Incidental Mutation 'R8769:G3bp2'
ID 664283
Institutional Source Beutler Lab
Gene Symbol G3bp2
Ensembl Gene ENSMUSG00000029405
Gene Name GTPase activating protein (SH3 domain) binding protein 2
Synonyms G3BP, E430034L04Rik, G3BP2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8769 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 92052146-92083719 bp(-) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) C to T at 92083497 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144456 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113127] [ENSMUST00000164378] [ENSMUST00000167918] [ENSMUST00000169094] [ENSMUST00000201820] [ENSMUST00000202258]
AlphaFold P97379
Predicted Effect probably benign
Transcript: ENSMUST00000113127
SMART Domains Protein: ENSMUSP00000108752
Gene: ENSMUSG00000029405

DomainStartEndE-ValueType
Pfam:NTF2 11 133 8.4e-34 PFAM
low complexity region 140 159 N/A INTRINSIC
low complexity region 186 211 N/A INTRINSIC
low complexity region 214 224 N/A INTRINSIC
low complexity region 254 279 N/A INTRINSIC
RRM 299 372 6.07e-14 SMART
low complexity region 376 427 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164378
SMART Domains Protein: ENSMUSP00000128353
Gene: ENSMUSG00000029405

DomainStartEndE-ValueType
Pfam:NTF2 11 133 5.5e-36 PFAM
low complexity region 140 159 N/A INTRINSIC
low complexity region 186 211 N/A INTRINSIC
low complexity region 214 224 N/A INTRINSIC
low complexity region 287 312 N/A INTRINSIC
RRM 332 405 6.07e-14 SMART
low complexity region 409 460 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167918
SMART Domains Protein: ENSMUSP00000132469
Gene: ENSMUSG00000029405

DomainStartEndE-ValueType
Pfam:NTF2 11 133 8.4e-34 PFAM
low complexity region 140 159 N/A INTRINSIC
low complexity region 186 211 N/A INTRINSIC
low complexity region 214 224 N/A INTRINSIC
low complexity region 254 279 N/A INTRINSIC
RRM 299 372 6.07e-14 SMART
low complexity region 376 427 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169094
SMART Domains Protein: ENSMUSP00000128244
Gene: ENSMUSG00000029405

DomainStartEndE-ValueType
Pfam:NTF2 11 133 1.1e-34 PFAM
low complexity region 140 159 N/A INTRINSIC
low complexity region 186 211 N/A INTRINSIC
low complexity region 214 224 N/A INTRINSIC
low complexity region 287 312 N/A INTRINSIC
RRM 332 405 6.07e-14 SMART
low complexity region 409 460 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201820
SMART Domains Protein: ENSMUSP00000144404
Gene: ENSMUSG00000029405

DomainStartEndE-ValueType
Pfam:NTF2 11 117 9.5e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202258
SMART Domains Protein: ENSMUSP00000144456
Gene: ENSMUSG00000029405

DomainStartEndE-ValueType
Pfam:NTF2 11 133 5.5e-36 PFAM
low complexity region 140 159 N/A INTRINSIC
low complexity region 186 211 N/A INTRINSIC
low complexity region 214 224 N/A INTRINSIC
low complexity region 287 312 N/A INTRINSIC
RRM 332 405 6.07e-14 SMART
low complexity region 409 460 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 97% (57/59)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik T A 2: 68,616,245 N289K unknown Het
Adgrl2 T C 3: 148,817,281 I436V Het
Agbl3 C T 6: 34,857,614 S911L probably damaging Het
Ampd2 C T 3: 108,075,297 M714I probably damaging Het
Asb6 T C 2: 30,828,131 D19G possibly damaging Het
Bbx T C 16: 50,240,864 Q298R probably damaging Het
Bcl9l T A 9: 44,508,966 M1223K probably benign Het
Ccr3 T A 9: 124,029,059 F144I possibly damaging Het
Cfap74 T A 4: 155,418,648 F32L Het
Clhc1 G A 11: 29,561,401 E293K probably damaging Het
Col22a1 A T 15: 72,006,722 D195E probably benign Het
Cttnbp2 T A 6: 18,376,004 D1512V probably damaging Het
Cul9 T C 17: 46,521,902 T1372A possibly damaging Het
Dyrk4 G T 6: 126,880,245 D490E possibly damaging Het
E4f1 C T 17: 24,444,600 V626M probably damaging Het
Edc3 C T 9: 57,727,395 R232C probably damaging Het
Eppk1 A G 15: 76,110,695 I662T probably benign Het
Fam214a C A 9: 75,025,825 L1025I probably damaging Het
Grik3 T C 4: 125,656,373 L397P probably damaging Het
Hectd4 A G 5: 121,281,873 N627S possibly damaging Het
Hecw2 C T 1: 53,913,348 V909I probably benign Het
Hsd17b12 A T 2: 94,115,052 M75K probably damaging Het
Htt C T 5: 34,820,289 T809I probably benign Het
Itih1 A G 14: 30,933,424 S609P probably damaging Het
Klk1b9 T A 7: 43,980,242 C234S probably damaging Het
Lrrc37a A G 11: 103,498,710 L1963P probably benign Het
Lypd3 C A 7: 24,638,507 H99Q probably damaging Het
Mdn1 C A 4: 32,751,390 H4593Q probably damaging Het
Mroh1 A G 15: 76,412,926 S325G probably benign Het
Muc5ac G A 7: 141,818,872 G3452R probably damaging Het
Myrfl A T 10: 116,776,791 D884E probably damaging Het
Nbeal1 T A 1: 60,235,211 H260Q probably damaging Het
Ngef A G 1: 87,481,161 L519P probably damaging Het
Olfr1133 A T 2: 87,645,616 F169Y probably damaging Het
Olfr1454 T A 19: 13,063,943 C177* probably null Het
Olfr202 A G 16: 59,283,831 L222P probably damaging Het
Pcca A G 14: 122,616,848 K184R probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Ppp6r1 A T 7: 4,641,290 V379E probably benign Het
Prkca A T 11: 107,951,460 probably benign Het
Prune2 A G 19: 17,123,078 E1982G probably damaging Het
Rad21l T C 2: 151,667,918 T88A probably benign Het
Rpgrip1l T C 8: 91,252,584 probably benign Het
Sec62 T C 3: 30,810,028 probably null Het
Slc22a19 C T 19: 7,692,721 R256Q possibly damaging Het
Slc43a2 G T 11: 75,543,366 probably null Het
Smarcd3 T C 5: 24,598,794 M30V probably benign Het
Tes3-ps T A 13: 49,493,880 D77E probably benign Het
Thbs3 G A 3: 89,224,630 probably benign Het
Trpm2 A T 10: 77,932,294 N790K probably benign Het
Ttc13 A T 8: 124,679,077 N492K possibly damaging Het
Ttc39c T C 18: 12,695,488 L235P probably damaging Het
Tyms T C 5: 30,073,362 probably benign Het
Whamm A T 7: 81,585,185 K333* probably null Het
Ydjc A G 16: 17,150,868 I224V probably benign Het
Zc3hav1 C T 6: 38,336,481 D210N possibly damaging Het
Zfp735 G A 11: 73,690,301 E55K possibly damaging Het
Other mutations in G3bp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00687:G3bp2 APN 5 92065848 missense probably damaging 0.98
IGL02124:G3bp2 APN 5 92073247 missense possibly damaging 0.92
IGL02519:G3bp2 APN 5 92066524 missense possibly damaging 0.90
IGL03146:G3bp2 APN 5 92066540 missense probably damaging 1.00
IGL03183:G3bp2 APN 5 92055046 missense possibly damaging 0.82
IGL03195:G3bp2 APN 5 92068508 splice site probably benign
IGL03385:G3bp2 APN 5 92068395 missense probably damaging 1.00
R0558:G3bp2 UTSW 5 92073197 missense probably damaging 1.00
R1067:G3bp2 UTSW 5 92063328 splice site probably benign
R1621:G3bp2 UTSW 5 92056278 missense probably damaging 1.00
R2294:G3bp2 UTSW 5 92058028 missense probably damaging 1.00
R3698:G3bp2 UTSW 5 92056280 missense possibly damaging 0.91
R4159:G3bp2 UTSW 5 92064401 missense probably benign 0.00
R4195:G3bp2 UTSW 5 92055416 missense probably damaging 0.99
R4754:G3bp2 UTSW 5 92054909 missense possibly damaging 0.85
R5518:G3bp2 UTSW 5 92068488 missense probably benign 0.00
R5680:G3bp2 UTSW 5 92068360 missense probably damaging 1.00
R5937:G3bp2 UTSW 5 92055397 missense probably damaging 1.00
R8945:G3bp2 UTSW 5 92068422 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTCATCCTAGCAATCCCCAG -3'
(R):5'- TCCAAACTGATGCCTGATTGG -3'

Sequencing Primer
(F):5'- GCGCAGGTCATCCTCCTC -3'
(R):5'- AGCTCGTTGCAGCTCTAGG -3'
Posted On 2021-03-08