-08