Incidental Mutation 'R8768:Cadps2'
ID 664220
Institutional Source Beutler Lab
Gene Symbol Cadps2
Ensembl Gene ENSMUSG00000017978
Gene Name Ca2+-dependent activator protein for secretion 2
Synonyms Caps2, A230044C21Rik, cpd2
MMRRC Submission 068623-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8768 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 23262772-23839420 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 23382938 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tryptophan at position 807 (C807W)
Ref Sequence ENSEMBL: ENSMUSP00000111018 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018122] [ENSMUST00000069074] [ENSMUST00000115358] [ENSMUST00000115361] [ENSMUST00000125350] [ENSMUST00000142913] [ENSMUST00000163871] [ENSMUST00000166458]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000018122
AA Change: C807W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000018122
Gene: ENSMUSG00000017978
AA Change: C807W

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 1.14e-52 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000069074
AA Change: C810W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064876
Gene: ENSMUSG00000017978
AA Change: C810W

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 895 5.54e-51 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115358
AA Change: C807W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111015
Gene: ENSMUSG00000017978
AA Change: C807W

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 1.14e-52 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115361
AA Change: C807W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111018
Gene: ENSMUSG00000017978
AA Change: C807W

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 892 1.9e-49 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000125350
AA Change: C452W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115866
Gene: ENSMUSG00000017978
AA Change: C452W

DomainStartEndE-ValueType
C2 14 112 1.51e-1 SMART
PH 137 241 2.94e-11 SMART
DUF1041 446 537 1.9e-49 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000142913
AA Change: C778W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138167
Gene: ENSMUSG00000017978
AA Change: C778W

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 22 39 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
coiled coil region 236 256 N/A INTRINSIC
C2 340 438 1.51e-1 SMART
PH 463 567 2.94e-11 SMART
DUF1041 772 873 1.14e-52 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000163871
AA Change: C807W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128905
Gene: ENSMUSG00000017978
AA Change: C807W

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 7.2e-50 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166458
AA Change: C778W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125972
Gene: ENSMUSG00000017978
AA Change: C778W

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
coiled coil region 236 256 N/A INTRINSIC
C2 340 438 1.51e-1 SMART
PH 463 567 2.94e-11 SMART
DUF1041 772 873 1.05e-51 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calcium-dependent activator of secretion (CAPS) protein family, which are calcium binding proteins that regulate the exocytosis of synaptic and dense-core vesicles in neurons and neuroendocrine cells. Mutations in this gene may contribute to autism susceptibility. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit defects in cerebellum, Purkinje cell and interneuron morphology, paired-pulse facilitation, and behaviors including emotional behavior, vestibuoocular reflex, circadium and sleep patterns, social investigation and nurturing behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr1b A T 1: 36,740,588 (GRCm39) C222S probably benign Het
Actrt3 T G 3: 30,651,992 (GRCm39) R367S probably damaging Het
Alg1 T C 16: 5,060,416 (GRCm39) V379A probably damaging Het
Ankrd36 A G 11: 5,593,763 (GRCm39) E456G probably benign Het
Arhgef33 G T 17: 80,681,148 (GRCm39) A763S possibly damaging Het
Armc5 T G 7: 127,841,783 (GRCm39) V597G probably benign Het
Asb10 G T 5: 24,738,690 (GRCm39) R456S probably damaging Het
Asph A G 4: 9,453,417 (GRCm39) F702L probably damaging Het
Atf7 T A 15: 102,449,324 (GRCm39) T326S probably benign Het
Atxn7l2 T C 3: 108,114,250 (GRCm39) N171D probably benign Het
BC049715 T A 6: 136,816,979 (GRCm39) M73K possibly damaging Het
C2cd6 A G 1: 59,105,312 (GRCm39) V322A probably benign Het
Ccdc57 C T 11: 120,788,788 (GRCm39) R353H probably benign Het
Ccdc89 T C 7: 90,075,793 (GRCm39) M1T probably null Het
Cntn1 G A 15: 92,132,347 (GRCm39) V148M probably damaging Het
Csmd3 T A 15: 47,561,572 (GRCm39) I1335F Het
Dap3 A G 3: 88,834,334 (GRCm39) M294T probably damaging Het
Dbh A G 2: 27,060,328 (GRCm39) D168G probably benign Het
Dchs2 C A 3: 83,253,592 (GRCm39) A2334E probably benign Het
Dcun1d4 T A 5: 73,678,310 (GRCm39) Y102N probably benign Het
Dhtkd1 T C 2: 5,903,533 (GRCm39) T918A probably benign Het
Dmgdh C T 13: 93,825,118 (GRCm39) T147I possibly damaging Het
Dmxl2 T G 9: 54,301,105 (GRCm39) K2335N possibly damaging Het
Efna5 T C 17: 63,188,125 (GRCm39) M1V probably null Het
Fpr-rs3 T C 17: 20,844,944 (GRCm39) N66D probably damaging Het
Gas2l2 C A 11: 83,313,999 (GRCm39) A438S probably benign Het
Hivep3 T C 4: 119,989,521 (GRCm39) S1991P probably damaging Het
Hsp90b1 A T 10: 86,541,169 (GRCm39) probably null Het
Iars1 T A 13: 49,878,102 (GRCm39) N875K probably damaging Het
Jag1 A C 2: 136,943,521 (GRCm39) M225R possibly damaging Het
Jag1 T C 2: 136,932,708 (GRCm39) probably benign Het
Kcnn2 C T 18: 45,692,502 (GRCm39) S26L possibly damaging Het
Kctd2 T C 11: 115,311,279 (GRCm39) S96P probably damaging Het
Klhl25 A G 7: 75,516,359 (GRCm39) N422D probably damaging Het
Lhx8 A T 3: 154,027,886 (GRCm39) V222E possibly damaging Het
Lrig1 A T 6: 94,631,840 (GRCm39) V120D possibly damaging Het
Manba T A 3: 135,256,995 (GRCm39) S553T probably damaging Het
Mllt10 T A 2: 18,167,583 (GRCm39) S503T probably damaging Het
Nxpe4 A G 9: 48,304,050 (GRCm39) N46D probably benign Het
Or1l4b C T 2: 37,037,016 (GRCm39) S264L probably benign Het
Or8b50 A C 9: 38,518,441 (GRCm39) K227Q probably benign Het
Pdzd2 C T 15: 12,437,252 (GRCm39) E450K probably damaging Het
Phrf1 T A 7: 140,838,651 (GRCm39) F615L unknown Het
Plch2 C A 4: 155,083,324 (GRCm39) G538V probably damaging Het
Ppp2r2d T A 7: 138,475,897 (GRCm39) I235N probably damaging Het
Prdm15 A T 16: 97,638,888 (GRCm39) D57E probably benign Het
Psd3 T C 8: 68,417,003 (GRCm39) D45G probably damaging Het
Ptger4 T A 15: 5,272,138 (GRCm39) R185S probably benign Het
Ptp4a2 T A 4: 129,740,299 (GRCm39) M121K probably damaging Het
Ptpre T G 7: 135,283,306 (GRCm39) F659V possibly damaging Het
Rad54l2 T G 9: 106,596,809 (GRCm39) D199A probably benign Het
Rap1gds1 T C 3: 138,647,521 (GRCm39) M556V probably benign Het
Scaf8 T C 17: 3,243,349 (GRCm39) V711A probably benign Het
Sesn3 G A 9: 14,225,964 (GRCm39) C233Y probably damaging Het
Slc45a1 T A 4: 150,714,206 (GRCm39) I680F probably damaging Het
Slco1a6 C T 6: 142,078,897 (GRCm39) V133M probably benign Het
Syt6 T C 3: 103,492,850 (GRCm39) L119P probably benign Het
Szt2 A C 4: 118,226,613 (GRCm39) S2974R unknown Het
Taok1 A T 11: 77,444,712 (GRCm39) H454Q probably damaging Het
Tbx10 G A 19: 4,047,303 (GRCm39) V136M probably damaging Het
Tespa1 A G 10: 130,198,027 (GRCm39) T350A probably benign Het
Tnks1bp1 T A 2: 84,900,980 (GRCm39) Y1562* probably null Het
Trank1 T A 9: 111,218,344 (GRCm39) F1908Y probably benign Het
Trav6d-4 A T 14: 52,991,243 (GRCm39) H96L possibly damaging Het
Tspoap1 T C 11: 87,669,197 (GRCm39) I1490T probably benign Het
Ttc21a T C 9: 119,770,286 (GRCm39) F119S probably damaging Het
Ttll3 T G 6: 113,385,949 (GRCm39) M594R probably damaging Het
Ttn T A 2: 76,798,790 (GRCm39) R495* probably null Het
Twf1 A C 15: 94,479,110 (GRCm39) L250V probably damaging Het
Ubr4 A T 4: 139,149,076 (GRCm39) E458D Het
Unc50 T C 1: 37,476,244 (GRCm39) F135L probably benign Het
Vwa3a T A 7: 120,375,299 (GRCm39) I371N probably damaging Het
Zfp180 T C 7: 23,805,161 (GRCm39) S527P probably damaging Het
Zfp512 T A 5: 31,630,882 (GRCm39) I408N probably damaging Het
Zfp57 A G 17: 37,317,077 (GRCm39) T52A probably benign Het
Zranb2 A G 3: 157,247,327 (GRCm39) probably benign Het
Other mutations in Cadps2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Cadps2 APN 6 23,496,873 (GRCm39) missense possibly damaging 0.84
IGL01105:Cadps2 APN 6 23,321,699 (GRCm39) splice site probably benign
IGL01317:Cadps2 APN 6 23,314,172 (GRCm39) missense possibly damaging 0.76
IGL01409:Cadps2 APN 6 23,587,440 (GRCm39) missense probably damaging 1.00
IGL01477:Cadps2 APN 6 23,263,672 (GRCm39) missense probably damaging 1.00
IGL01620:Cadps2 APN 6 23,587,461 (GRCm39) missense probably benign 0.19
IGL01674:Cadps2 APN 6 23,355,851 (GRCm39) missense probably damaging 1.00
IGL01675:Cadps2 APN 6 23,382,904 (GRCm39) missense probably damaging 1.00
IGL01895:Cadps2 APN 6 23,427,274 (GRCm39) missense probably damaging 0.98
IGL02095:Cadps2 APN 6 23,427,309 (GRCm39) missense probably benign 0.01
IGL02200:Cadps2 APN 6 23,385,527 (GRCm39) missense probably damaging 1.00
IGL02380:Cadps2 APN 6 23,287,731 (GRCm39) missense probably benign 0.11
IGL02680:Cadps2 APN 6 23,838,895 (GRCm39) missense probably damaging 0.99
IGL02814:Cadps2 APN 6 23,321,706 (GRCm39) missense probably damaging 1.00
IGL02940:Cadps2 APN 6 23,496,808 (GRCm39) missense probably benign 0.08
IGL03061:Cadps2 APN 6 23,287,659 (GRCm39) splice site probably null
IGL03233:Cadps2 APN 6 23,263,600 (GRCm39) missense probably benign 0.10
R0193:Cadps2 UTSW 6 23,599,439 (GRCm39) missense probably benign 0.00
R0389:Cadps2 UTSW 6 23,321,781 (GRCm39) missense possibly damaging 0.88
R0571:Cadps2 UTSW 6 23,583,411 (GRCm39) missense probably damaging 1.00
R0595:Cadps2 UTSW 6 23,321,703 (GRCm39) critical splice donor site probably null
R0620:Cadps2 UTSW 6 23,583,395 (GRCm39) missense probably damaging 1.00
R0723:Cadps2 UTSW 6 23,287,697 (GRCm39) missense probably damaging 0.99
R0831:Cadps2 UTSW 6 23,321,739 (GRCm39) missense possibly damaging 0.88
R0836:Cadps2 UTSW 6 23,328,775 (GRCm39) splice site probably benign
R0942:Cadps2 UTSW 6 23,263,561 (GRCm39) missense probably damaging 1.00
R1099:Cadps2 UTSW 6 23,599,478 (GRCm39) missense probably damaging 1.00
R1120:Cadps2 UTSW 6 23,838,793 (GRCm39) missense probably damaging 1.00
R1216:Cadps2 UTSW 6 23,583,472 (GRCm39) splice site probably benign
R1575:Cadps2 UTSW 6 23,429,217 (GRCm39) missense probably damaging 1.00
R1780:Cadps2 UTSW 6 23,320,931 (GRCm39) critical splice donor site probably null
R1924:Cadps2 UTSW 6 23,688,857 (GRCm39) missense probably damaging 0.99
R1944:Cadps2 UTSW 6 23,599,479 (GRCm39) missense probably damaging 0.99
R1956:Cadps2 UTSW 6 23,287,685 (GRCm39) missense probably damaging 1.00
R1986:Cadps2 UTSW 6 23,323,379 (GRCm39) missense probably damaging 1.00
R2045:Cadps2 UTSW 6 23,839,121 (GRCm39) missense possibly damaging 0.73
R2146:Cadps2 UTSW 6 23,838,998 (GRCm39) intron probably benign
R2147:Cadps2 UTSW 6 23,838,998 (GRCm39) intron probably benign
R2148:Cadps2 UTSW 6 23,838,998 (GRCm39) intron probably benign
R2150:Cadps2 UTSW 6 23,838,998 (GRCm39) intron probably benign
R2219:Cadps2 UTSW 6 23,410,831 (GRCm39) missense probably damaging 1.00
R2264:Cadps2 UTSW 6 23,323,339 (GRCm39) missense probably benign 0.15
R2338:Cadps2 UTSW 6 23,838,977 (GRCm39) splice site probably benign
R3861:Cadps2 UTSW 6 23,355,860 (GRCm39) missense probably damaging 1.00
R3898:Cadps2 UTSW 6 23,528,125 (GRCm39) missense probably damaging 1.00
R3982:Cadps2 UTSW 6 23,263,530 (GRCm39) utr 3 prime probably benign
R4213:Cadps2 UTSW 6 23,599,462 (GRCm39) missense probably damaging 1.00
R4384:Cadps2 UTSW 6 23,412,987 (GRCm39) missense probably benign 0.18
R4432:Cadps2 UTSW 6 23,626,737 (GRCm39) missense probably damaging 0.99
R4609:Cadps2 UTSW 6 23,587,578 (GRCm39) missense probably damaging 1.00
R4806:Cadps2 UTSW 6 23,688,859 (GRCm39) missense probably damaging 0.96
R4977:Cadps2 UTSW 6 23,599,478 (GRCm39) missense probably damaging 1.00
R5174:Cadps2 UTSW 6 23,287,742 (GRCm39) missense probably damaging 1.00
R5267:Cadps2 UTSW 6 23,626,667 (GRCm39) missense possibly damaging 0.79
R5389:Cadps2 UTSW 6 23,329,103 (GRCm39) missense probably damaging 1.00
R5737:Cadps2 UTSW 6 23,328,804 (GRCm39) missense probably benign 0.28
R6074:Cadps2 UTSW 6 23,626,670 (GRCm39) missense probably damaging 1.00
R6254:Cadps2 UTSW 6 23,329,162 (GRCm39) critical splice acceptor site probably null
R6323:Cadps2 UTSW 6 23,263,577 (GRCm39) missense probably benign 0.04
R6463:Cadps2 UTSW 6 23,323,333 (GRCm39) nonsense probably null
R6907:Cadps2 UTSW 6 23,599,505 (GRCm39) missense probably damaging 1.00
R6940:Cadps2 UTSW 6 23,302,491 (GRCm39) missense probably damaging 1.00
R6964:Cadps2 UTSW 6 23,583,458 (GRCm39) missense probably damaging 1.00
R7079:Cadps2 UTSW 6 23,323,408 (GRCm39) missense probably damaging 1.00
R7139:Cadps2 UTSW 6 23,410,888 (GRCm39) missense probably damaging 1.00
R7156:Cadps2 UTSW 6 23,688,955 (GRCm39) missense probably benign 0.02
R7184:Cadps2 UTSW 6 23,583,428 (GRCm39) missense probably benign 0.18
R7325:Cadps2 UTSW 6 23,409,934 (GRCm39) missense unknown
R7526:Cadps2 UTSW 6 23,496,850 (GRCm39) missense probably damaging 1.00
R7546:Cadps2 UTSW 6 23,626,607 (GRCm39) missense probably benign 0.15
R7772:Cadps2 UTSW 6 23,390,445 (GRCm39) missense probably benign 0.00
R7870:Cadps2 UTSW 6 23,263,641 (GRCm39) missense probably benign 0.14
R8040:Cadps2 UTSW 6 23,412,942 (GRCm39) splice site probably benign
R8048:Cadps2 UTSW 6 23,838,862 (GRCm39) missense probably benign 0.14
R8082:Cadps2 UTSW 6 23,323,313 (GRCm39) missense probably damaging 1.00
R8100:Cadps2 UTSW 6 23,838,808 (GRCm39) missense probably damaging 1.00
R8115:Cadps2 UTSW 6 23,328,897 (GRCm39) missense probably benign 0.00
R8497:Cadps2 UTSW 6 23,355,918 (GRCm39) missense probably benign 0.27
R8783:Cadps2 UTSW 6 23,302,303 (GRCm39) missense possibly damaging 0.57
R8804:Cadps2 UTSW 6 23,496,805 (GRCm39) missense probably damaging 1.00
R8832:Cadps2 UTSW 6 23,587,536 (GRCm39) missense possibly damaging 0.52
R8848:Cadps2 UTSW 6 23,344,256 (GRCm39) missense probably damaging 1.00
R8854:Cadps2 UTSW 6 23,385,507 (GRCm39) missense probably damaging 1.00
R8896:Cadps2 UTSW 6 23,410,876 (GRCm39) missense probably damaging 1.00
R8910:Cadps2 UTSW 6 23,344,223 (GRCm39) missense probably benign 0.11
R8921:Cadps2 UTSW 6 23,302,300 (GRCm39) missense probably benign 0.00
R9228:Cadps2 UTSW 6 23,688,927 (GRCm39) missense probably benign 0.00
R9297:Cadps2 UTSW 6 23,496,887 (GRCm39) missense probably benign
R9318:Cadps2 UTSW 6 23,496,887 (GRCm39) missense probably benign
R9348:Cadps2 UTSW 6 23,344,262 (GRCm39) missense probably benign 0.20
R9447:Cadps2 UTSW 6 23,323,297 (GRCm39) missense probably damaging 0.96
R9484:Cadps2 UTSW 6 23,626,646 (GRCm39) missense probably benign 0.02
R9492:Cadps2 UTSW 6 23,427,238 (GRCm39) missense probably benign
R9630:Cadps2 UTSW 6 23,587,571 (GRCm39) missense probably benign 0.08
R9729:Cadps2 UTSW 6 23,382,982 (GRCm39) missense probably benign 0.28
Z1176:Cadps2 UTSW 6 23,321,800 (GRCm39) missense probably benign 0.24
Z1177:Cadps2 UTSW 6 23,838,817 (GRCm39) missense probably damaging 1.00
Z1177:Cadps2 UTSW 6 23,626,694 (GRCm39) missense probably damaging 1.00
Z1177:Cadps2 UTSW 6 23,385,477 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TCGCCAGCTGAGATTTTAATGAG -3'
(R):5'- CAAGTTACAGAAGGCCCCTC -3'

Sequencing Primer
(F):5'- GCTGAGATTTTAATGAGACATTTCCC -3'
(R):5'- TTCCCAGGAACACTCAGGG -3'
Posted On 2021-03-08