Incidental Mutation 'R8770:Aox2'
ID 664321
Institutional Source Beutler Lab
Gene Symbol Aox2
Ensembl Gene ENSMUSG00000079554
Gene Name aldehyde oxidase 2
Synonyms Aox3l1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock # R8770 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 58278326-58380259 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 58339604 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Methionine at position 1004 (K1004M)
Ref Sequence ENSEMBL: ENSMUSP00000110006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114366]
AlphaFold Q5SGK3
Predicted Effect probably benign
Transcript: ENSMUST00000114366
AA Change: K1004M

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000110006
Gene: ENSMUSG00000079554
AA Change: K1004M

DomainStartEndE-ValueType
Pfam:Fer2 13 83 3.4e-9 PFAM
Pfam:Fer2_2 92 166 4.2e-30 PFAM
Pfam:FAD_binding_5 241 421 5.1e-46 PFAM
CO_deh_flav_C 428 532 1.4e-23 SMART
Ald_Xan_dh_C 604 707 4.64e-47 SMART
Pfam:Ald_Xan_dh_C2 717 1251 1.3e-178 PFAM
low complexity region 1257 1271 N/A INTRINSIC
low complexity region 1285 1303 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 99% (66/67)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn T C 17: 13,883,937 probably null Het
Atn1 C T 6: 124,745,638 probably null Het
Atp8b4 T C 2: 126,342,995 Y916C probably damaging Het
BC030867 A G 11: 102,255,150 N84S probably benign Het
Bicd1 T C 6: 149,518,950 L766S probably damaging Het
Bmpr2 T G 1: 59,845,525 D223E probably benign Het
Bpifc T G 10: 85,965,265 R406S probably damaging Het
Ccl6 A G 11: 83,588,832 I115T possibly damaging Het
Cdcp1 A T 9: 123,177,861 I607N possibly damaging Het
Cdyl2 T C 8: 116,595,083 Y235C probably damaging Het
Clns1a A G 7: 97,713,910 Q163R probably benign Het
Cntn3 T A 6: 102,277,316 M222L possibly damaging Het
Cpn1 A G 19: 43,963,769 V358A probably damaging Het
Dchs1 G A 7: 105,771,738 R492W probably damaging Het
Dmxl2 T C 9: 54,404,014 T1808A probably benign Het
Dnah10 A G 5: 124,775,346 I1880V possibly damaging Het
Dscam T C 16: 96,654,906 E1274G possibly damaging Het
Dtwd1 A G 2: 126,154,807 T71A probably damaging Het
Dusp4 T A 8: 34,807,784 M19K probably benign Het
Fam46a A G 9: 85,326,750 Y7H probably benign Het
Fbxo39 T C 11: 72,318,459 F382L probably damaging Het
Fbxw20 A T 9: 109,217,528 C455S probably benign Het
Fcmr T A 1: 130,876,062 V201E probably benign Het
Galnt2 C T 8: 124,334,286 R306* probably null Het
Gpr156 A G 16: 38,004,612 E397G possibly damaging Het
Gzmf A T 14: 56,206,494 V73D probably damaging Het
Laptm4b T C 15: 34,258,697 V39A possibly damaging Het
Mlf2 C A 6: 124,934,296 H91Q probably benign Het
Mylk3 T A 8: 85,364,831 E115V probably damaging Het
Myo6 A G 9: 80,264,199 E494G unknown Het
Myo7b C T 18: 31,981,071 D1076N probably benign Het
Neurl1b A G 17: 26,431,913 D53G probably damaging Het
Noc4l A G 5: 110,648,892 L508P possibly damaging Het
Nup210l C A 3: 90,118,543 F157L probably damaging Het
Ogdh T C 11: 6,355,336 Y959H probably damaging Het
Olfr1246 A G 2: 89,590,827 M96T probably benign Het
Olfr159 T G 4: 43,770,813 N66T probably damaging Het
Pik3ap1 A G 19: 41,328,160 Y264H possibly damaging Het
Plb1 T C 5: 32,247,509 Y4H unknown Het
Rad21 A G 15: 51,968,353 I444T probably benign Het
Recql5 T C 11: 115,897,117 I459V probably benign Het
Scaf1 T C 7: 45,006,705 T917A unknown Het
Sdc4 C T 2: 164,428,902 V146I probably damaging Het
Serpina6 T C 12: 103,653,939 S184G probably benign Het
Shkbp1 C A 7: 27,351,886 R218S possibly damaging Het
Slc17a3 A G 13: 23,855,624 D255G Het
Slc7a2 T G 8: 40,899,230 V110G probably damaging Het
Slf1 A C 13: 77,046,647 V853G probably damaging Het
Smarcad1 T C 6: 65,052,734 V102A probably benign Het
Sobp T C 10: 43,160,792 K50R probably damaging Het
Spink10 A T 18: 62,653,461 R47S probably benign Het
Sspo T A 6: 48,474,272 F2720Y probably null Het
Tdrkh T A 3: 94,429,133 V459D probably damaging Het
Tlcd2 T A 11: 75,469,804 D224E probably damaging Het
Tln2 T A 9: 67,323,022 Q87L probably benign Het
Tmem131 A T 1: 36,799,105 probably benign Het
Tmem63a G A 1: 180,962,396 G378R probably benign Het
Trank1 C A 9: 111,390,824 Q2210K probably benign Het
Trim24 T A 6: 37,957,500 probably benign Het
Trim37 T A 11: 87,159,849 I238N probably damaging Het
Vps39 A T 2: 120,323,067 D675E probably benign Het
Wdr63 T C 3: 146,046,543 T793A probably benign Het
Zfp229 T A 17: 21,745,814 C342S probably damaging Het
Zfp759 A G 13: 67,140,353 H656R probably damaging Het
Zfp994 T C 17: 22,200,999 Y323C probably damaging Het
Other mutations in Aox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Aox2 APN 1 58322801 missense possibly damaging 0.73
IGL01288:Aox2 APN 1 58294407 missense probably damaging 0.99
IGL01383:Aox2 APN 1 58294305 missense probably benign 0.09
IGL01734:Aox2 APN 1 58354310 missense possibly damaging 0.95
IGL01793:Aox2 APN 1 58336624 missense possibly damaging 0.79
IGL01834:Aox2 APN 1 58309024 missense possibly damaging 0.90
IGL01924:Aox2 APN 1 58287743 missense possibly damaging 0.90
IGL02591:Aox2 APN 1 58358999 nonsense probably null
IGL02645:Aox2 APN 1 58334724 missense probably damaging 1.00
IGL02710:Aox2 APN 1 58334769 critical splice donor site probably null
IGL02801:Aox2 APN 1 58354177 missense probably damaging 1.00
IGL02988:Aox2 APN 1 58337350 missense probably benign
IGL03104:Aox2 APN 1 58282759 missense probably benign
IGL03121:Aox2 APN 1 58358954 missense probably damaging 1.00
IGL03191:Aox2 APN 1 58359069 missense probably null 0.98
IGL03236:Aox2 APN 1 58309997 nonsense probably null
IGL03409:Aox2 APN 1 58354429 missense possibly damaging 0.91
PIT4362001:Aox2 UTSW 1 58282680 missense probably damaging 1.00
R0035:Aox2 UTSW 1 58354422 missense probably benign 0.00
R0035:Aox2 UTSW 1 58354422 missense probably benign 0.00
R0267:Aox2 UTSW 1 58339446 splice site probably benign
R0388:Aox2 UTSW 1 58354406 missense probably damaging 1.00
R0409:Aox2 UTSW 1 58336624 missense possibly damaging 0.90
R0547:Aox2 UTSW 1 58310042 missense probably damaging 0.96
R0630:Aox2 UTSW 1 58337321 splice site probably benign
R0726:Aox2 UTSW 1 58334782 splice site probably benign
R0734:Aox2 UTSW 1 58305341 missense probably benign 0.22
R0831:Aox2 UTSW 1 58339683 missense probably benign 0.28
R0961:Aox2 UTSW 1 58310071 missense probably benign 0.00
R1404:Aox2 UTSW 1 58346212 splice site probably benign
R1512:Aox2 UTSW 1 58307351 missense probably benign 0.00
R1573:Aox2 UTSW 1 58309027 missense probably benign 0.00
R1592:Aox2 UTSW 1 58300694 missense probably benign 0.00
R1747:Aox2 UTSW 1 58339592 missense probably benign 0.01
R1768:Aox2 UTSW 1 58354195 missense probably benign 0.00
R1809:Aox2 UTSW 1 58294325 missense probably benign
R1823:Aox2 UTSW 1 58312359 missense probably benign 0.02
R1834:Aox2 UTSW 1 58308991 missense probably benign 0.08
R1835:Aox2 UTSW 1 58308991 missense probably benign 0.08
R1836:Aox2 UTSW 1 58308991 missense probably benign 0.08
R2219:Aox2 UTSW 1 58349130 splice site probably null
R2220:Aox2 UTSW 1 58349130 splice site probably null
R2508:Aox2 UTSW 1 58343673 missense probably benign 0.38
R2942:Aox2 UTSW 1 58337381 missense probably benign 0.03
R2967:Aox2 UTSW 1 58322834 missense probably damaging 0.96
R3082:Aox2 UTSW 1 58283600 splice site probably benign
R3161:Aox2 UTSW 1 58304438 missense possibly damaging 0.91
R3408:Aox2 UTSW 1 58343668 missense probably benign 0.32
R3803:Aox2 UTSW 1 58289899 splice site probably null
R3894:Aox2 UTSW 1 58334678 critical splice acceptor site probably null
R4214:Aox2 UTSW 1 58307444 critical splice donor site probably null
R4249:Aox2 UTSW 1 58299819 missense probably benign 0.01
R4666:Aox2 UTSW 1 58304597 nonsense probably null
R4668:Aox2 UTSW 1 58334694 missense possibly damaging 0.63
R4703:Aox2 UTSW 1 58358957 missense possibly damaging 0.78
R4758:Aox2 UTSW 1 58332582 missense probably benign 0.00
R4890:Aox2 UTSW 1 58334703 missense probably benign 0.11
R4900:Aox2 UTSW 1 58305385 missense probably benign
R4924:Aox2 UTSW 1 58305344 missense probably damaging 1.00
R4970:Aox2 UTSW 1 58310095 splice site probably null
R5112:Aox2 UTSW 1 58310095 splice site probably null
R5987:Aox2 UTSW 1 58307359 missense probably benign 0.00
R6239:Aox2 UTSW 1 58305391 critical splice donor site probably null
R6273:Aox2 UTSW 1 58339672 missense probably benign 0.00
R6291:Aox2 UTSW 1 58330806 missense probably damaging 0.98
R6334:Aox2 UTSW 1 58307407 nonsense probably null
R6764:Aox2 UTSW 1 58350282 missense probably damaging 0.97
R6766:Aox2 UTSW 1 58349068 missense possibly damaging 0.95
R6789:Aox2 UTSW 1 58304485 missense probably benign 0.01
R6804:Aox2 UTSW 1 58304598 missense probably benign 0.04
R7007:Aox2 UTSW 1 58330892 missense probably damaging 1.00
R7015:Aox2 UTSW 1 58282758 missense probably benign 0.00
R7055:Aox2 UTSW 1 58299768 missense probably benign 0.08
R7089:Aox2 UTSW 1 58336649 missense probably benign 0.01
R7157:Aox2 UTSW 1 58283492 missense probably benign 0.00
R7303:Aox2 UTSW 1 58334765 nonsense probably null
R7426:Aox2 UTSW 1 58289983 nonsense probably null
R7762:Aox2 UTSW 1 58349104 missense probably damaging 1.00
R7899:Aox2 UTSW 1 58281237 splice site probably null
R7942:Aox2 UTSW 1 58337431 missense probably damaging 1.00
R7975:Aox2 UTSW 1 58309028 missense probably benign 0.02
R8029:Aox2 UTSW 1 58343668 missense probably benign 0.32
R8032:Aox2 UTSW 1 58350283 missense probably benign 0.01
R8147:Aox2 UTSW 1 58300662 missense probably benign 0.02
R8165:Aox2 UTSW 1 58308929 missense probably benign 0.08
R8326:Aox2 UTSW 1 58295887 missense probably benign
R8973:Aox2 UTSW 1 58289954 missense probably benign 0.34
R9015:Aox2 UTSW 1 58343692 missense probably damaging 1.00
R9097:Aox2 UTSW 1 58287728 missense possibly damaging 0.82
R9101:Aox2 UTSW 1 58332637 missense probably benign 0.03
R9108:Aox2 UTSW 1 58282692 missense probably damaging 1.00
R9180:Aox2 UTSW 1 58339618 nonsense probably null
R9258:Aox2 UTSW 1 58312356 missense probably damaging 1.00
R9293:Aox2 UTSW 1 58322794 missense possibly damaging 0.86
R9519:Aox2 UTSW 1 58334767 missense probably damaging 0.98
R9581:Aox2 UTSW 1 58330896 critical splice donor site probably null
Z1177:Aox2 UTSW 1 58354397 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- AGTCACTGTCATAAGTTCTGATGG -3'
(R):5'- ATGAAGCTGATCATGCTTCTGG -3'

Sequencing Primer
(F):5'- CTGATGGAATTTCACACTTGTTTCAG -3'
(R):5'- ATTCAGGGAAATGTGGCATCCTC -3'
Posted On 2021-03-08