Incidental Mutation 'R8769:Agbl3'
ID 664286
Institutional Source Beutler Lab
Gene Symbol Agbl3
Ensembl Gene ENSMUSG00000038836
Gene Name ATP/GTP binding protein-like 3
Synonyms 4930431N21Rik, 2900053G10Rik, 6530406M24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8769 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 34780432-34859459 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 34857614 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Leucine at position 911 (S911L)
Ref Sequence ENSEMBL: ENSMUSP00000110668 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115016] [ENSMUST00000115017] [ENSMUST00000148834]
AlphaFold Q8CDP0
Predicted Effect probably damaging
Transcript: ENSMUST00000115016
AA Change: S911L

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110668
Gene: ENSMUSG00000038836
AA Change: S911L

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Pfam:Peptidase_M14 314 563 2.7e-19 PFAM
low complexity region 614 629 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115017
AA Change: S906L

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110669
Gene: ENSMUSG00000038836
AA Change: S906L

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Pfam:Peptidase_M14 309 560 1e-33 PFAM
low complexity region 609 624 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148834
SMART Domains Protein: ENSMUSP00000116066
Gene: ENSMUSG00000038836

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 97% (57/59)
MGI Phenotype PHENOTYPE: Homozygous mice for a targeted allele are viable and fertile. Mice homozygous for a knock-out allele exhibit normal response to herpes simplex virus (HSV) and vaccinia virus (VACV) infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik T A 2: 68,616,245 N289K unknown Het
Adgrl2 T C 3: 148,817,281 I436V Het
Ampd2 C T 3: 108,075,297 M714I probably damaging Het
Asb6 T C 2: 30,828,131 D19G possibly damaging Het
Bbx T C 16: 50,240,864 Q298R probably damaging Het
Bcl9l T A 9: 44,508,966 M1223K probably benign Het
Ccr3 T A 9: 124,029,059 F144I possibly damaging Het
Cfap74 T A 4: 155,418,648 F32L Het
Clhc1 G A 11: 29,561,401 E293K probably damaging Het
Col22a1 A T 15: 72,006,722 D195E probably benign Het
Cttnbp2 T A 6: 18,376,004 D1512V probably damaging Het
Cul9 T C 17: 46,521,902 T1372A possibly damaging Het
Dyrk4 G T 6: 126,880,245 D490E possibly damaging Het
E4f1 C T 17: 24,444,600 V626M probably damaging Het
Edc3 C T 9: 57,727,395 R232C probably damaging Het
Eppk1 A G 15: 76,110,695 I662T probably benign Het
Fam214a C A 9: 75,025,825 L1025I probably damaging Het
G3bp2 C T 5: 92,083,497 probably benign Het
Grik3 T C 4: 125,656,373 L397P probably damaging Het
Hectd4 A G 5: 121,281,873 N627S possibly damaging Het
Hecw2 C T 1: 53,913,348 V909I probably benign Het
Hsd17b12 A T 2: 94,115,052 M75K probably damaging Het
Htt C T 5: 34,820,289 T809I probably benign Het
Itih1 A G 14: 30,933,424 S609P probably damaging Het
Klk1b9 T A 7: 43,980,242 C234S probably damaging Het
Lrrc37a A G 11: 103,498,710 L1963P probably benign Het
Lypd3 C A 7: 24,638,507 H99Q probably damaging Het
Mdn1 C A 4: 32,751,390 H4593Q probably damaging Het
Mroh1 A G 15: 76,412,926 S325G probably benign Het
Muc5ac G A 7: 141,818,872 G3452R probably damaging Het
Myrfl A T 10: 116,776,791 D884E probably damaging Het
Nbeal1 T A 1: 60,235,211 H260Q probably damaging Het
Ngef A G 1: 87,481,161 L519P probably damaging Het
Olfr1133 A T 2: 87,645,616 F169Y probably damaging Het
Olfr1454 T A 19: 13,063,943 C177* probably null Het
Olfr202 A G 16: 59,283,831 L222P probably damaging Het
Pcca A G 14: 122,616,848 K184R probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Ppp6r1 A T 7: 4,641,290 V379E probably benign Het
Prkca A T 11: 107,951,460 probably benign Het
Prune2 A G 19: 17,123,078 E1982G probably damaging Het
Rad21l T C 2: 151,667,918 T88A probably benign Het
Rpgrip1l T C 8: 91,252,584 probably benign Het
Sec62 T C 3: 30,810,028 probably null Het
Slc22a19 C T 19: 7,692,721 R256Q possibly damaging Het
Slc43a2 G T 11: 75,543,366 probably null Het
Smarcd3 T C 5: 24,598,794 M30V probably benign Het
Tes3-ps T A 13: 49,493,880 D77E probably benign Het
Thbs3 G A 3: 89,224,630 probably benign Het
Trpm2 A T 10: 77,932,294 N790K probably benign Het
Ttc13 A T 8: 124,679,077 N492K possibly damaging Het
Ttc39c T C 18: 12,695,488 L235P probably damaging Het
Tyms T C 5: 30,073,362 probably benign Het
Whamm A T 7: 81,585,185 K333* probably null Het
Ydjc A G 16: 17,150,868 I224V probably benign Het
Zc3hav1 C T 6: 38,336,481 D210N possibly damaging Het
Zfp735 G A 11: 73,690,301 E55K possibly damaging Het
Other mutations in Agbl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Agbl3 APN 6 34846836 missense probably damaging 1.00
IGL00835:Agbl3 APN 6 34799732 missense probably damaging 1.00
IGL00840:Agbl3 APN 6 34799159 missense possibly damaging 0.95
IGL01090:Agbl3 APN 6 34799887 missense probably benign 0.40
IGL01123:Agbl3 APN 6 34846976 nonsense probably null
IGL01707:Agbl3 APN 6 34839454 missense possibly damaging 0.78
IGL01728:Agbl3 APN 6 34782157 start codon destroyed probably null
IGL02335:Agbl3 APN 6 34799750 missense probably damaging 1.00
IGL02420:Agbl3 APN 6 34785307 missense possibly damaging 0.47
IGL02551:Agbl3 APN 6 34823071 missense possibly damaging 0.88
IGL02974:Agbl3 APN 6 34799822 missense probably damaging 1.00
IGL03167:Agbl3 APN 6 34857659 missense possibly damaging 0.92
IGL03182:Agbl3 APN 6 34803500 missense probably damaging 1.00
R0044:Agbl3 UTSW 6 34799899 missense probably damaging 1.00
R0499:Agbl3 UTSW 6 34839335 missense probably benign
R0639:Agbl3 UTSW 6 34799705 missense probably damaging 1.00
R0850:Agbl3 UTSW 6 34799204 missense probably damaging 1.00
R1004:Agbl3 UTSW 6 34803451 missense probably damaging 0.99
R1080:Agbl3 UTSW 6 34828235 missense probably benign 0.14
R1589:Agbl3 UTSW 6 34857517 missense possibly damaging 0.77
R2361:Agbl3 UTSW 6 34832505 missense possibly damaging 0.87
R2495:Agbl3 UTSW 6 34846764 missense probably damaging 1.00
R3236:Agbl3 UTSW 6 34823087 splice site probably null
R3237:Agbl3 UTSW 6 34823087 splice site probably null
R3420:Agbl3 UTSW 6 34793965 missense probably benign 0.36
R3421:Agbl3 UTSW 6 34793965 missense probably benign 0.36
R3422:Agbl3 UTSW 6 34793965 missense probably benign 0.36
R3810:Agbl3 UTSW 6 34799729 missense probably damaging 1.00
R3811:Agbl3 UTSW 6 34799729 missense probably damaging 1.00
R4059:Agbl3 UTSW 6 34846899 missense probably damaging 1.00
R4499:Agbl3 UTSW 6 34857598 missense probably benign 0.00
R4687:Agbl3 UTSW 6 34798326 missense probably damaging 1.00
R4854:Agbl3 UTSW 6 34785284 missense probably damaging 0.97
R5354:Agbl3 UTSW 6 34814752 missense probably benign 0.03
R5386:Agbl3 UTSW 6 34799196 missense probably damaging 1.00
R5897:Agbl3 UTSW 6 34803573 missense probably benign 0.21
R6018:Agbl3 UTSW 6 34799255 missense probably damaging 1.00
R6148:Agbl3 UTSW 6 34857753 missense possibly damaging 0.87
R6305:Agbl3 UTSW 6 34782210 missense unknown
R6525:Agbl3 UTSW 6 34803594 nonsense probably null
R6546:Agbl3 UTSW 6 34799299 missense probably damaging 1.00
R6743:Agbl3 UTSW 6 34846953 missense probably benign 0.03
R6986:Agbl3 UTSW 6 34839452 missense probably benign 0.42
R7023:Agbl3 UTSW 6 34814769 missense probably benign 0.02
R7411:Agbl3 UTSW 6 34814819 missense probably damaging 0.99
R7469:Agbl3 UTSW 6 34814414 missense probably damaging 1.00
R7631:Agbl3 UTSW 6 34857671 missense possibly damaging 0.95
R7658:Agbl3 UTSW 6 34832508 missense probably benign 0.11
R7743:Agbl3 UTSW 6 34846830 missense probably damaging 1.00
R7801:Agbl3 UTSW 6 34839365 missense probably benign 0.00
R8033:Agbl3 UTSW 6 34839494 missense possibly damaging 0.95
R8203:Agbl3 UTSW 6 34799479 missense probably damaging 1.00
R9072:Agbl3 UTSW 6 34799452 missense probably damaging 1.00
R9073:Agbl3 UTSW 6 34799452 missense probably damaging 1.00
R9210:Agbl3 UTSW 6 34798242 missense probably damaging 0.98
R9255:Agbl3 UTSW 6 34812905 missense probably damaging 1.00
RF014:Agbl3 UTSW 6 34799358 missense possibly damaging 0.53
Z1177:Agbl3 UTSW 6 34799408 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGAAACTTTACAGTCTGCATGATG -3'
(R):5'- TAGGCTGCAGAACACTGTTACC -3'

Sequencing Primer
(F):5'- GTCTGCATGATGACAGTATACCTAGG -3'
(R):5'- TGCAGAACACTGTTACCCCTGATG -3'
Posted On 2021-03-08