Incidental Mutation 'R8768:Ppp2r2d'
ID664231
Institutional Source Beutler Lab
Gene Symbol Ppp2r2d
Ensembl Gene ENSMUSG00000041769
Gene Nameprotein phosphatase 2, regulatory subunit B, delta
Synonyms1300017E19Rik, MDS026, D7Ertd753e
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.916) question?
Stock #R8768 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location138846079-138883057 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 138874168 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 235 (I235N)
Ref Sequence ENSEMBL: ENSMUSP00000040321 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041097] [ENSMUST00000136824] [ENSMUST00000148453] [ENSMUST00000155672]
Predicted Effect probably damaging
Transcript: ENSMUST00000041097
AA Change: I235N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040321
Gene: ENSMUSG00000041769
AA Change: I235N

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
WD40 27 62 1.91e1 SMART
WD40 89 129 4.77e0 SMART
WD40 171 210 1.19e0 SMART
WD40 221 261 1.91e1 SMART
WD40 280 318 4.11e1 SMART
WD40 345 376 2.54e2 SMART
WD40 412 449 3.82e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136824
SMART Domains Protein: ENSMUSP00000133380
Gene: ENSMUSG00000041769

DomainStartEndE-ValueType
PDB:3DW8|E 6 69 3e-31 PDB
Blast:WD40 15 57 3e-22 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000148453
SMART Domains Protein: ENSMUSP00000119183
Gene: ENSMUSG00000041769

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
PDB:3DW8|E 14 33 9e-7 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000155672
AA Change: I70N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119004
Gene: ENSMUSG00000041769
AA Change: I70N

DomainStartEndE-ValueType
WD40 6 45 1.19e0 SMART
WD40 56 96 1.91e1 SMART
WD40 115 153 4.11e1 SMART
WD40 180 211 2.54e2 SMART
WD40 247 284 3.82e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172764
SMART Domains Protein: ENSMUSP00000133810
Gene: ENSMUSG00000041769

DomainStartEndE-ValueType
SCOP:d1k32a3 2 103 9e-8 SMART
PDB:3DW8|E 2 127 2e-75 PDB
Blast:WD40 56 96 4e-22 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr1b A T 1: 36,701,507 C222S probably benign Het
Actrt3 T G 3: 30,597,843 R367S probably damaging Het
Alg1 T C 16: 5,242,552 V379A probably damaging Het
Ankrd36 A G 11: 5,643,763 E456G probably benign Het
Arhgef33 G T 17: 80,373,719 A763S possibly damaging Het
Armc5 T G 7: 128,242,611 V597G probably benign Het
Asb10 G T 5: 24,533,692 R456S probably damaging Het
Asph A G 4: 9,453,417 F702L probably damaging Het
Atf7 T A 15: 102,540,889 T326S probably benign Het
Atxn7l2 T C 3: 108,206,934 N171D probably benign Het
BC049715 T A 6: 136,839,981 M73K possibly damaging Het
C2cd6 A G 1: 59,066,153 V322A probably benign Het
Cadps2 A C 6: 23,382,939 C807W probably damaging Het
Ccdc57 C T 11: 120,897,962 R353H probably benign Het
Ccdc89 T C 7: 90,426,585 M1T probably null Het
Cntn1 G A 15: 92,234,466 V148M probably damaging Het
Csmd3 T A 15: 47,698,176 I1335F Het
Dap3 A G 3: 88,927,027 M294T probably damaging Het
Dbh A G 2: 27,170,316 D168G probably benign Het
Dchs2 C A 3: 83,346,285 A2334E probably benign Het
Dhtkd1 T C 2: 5,898,722 T918A probably benign Het
Dmgdh C T 13: 93,688,610 T147I possibly damaging Het
Dmxl2 T G 9: 54,393,821 K2335N possibly damaging Het
Efna5 T C 17: 62,881,130 M1V probably null Het
Fpr-rs3 T C 17: 20,624,682 N66D probably damaging Het
Gas2l2 C A 11: 83,423,173 A438S probably benign Het
Hivep3 T C 4: 120,132,324 S1991P probably damaging Het
Hsp90b1 A T 10: 86,705,305 probably null Het
Iars T A 13: 49,724,626 N875K probably damaging Het
Jag1 A C 2: 137,101,601 M225R possibly damaging Het
Kcnn2 C T 18: 45,559,435 S26L possibly damaging Het
Kctd2 T C 11: 115,420,453 S96P probably damaging Het
Klhl25 A G 7: 75,866,611 N422D probably damaging Het
Lhx8 A T 3: 154,322,249 V222E possibly damaging Het
Lrig1 A T 6: 94,654,859 V120D possibly damaging Het
Manba T A 3: 135,551,234 S553T probably damaging Het
Mllt10 T A 2: 18,162,772 S503T probably damaging Het
Nxpe4 A G 9: 48,392,750 N46D probably benign Het
Olfr364-ps1 C T 2: 37,147,004 S264L probably benign Het
Olfr914 A C 9: 38,607,145 K227Q probably benign Het
Pdzd2 C T 15: 12,437,166 E450K probably damaging Het
Phrf1 T A 7: 141,258,738 F615L unknown Het
Plch2 C A 4: 154,998,867 G538V probably damaging Het
Prdm15 A T 16: 97,837,688 D57E probably benign Het
Psd3 T C 8: 67,964,351 D45G probably damaging Het
Ptger4 T A 15: 5,242,657 R185S probably benign Het
Ptp4a2 T A 4: 129,846,506 M121K probably damaging Het
Ptpre T G 7: 135,681,577 F659V possibly damaging Het
Rad54l2 T G 9: 106,719,610 D199A probably benign Het
Rap1gds1 T C 3: 138,941,760 M556V probably benign Het
Scaf8 T C 17: 3,193,074 V711A probably benign Het
Sesn3 G A 9: 14,314,668 C233Y probably damaging Het
Slc45a1 T A 4: 150,629,749 I680F probably damaging Het
Slco1a6 C T 6: 142,133,171 V133M probably benign Het
Syt6 T C 3: 103,585,534 L119P probably benign Het
Szt2 A C 4: 118,369,416 S2974R unknown Het
Taok1 A T 11: 77,553,886 H454Q probably damaging Het
Tbx10 G A 19: 3,997,303 V136M probably damaging Het
Tespa1 A G 10: 130,362,158 T350A probably benign Het
Tnks1bp1 T A 2: 85,070,636 Y1562* probably null Het
Trank1 T A 9: 111,389,276 F1908Y probably benign Het
Trav6d-4 A T 14: 52,753,786 H96L possibly damaging Het
Tspoap1 T C 11: 87,778,371 I1490T probably benign Het
Ttc21a T C 9: 119,941,220 F119S probably damaging Het
Ttll3 T G 6: 113,408,988 M594R probably damaging Het
Ttn T A 2: 76,968,446 R495* probably null Het
Twf1 A C 15: 94,581,229 L250V probably damaging Het
Ubr4 A T 4: 139,421,765 E458D Het
Unc50 T C 1: 37,437,163 F135L probably benign Het
Vwa3a T A 7: 120,776,076 I371N probably damaging Het
Zfp180 T C 7: 24,105,736 S527P probably damaging Het
Zfp512 T A 5: 31,473,538 I408N probably damaging Het
Zfp57 A G 17: 37,006,185 T52A probably benign Het
Other mutations in Ppp2r2d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Ppp2r2d APN 7 138882211 missense probably benign
IGL01538:Ppp2r2d APN 7 138876635 missense probably damaging 1.00
IGL02266:Ppp2r2d APN 7 138868437 missense probably damaging 0.97
IGL02268:Ppp2r2d APN 7 138872971 missense probably null 1.00
IGL03263:Ppp2r2d APN 7 138872922 nonsense probably null
R0482:Ppp2r2d UTSW 7 138870431 missense probably benign 0.08
R1946:Ppp2r2d UTSW 7 138868467 missense probably damaging 1.00
R4043:Ppp2r2d UTSW 7 138882416 nonsense probably null
R4326:Ppp2r2d UTSW 7 138868485 missense probably damaging 1.00
R6164:Ppp2r2d UTSW 7 138873013 missense probably damaging 0.96
R7076:Ppp2r2d UTSW 7 138876597 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- TATGGGCTCCTCTGTGACAG -3'
(R):5'- GGAGTACTCCTTTATTAGCATAGCCC -3'

Sequencing Primer
(F):5'- GACAGTTTATATGGTCAGTCTCCTGC -3'
(R):5'- CCTTTATTAGCATAGCCCATGGG -3'
Posted On2021-03-08