Incidental Mutation 'R8769:Grik3'
ID 664279
Institutional Source Beutler Lab
Gene Symbol Grik3
Ensembl Gene ENSMUSG00000001985
Gene Name glutamate receptor, ionotropic, kainate 3
Synonyms Glur7, Glur-7
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock # R8769 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 125490700-125714173 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 125656373 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 397 (L397P)
Ref Sequence ENSEMBL: ENSMUSP00000030676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030676]
AlphaFold B1AS29
Predicted Effect probably damaging
Transcript: ENSMUST00000030676
AA Change: L397P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030676
Gene: ENSMUSG00000001985
AA Change: L397P

DomainStartEndE-ValueType
Pfam:ANF_receptor 55 398 7.8e-72 PFAM
PBPe 435 802 4.38e-133 SMART
Lig_chan-Glu_bd 445 509 5.77e-34 SMART
transmembrane domain 823 845 N/A INTRINSIC
Meta Mutation Damage Score 0.9142 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. This gene product belongs to the kainate family of glutamate receptors, which are composed of four subunits and function as ligand-activated ion channels. Transcript variants encoding different isoforms have been described for this gene, however, their full-length nature is not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit significantly reduced short- and long-term synaptic potentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik T A 2: 68,616,245 N289K unknown Het
Adgrl2 T C 3: 148,817,281 I436V Het
Agbl3 C T 6: 34,857,614 S911L probably damaging Het
Ampd2 C T 3: 108,075,297 M714I probably damaging Het
Asb6 T C 2: 30,828,131 D19G possibly damaging Het
Bbx T C 16: 50,240,864 Q298R probably damaging Het
Bcl9l T A 9: 44,508,966 M1223K probably benign Het
Ccr3 T A 9: 124,029,059 F144I possibly damaging Het
Cfap74 T A 4: 155,418,648 F32L Het
Clhc1 G A 11: 29,561,401 E293K probably damaging Het
Col22a1 A T 15: 72,006,722 D195E probably benign Het
Cttnbp2 T A 6: 18,376,004 D1512V probably damaging Het
Cul9 T C 17: 46,521,902 T1372A possibly damaging Het
Dyrk4 G T 6: 126,880,245 D490E possibly damaging Het
E4f1 C T 17: 24,444,600 V626M probably damaging Het
Edc3 C T 9: 57,727,395 R232C probably damaging Het
Eppk1 A G 15: 76,110,695 I662T probably benign Het
Fam214a C A 9: 75,025,825 L1025I probably damaging Het
G3bp2 C T 5: 92,083,497 probably benign Het
Hectd4 A G 5: 121,281,873 N627S possibly damaging Het
Hecw2 C T 1: 53,913,348 V909I probably benign Het
Hsd17b12 A T 2: 94,115,052 M75K probably damaging Het
Htt C T 5: 34,820,289 T809I probably benign Het
Itih1 A G 14: 30,933,424 S609P probably damaging Het
Klk1b9 T A 7: 43,980,242 C234S probably damaging Het
Lrrc37a A G 11: 103,498,710 L1963P probably benign Het
Lypd3 C A 7: 24,638,507 H99Q probably damaging Het
Mdn1 C A 4: 32,751,390 H4593Q probably damaging Het
Mroh1 A G 15: 76,412,926 S325G probably benign Het
Muc5ac G A 7: 141,818,872 G3452R probably damaging Het
Myrfl A T 10: 116,776,791 D884E probably damaging Het
Nbeal1 T A 1: 60,235,211 H260Q probably damaging Het
Ngef A G 1: 87,481,161 L519P probably damaging Het
Olfr1133 A T 2: 87,645,616 F169Y probably damaging Het
Olfr1454 T A 19: 13,063,943 C177* probably null Het
Olfr202 A G 16: 59,283,831 L222P probably damaging Het
Pcca A G 14: 122,616,848 K184R probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Ppp6r1 A T 7: 4,641,290 V379E probably benign Het
Prkca A T 11: 107,951,460 probably benign Het
Prune2 A G 19: 17,123,078 E1982G probably damaging Het
Rad21l T C 2: 151,667,918 T88A probably benign Het
Rpgrip1l T C 8: 91,252,584 probably benign Het
Sec62 T C 3: 30,810,028 probably null Het
Slc22a19 C T 19: 7,692,721 R256Q possibly damaging Het
Slc43a2 G T 11: 75,543,366 probably null Het
Smarcd3 T C 5: 24,598,794 M30V probably benign Het
Tes3-ps T A 13: 49,493,880 D77E probably benign Het
Thbs3 G A 3: 89,224,630 probably benign Het
Trpm2 A T 10: 77,932,294 N790K probably benign Het
Ttc13 A T 8: 124,679,077 N492K possibly damaging Het
Ttc39c T C 18: 12,695,488 L235P probably damaging Het
Tyms T C 5: 30,073,362 probably benign Het
Whamm A T 7: 81,585,185 K333* probably null Het
Ydjc A G 16: 17,150,868 I224V probably benign Het
Zc3hav1 C T 6: 38,336,481 D210N possibly damaging Het
Zfp735 G A 11: 73,690,301 E55K possibly damaging Het
Other mutations in Grik3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01135:Grik3 APN 4 125632415 missense probably benign
IGL01534:Grik3 APN 4 125686190 missense probably damaging 1.00
IGL01538:Grik3 APN 4 125694036 missense possibly damaging 0.90
IGL02276:Grik3 APN 4 125623502 missense possibly damaging 0.86
IGL02323:Grik3 APN 4 125685990 splice site probably benign
IGL02475:Grik3 APN 4 125650517 missense probably benign
IGL03198:Grik3 APN 4 125659762 missense probably benign 0.25
IGL03307:Grik3 APN 4 125641554 missense possibly damaging 0.91
R0054:Grik3 UTSW 4 125623575 missense probably damaging 1.00
R0054:Grik3 UTSW 4 125623575 missense probably damaging 1.00
R0116:Grik3 UTSW 4 125670556 missense probably benign 0.01
R0208:Grik3 UTSW 4 125686165 missense probably damaging 1.00
R0497:Grik3 UTSW 4 125623510 missense possibly damaging 0.82
R1295:Grik3 UTSW 4 125704564 splice site probably benign
R1296:Grik3 UTSW 4 125704564 splice site probably benign
R1515:Grik3 UTSW 4 125670728 missense probably benign 0.37
R1559:Grik3 UTSW 4 125707997 missense probably benign 0.16
R1617:Grik3 UTSW 4 125691192 missense probably benign
R1848:Grik3 UTSW 4 125694138 missense probably damaging 1.00
R2903:Grik3 UTSW 4 125670644 missense probably damaging 1.00
R3440:Grik3 UTSW 4 125693970 missense probably damaging 1.00
R3440:Grik3 UTSW 4 125693971 missense probably damaging 1.00
R3442:Grik3 UTSW 4 125693970 missense probably damaging 1.00
R3442:Grik3 UTSW 4 125693971 missense probably damaging 1.00
R3842:Grik3 UTSW 4 125693954 splice site probably benign
R4649:Grik3 UTSW 4 125650485 missense probably damaging 1.00
R4841:Grik3 UTSW 4 125691176 missense probably damaging 1.00
R4842:Grik3 UTSW 4 125691176 missense probably damaging 1.00
R5093:Grik3 UTSW 4 125670589 missense probably benign
R5318:Grik3 UTSW 4 125694136 missense probably damaging 0.96
R5549:Grik3 UTSW 4 125686045 missense possibly damaging 0.95
R6221:Grik3 UTSW 4 125705123 missense probably damaging 0.99
R6226:Grik3 UTSW 4 125659789 missense probably benign 0.04
R6306:Grik3 UTSW 4 125632412 missense probably benign 0.01
R6672:Grik3 UTSW 4 125623516 missense probably benign 0.08
R6682:Grik3 UTSW 4 125650466 missense probably damaging 1.00
R6783:Grik3 UTSW 4 125632300 missense probably benign 0.01
R7390:Grik3 UTSW 4 125649739 missense probably damaging 1.00
R7604:Grik3 UTSW 4 125623635 missense probably damaging 0.97
R7790:Grik3 UTSW 4 125686019 missense probably damaging 1.00
R7822:Grik3 UTSW 4 125656397 critical splice donor site probably null
R7952:Grik3 UTSW 4 125704547 missense probably damaging 1.00
R8418:Grik3 UTSW 4 125686042 missense possibly damaging 0.95
R9030:Grik3 UTSW 4 125632392 missense probably benign 0.24
R9243:Grik3 UTSW 4 125707897 missense probably benign 0.00
Z1177:Grik3 UTSW 4 125650506 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TATGGAAATCGCTGGCTCGC -3'
(R):5'- TGTAACAGGACCCCACAGTC -3'

Sequencing Primer
(F):5'- AATCATGGTCTTGGGGGAACAGTATC -3'
(R):5'- AGGACCCCACAGTCTCCTCTG -3'
Posted On 2021-03-08