Incidental Mutation 'R8768:Pdzd2'
ID 664253
Institutional Source Beutler Lab
Gene Symbol Pdzd2
Ensembl Gene ENSMUSG00000022197
Gene Name PDZ domain containing 2
Synonyms Pdzk3, A930022H17Rik, 4930537L06Rik, Gm21706, LOC223364
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock # R8768 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 12359711-12739924 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 12437166 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 450 (E450K)
Ref Sequence ENSEMBL: ENSMUSP00000074788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075317] [ENSMUST00000190929]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000075317
AA Change: E450K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000074788
Gene: ENSMUSG00000022197
AA Change: E450K

DomainStartEndE-ValueType
PDZ 81 179 1.27e-2 SMART
PDZ 342 419 1.51e-18 SMART
PDZ 597 675 5.25e-18 SMART
low complexity region 690 718 N/A INTRINSIC
PDZ 738 817 1.64e-10 SMART
low complexity region 861 869 N/A INTRINSIC
low complexity region 969 984 N/A INTRINSIC
low complexity region 986 1000 N/A INTRINSIC
low complexity region 1436 1459 N/A INTRINSIC
low complexity region 1525 1537 N/A INTRINSIC
low complexity region 1538 1553 N/A INTRINSIC
low complexity region 1567 1586 N/A INTRINSIC
low complexity region 2111 2129 N/A INTRINSIC
low complexity region 2190 2198 N/A INTRINSIC
low complexity region 2335 2354 N/A INTRINSIC
low complexity region 2469 2479 N/A INTRINSIC
PDZ 2589 2666 1.3e-13 SMART
PDZ 2716 2794 9.42e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190929
SMART Domains Protein: ENSMUSP00000140682
Gene: ENSMUSG00000022197

DomainStartEndE-ValueType
PDZ 168 245 3e-20 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains six PDZ domains and shares sequence similarity with pro-interleukin-16 (pro-IL-16). Like pro-IL-16, the encoded protein localizes to the endoplasmic reticulum and is thought to be cleaved by a caspase to produce a secreted peptide containing two PDZ domains. In addition, this gene is upregulated in primary prostate tumors and may be involved in the early stages of prostate tumorigenesis. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit normal response to acute and chronic pain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr1b A T 1: 36,701,507 C222S probably benign Het
Actrt3 T G 3: 30,597,843 R367S probably damaging Het
Alg1 T C 16: 5,242,552 V379A probably damaging Het
Ankrd36 A G 11: 5,643,763 E456G probably benign Het
Arhgef33 G T 17: 80,373,719 A763S possibly damaging Het
Armc5 T G 7: 128,242,611 V597G probably benign Het
Asb10 G T 5: 24,533,692 R456S probably damaging Het
Asph A G 4: 9,453,417 F702L probably damaging Het
Atf7 T A 15: 102,540,889 T326S probably benign Het
Atxn7l2 T C 3: 108,206,934 N171D probably benign Het
BC049715 T A 6: 136,839,981 M73K possibly damaging Het
C2cd6 A G 1: 59,066,153 V322A probably benign Het
Cadps2 A C 6: 23,382,939 C807W probably damaging Het
Ccdc57 C T 11: 120,897,962 R353H probably benign Het
Ccdc89 T C 7: 90,426,585 M1T probably null Het
Cntn1 G A 15: 92,234,466 V148M probably damaging Het
Csmd3 T A 15: 47,698,176 I1335F Het
Dap3 A G 3: 88,927,027 M294T probably damaging Het
Dbh A G 2: 27,170,316 D168G probably benign Het
Dchs2 C A 3: 83,346,285 A2334E probably benign Het
Dcun1d4 T A 5: 73,520,967 Y102N probably benign Het
Dhtkd1 T C 2: 5,898,722 T918A probably benign Het
Dmgdh C T 13: 93,688,610 T147I possibly damaging Het
Dmxl2 T G 9: 54,393,821 K2335N possibly damaging Het
Efna5 T C 17: 62,881,130 M1V probably null Het
Fpr-rs3 T C 17: 20,624,682 N66D probably damaging Het
Gas2l2 C A 11: 83,423,173 A438S probably benign Het
Hivep3 T C 4: 120,132,324 S1991P probably damaging Het
Hsp90b1 A T 10: 86,705,305 probably null Het
Iars T A 13: 49,724,626 N875K probably damaging Het
Jag1 A C 2: 137,101,601 M225R possibly damaging Het
Jag1 T C 2: 137,090,788 probably benign Het
Kcnn2 C T 18: 45,559,435 S26L possibly damaging Het
Kctd2 T C 11: 115,420,453 S96P probably damaging Het
Klhl25 A G 7: 75,866,611 N422D probably damaging Het
Lhx8 A T 3: 154,322,249 V222E possibly damaging Het
Lrig1 A T 6: 94,654,859 V120D possibly damaging Het
Manba T A 3: 135,551,234 S553T probably damaging Het
Mllt10 T A 2: 18,162,772 S503T probably damaging Het
Nxpe4 A G 9: 48,392,750 N46D probably benign Het
Olfr364-ps1 C T 2: 37,147,004 S264L probably benign Het
Olfr914 A C 9: 38,607,145 K227Q probably benign Het
Phrf1 T A 7: 141,258,738 F615L unknown Het
Plch2 C A 4: 154,998,867 G538V probably damaging Het
Ppp2r2d T A 7: 138,874,168 I235N probably damaging Het
Prdm15 A T 16: 97,837,688 D57E probably benign Het
Psd3 T C 8: 67,964,351 D45G probably damaging Het
Ptger4 T A 15: 5,242,657 R185S probably benign Het
Ptp4a2 T A 4: 129,846,506 M121K probably damaging Het
Ptpre T G 7: 135,681,577 F659V possibly damaging Het
Rad54l2 T G 9: 106,719,610 D199A probably benign Het
Rap1gds1 T C 3: 138,941,760 M556V probably benign Het
Scaf8 T C 17: 3,193,074 V711A probably benign Het
Sesn3 G A 9: 14,314,668 C233Y probably damaging Het
Slc45a1 T A 4: 150,629,749 I680F probably damaging Het
Slco1a6 C T 6: 142,133,171 V133M probably benign Het
Syt6 T C 3: 103,585,534 L119P probably benign Het
Szt2 A C 4: 118,369,416 S2974R unknown Het
Taok1 A T 11: 77,553,886 H454Q probably damaging Het
Tbx10 G A 19: 3,997,303 V136M probably damaging Het
Tespa1 A G 10: 130,362,158 T350A probably benign Het
Tnks1bp1 T A 2: 85,070,636 Y1562* probably null Het
Trank1 T A 9: 111,389,276 F1908Y probably benign Het
Trav6d-4 A T 14: 52,753,786 H96L possibly damaging Het
Tspoap1 T C 11: 87,778,371 I1490T probably benign Het
Ttc21a T C 9: 119,941,220 F119S probably damaging Het
Ttll3 T G 6: 113,408,988 M594R probably damaging Het
Ttn T A 2: 76,968,446 R495* probably null Het
Twf1 A C 15: 94,581,229 L250V probably damaging Het
Ubr4 A T 4: 139,421,765 E458D Het
Unc50 T C 1: 37,437,163 F135L probably benign Het
Vwa3a T A 7: 120,776,076 I371N probably damaging Het
Zfp180 T C 7: 24,105,736 S527P probably damaging Het
Zfp512 T A 5: 31,473,538 I408N probably damaging Het
Zfp57 A G 17: 37,006,185 T52A probably benign Het
Zranb2 A G 3: 157,541,690 probably benign Het
Other mutations in Pdzd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Pdzd2 APN 15 12457983 missense possibly damaging 0.93
IGL00586:Pdzd2 APN 15 12365767 splice site probably null
IGL00697:Pdzd2 APN 15 12373647 missense possibly damaging 0.81
IGL00721:Pdzd2 APN 15 12374412 missense probably benign 0.00
IGL00971:Pdzd2 APN 15 12374718 missense probably benign 0.00
IGL01066:Pdzd2 APN 15 12402632 unclassified probably benign
IGL01389:Pdzd2 APN 15 12374626 missense possibly damaging 0.56
IGL01505:Pdzd2 APN 15 12458207 missense probably damaging 1.00
IGL01527:Pdzd2 APN 15 12445664 missense probably damaging 1.00
IGL01584:Pdzd2 APN 15 12592483 missense probably damaging 1.00
IGL01763:Pdzd2 APN 15 12372546 missense probably benign
IGL01915:Pdzd2 APN 15 12371639 missense probably damaging 1.00
IGL01947:Pdzd2 APN 15 12592354 missense probably damaging 1.00
IGL02058:Pdzd2 APN 15 12376296 missense possibly damaging 0.87
IGL02274:Pdzd2 APN 15 12445649 missense probably damaging 1.00
IGL02408:Pdzd2 APN 15 12375765 missense probably benign 0.00
IGL02600:Pdzd2 APN 15 12411019 missense probably damaging 1.00
IGL02637:Pdzd2 APN 15 12385634 missense probably benign 0.13
IGL02639:Pdzd2 APN 15 12592243 missense probably damaging 1.00
IGL02712:Pdzd2 APN 15 12376027 missense probably benign 0.00
IGL02967:Pdzd2 APN 15 12374341 missense probably benign 0.04
IGL02992:Pdzd2 APN 15 12382622 missense possibly damaging 0.77
IGL03005:Pdzd2 APN 15 12385265 missense probably damaging 1.00
IGL03067:Pdzd2 APN 15 12388542 critical splice donor site probably null
IGL03335:Pdzd2 APN 15 12373764 missense probably benign 0.00
PIT4280001:Pdzd2 UTSW 15 12399288 missense probably damaging 1.00
R0022:Pdzd2 UTSW 15 12371605 missense possibly damaging 0.94
R0241:Pdzd2 UTSW 15 12367941 missense probably damaging 1.00
R0241:Pdzd2 UTSW 15 12367941 missense probably damaging 1.00
R0446:Pdzd2 UTSW 15 12375024 missense probably benign 0.43
R0462:Pdzd2 UTSW 15 12592160 missense probably damaging 1.00
R0562:Pdzd2 UTSW 15 12592278 missense probably damaging 1.00
R0589:Pdzd2 UTSW 15 12376299 missense probably benign 0.03
R0639:Pdzd2 UTSW 15 12458058 missense possibly damaging 0.77
R0925:Pdzd2 UTSW 15 12399270 missense probably damaging 1.00
R1015:Pdzd2 UTSW 15 12374508 missense probably damaging 1.00
R1054:Pdzd2 UTSW 15 12371639 missense probably damaging 1.00
R1070:Pdzd2 UTSW 15 12389966 critical splice donor site probably null
R1099:Pdzd2 UTSW 15 12373087 missense probably damaging 1.00
R1122:Pdzd2 UTSW 15 12457895 missense probably benign 0.25
R1126:Pdzd2 UTSW 15 12458220 missense possibly damaging 0.94
R1381:Pdzd2 UTSW 15 12385439 missense probably benign 0.02
R1385:Pdzd2 UTSW 15 12411022 missense probably benign 0.38
R1513:Pdzd2 UTSW 15 12373829 missense possibly damaging 0.88
R1538:Pdzd2 UTSW 15 12372961 missense probably damaging 1.00
R1750:Pdzd2 UTSW 15 12385864 missense probably damaging 1.00
R1775:Pdzd2 UTSW 15 12592460 missense probably damaging 1.00
R1801:Pdzd2 UTSW 15 12387654 missense possibly damaging 0.56
R1832:Pdzd2 UTSW 15 12390048 missense probably damaging 1.00
R1856:Pdzd2 UTSW 15 12373855 missense possibly damaging 0.87
R1870:Pdzd2 UTSW 15 12457886 missense probably damaging 1.00
R1879:Pdzd2 UTSW 15 12373900 missense possibly damaging 0.61
R2072:Pdzd2 UTSW 15 12385819 missense probably damaging 1.00
R2073:Pdzd2 UTSW 15 12385819 missense probably damaging 1.00
R2075:Pdzd2 UTSW 15 12385819 missense probably damaging 1.00
R2125:Pdzd2 UTSW 15 12373590 missense probably benign 0.37
R2142:Pdzd2 UTSW 15 12406559 missense probably damaging 1.00
R2155:Pdzd2 UTSW 15 12375793 missense probably benign 0.43
R2282:Pdzd2 UTSW 15 12373848 missense possibly damaging 0.95
R2407:Pdzd2 UTSW 15 12373161 missense probably damaging 1.00
R3545:Pdzd2 UTSW 15 12375471 missense probably benign 0.00
R3878:Pdzd2 UTSW 15 12376176 missense probably benign 0.00
R3879:Pdzd2 UTSW 15 12375508 missense probably damaging 1.00
R4396:Pdzd2 UTSW 15 12387646 missense probably benign 0.36
R4398:Pdzd2 UTSW 15 12375975 missense probably benign 0.30
R4491:Pdzd2 UTSW 15 12385637 missense possibly damaging 0.75
R4492:Pdzd2 UTSW 15 12385637 missense possibly damaging 0.75
R4492:Pdzd2 UTSW 15 12419481 missense possibly damaging 0.48
R4656:Pdzd2 UTSW 15 12385711 missense probably benign 0.00
R4715:Pdzd2 UTSW 15 12419516 missense possibly damaging 0.72
R4803:Pdzd2 UTSW 15 12374595 missense probably benign 0.04
R4893:Pdzd2 UTSW 15 12385343 missense probably benign 0.00
R4959:Pdzd2 UTSW 15 12375648 missense probably damaging 1.00
R4973:Pdzd2 UTSW 15 12375648 missense probably damaging 1.00
R5030:Pdzd2 UTSW 15 12592408 nonsense probably null
R5174:Pdzd2 UTSW 15 12372514 missense probably benign 0.01
R5230:Pdzd2 UTSW 15 12390033 missense probably damaging 1.00
R5256:Pdzd2 UTSW 15 12372942 missense possibly damaging 0.87
R5268:Pdzd2 UTSW 15 12592177 missense probably damaging 1.00
R5488:Pdzd2 UTSW 15 12382676 missense probably benign 0.00
R5489:Pdzd2 UTSW 15 12382676 missense probably benign 0.00
R5588:Pdzd2 UTSW 15 12374281 missense possibly damaging 0.48
R5605:Pdzd2 UTSW 15 12592350 nonsense probably null
R5704:Pdzd2 UTSW 15 12385675 missense probably benign 0.02
R5858:Pdzd2 UTSW 15 12442589 missense probably damaging 0.97
R6048:Pdzd2 UTSW 15 12592570 splice site probably null
R6222:Pdzd2 UTSW 15 12374566 missense probably damaging 1.00
R6311:Pdzd2 UTSW 15 12458188 missense probably damaging 1.00
R6734:Pdzd2 UTSW 15 12592465 missense probably damaging 1.00
R6897:Pdzd2 UTSW 15 12385865 missense probably damaging 1.00
R6900:Pdzd2 UTSW 15 12374037 missense probably benign
R6955:Pdzd2 UTSW 15 12401464 missense probably damaging 1.00
R6959:Pdzd2 UTSW 15 12375907 missense probably benign 0.17
R6992:Pdzd2 UTSW 15 12457859 missense probably damaging 1.00
R7014:Pdzd2 UTSW 15 12372561 missense probably benign 0.13
R7014:Pdzd2 UTSW 15 12372975 missense probably benign 0.14
R7110:Pdzd2 UTSW 15 12368013 missense probably damaging 1.00
R7180:Pdzd2 UTSW 15 12376123 missense probably damaging 0.99
R7228:Pdzd2 UTSW 15 12372973 missense probably benign 0.01
R7228:Pdzd2 UTSW 15 12458145 nonsense probably null
R7317:Pdzd2 UTSW 15 12592243 missense probably damaging 1.00
R7322:Pdzd2 UTSW 15 12437162 missense probably damaging 1.00
R7349:Pdzd2 UTSW 15 12399205 missense probably damaging 1.00
R7600:Pdzd2 UTSW 15 12372734 missense probably damaging 1.00
R7663:Pdzd2 UTSW 15 12373203 missense probably damaging 1.00
R7712:Pdzd2 UTSW 15 12407336 missense probably damaging 1.00
R7716:Pdzd2 UTSW 15 12373374 missense possibly damaging 0.63
R7740:Pdzd2 UTSW 15 12374016 missense probably benign 0.00
R7748:Pdzd2 UTSW 15 12385786 missense possibly damaging 0.60
R8017:Pdzd2 UTSW 15 12373036 missense probably damaging 1.00
R8019:Pdzd2 UTSW 15 12373036 missense probably damaging 1.00
R8108:Pdzd2 UTSW 15 12373506 missense probably benign 0.01
R8109:Pdzd2 UTSW 15 12373506 missense probably benign 0.01
R8110:Pdzd2 UTSW 15 12373506 missense probably benign 0.01
R8111:Pdzd2 UTSW 15 12373506 missense probably benign 0.01
R8145:Pdzd2 UTSW 15 12407372 missense probably benign 0.37
R8220:Pdzd2 UTSW 15 12592163 missense probably damaging 0.99
R8278:Pdzd2 UTSW 15 12375909 missense probably benign
R8879:Pdzd2 UTSW 15 12402319 missense probably damaging 1.00
R9019:Pdzd2 UTSW 15 12375526 missense probably damaging 1.00
R9030:Pdzd2 UTSW 15 12374299 missense probably benign 0.02
R9061:Pdzd2 UTSW 15 12374667 missense possibly damaging 0.94
R9302:Pdzd2 UTSW 15 12374256 missense possibly damaging 0.61
R9321:Pdzd2 UTSW 15 12385937 missense probably benign 0.00
R9421:Pdzd2 UTSW 15 12375028 missense not run
X0057:Pdzd2 UTSW 15 12411027 missense probably damaging 1.00
X0063:Pdzd2 UTSW 15 12368719 missense possibly damaging 0.77
X0066:Pdzd2 UTSW 15 12372856 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTTCAGAAGTTTCCAGAATGTGC -3'
(R):5'- AACTTCACACACTCTCTGGGTC -3'

Sequencing Primer
(F):5'- GTTTCCAGAATGTGCTGAGAAAG -3'
(R):5'- CTTGTGGCTGGCCTCAG -3'
Posted On 2021-03-08