Incidental Mutation 'R8770:Nup210l'
ID 664330
Institutional Source Beutler Lab
Gene Symbol Nup210l
Ensembl Gene ENSMUSG00000027939
Gene Name nucleoporin 210-like
Synonyms 4930548O11Rik
MMRRC Submission 068625-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.432) question?
Stock # R8770 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 90011439-90119355 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 90025850 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 157 (F157L)
Ref Sequence ENSEMBL: ENSMUSP00000029548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029548] [ENSMUST00000200410]
AlphaFold Q9D2F7
Predicted Effect probably damaging
Transcript: ENSMUST00000029548
AA Change: F157L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029548
Gene: ENSMUSG00000027939
AA Change: F157L

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
BID_2 457 536 2.05e1 SMART
Blast:S1 949 1023 2e-16 BLAST
BID_2 1077 1152 4.51e-11 SMART
Blast:BID_2 1468 1550 7e-15 BLAST
transmembrane domain 1807 1829 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200410
AA Change: F157L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143368
Gene: ENSMUSG00000027939
AA Change: F157L

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
BID_2 457 536 6.9e-2 SMART
Blast:S1 938 1023 9e-17 BLAST
BID_2 1077 1152 1.5e-13 SMART
Blast:BID_2 1468 1550 7e-15 BLAST
transmembrane domain 1807 1829 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 99% (66/67)
MGI Phenotype PHENOTYPE: Mice homozygous for a transgene insertion exhibit male infertility, asthenozoospermia, teratozoospermia, azoospermia, and seminiferous tubule degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn T C 17: 14,104,199 (GRCm39) probably null Het
Aox1 A T 1: 58,378,763 (GRCm39) K1004M probably benign Het
Atn1 C T 6: 124,722,601 (GRCm39) probably null Het
Atp8b4 T C 2: 126,184,915 (GRCm39) Y916C probably damaging Het
Bicd1 T C 6: 149,420,448 (GRCm39) L766S probably damaging Het
Bmpr2 T G 1: 59,884,684 (GRCm39) D223E probably benign Het
Bpifc T G 10: 85,801,129 (GRCm39) R406S probably damaging Het
Ccl6 A G 11: 83,479,658 (GRCm39) I115T possibly damaging Het
Cdcp1 A T 9: 123,006,926 (GRCm39) I607N possibly damaging Het
Cdyl2 T C 8: 117,321,822 (GRCm39) Y235C probably damaging Het
Clns1a A G 7: 97,363,117 (GRCm39) Q163R probably benign Het
Cntn3 T A 6: 102,254,277 (GRCm39) M222L possibly damaging Het
Cpn1 A G 19: 43,952,208 (GRCm39) V358A probably damaging Het
Dchs1 G A 7: 105,420,945 (GRCm39) R492W probably damaging Het
Dmxl2 T C 9: 54,311,298 (GRCm39) T1808A probably benign Het
Dnah10 A G 5: 124,852,410 (GRCm39) I1880V possibly damaging Het
Dnai3 T C 3: 145,752,298 (GRCm39) T793A probably benign Het
Dscam T C 16: 96,456,106 (GRCm39) E1274G possibly damaging Het
Dtwd1 A G 2: 125,996,727 (GRCm39) T71A probably damaging Het
Dusp4 T A 8: 35,274,938 (GRCm39) M19K probably benign Het
Fbxo39 T C 11: 72,209,285 (GRCm39) F382L probably damaging Het
Fbxw20 A T 9: 109,046,596 (GRCm39) C455S probably benign Het
Fcmr T A 1: 130,803,799 (GRCm39) V201E probably benign Het
Galnt2 C T 8: 125,061,025 (GRCm39) R306* probably null Het
Gpr156 A G 16: 37,824,974 (GRCm39) E397G possibly damaging Het
Gzmf A T 14: 56,443,951 (GRCm39) V73D probably damaging Het
Hrob A G 11: 102,145,976 (GRCm39) N84S probably benign Het
Laptm4b T C 15: 34,258,843 (GRCm39) V39A possibly damaging Het
Mlf2 C A 6: 124,911,259 (GRCm39) H91Q probably benign Het
Mylk3 T A 8: 86,091,460 (GRCm39) E115V probably damaging Het
Myo6 A G 9: 80,171,481 (GRCm39) E494G unknown Het
Myo7b C T 18: 32,114,124 (GRCm39) D1076N probably benign Het
Neurl1b A G 17: 26,650,887 (GRCm39) D53G probably damaging Het
Noc4l A G 5: 110,796,758 (GRCm39) L508P possibly damaging Het
Ogdh T C 11: 6,305,336 (GRCm39) Y959H probably damaging Het
Or13c7d T G 4: 43,770,813 (GRCm39) N66T probably damaging Het
Or4a73 A G 2: 89,421,171 (GRCm39) M96T probably benign Het
Pik3ap1 A G 19: 41,316,599 (GRCm39) Y264H possibly damaging Het
Plb1 T C 5: 32,404,853 (GRCm39) Y4H unknown Het
Rad21 A G 15: 51,831,749 (GRCm39) I444T probably benign Het
Recql5 T C 11: 115,787,943 (GRCm39) I459V probably benign Het
Scaf1 T C 7: 44,656,129 (GRCm39) T917A unknown Het
Sdc4 C T 2: 164,270,822 (GRCm39) V146I probably damaging Het
Serpina6 T C 12: 103,620,198 (GRCm39) S184G probably benign Het
Shkbp1 C A 7: 27,051,311 (GRCm39) R218S possibly damaging Het
Slc17a3 A G 13: 24,039,607 (GRCm39) D255G Het
Slc7a2 T G 8: 41,352,267 (GRCm39) V110G probably damaging Het
Slf1 A C 13: 77,194,766 (GRCm39) V853G probably damaging Het
Smarcad1 T C 6: 65,029,718 (GRCm39) V102A probably benign Het
Sobp T C 10: 43,036,788 (GRCm39) K50R probably damaging Het
Spink10 A T 18: 62,786,532 (GRCm39) R47S probably benign Het
Sspo T A 6: 48,451,206 (GRCm39) F2720Y probably null Het
Tdrkh T A 3: 94,336,440 (GRCm39) V459D probably damaging Het
Tent5a A G 9: 85,208,803 (GRCm39) Y7H probably benign Het
Tlcd2 T A 11: 75,360,630 (GRCm39) D224E probably damaging Het
Tln2 T A 9: 67,230,304 (GRCm39) Q87L probably benign Het
Tmem131 A T 1: 36,838,186 (GRCm39) probably benign Het
Tmem63a G A 1: 180,789,961 (GRCm39) G378R probably benign Het
Trank1 C A 9: 111,219,892 (GRCm39) Q2210K probably benign Het
Trim24 T A 6: 37,934,435 (GRCm39) probably benign Het
Trim37 T A 11: 87,050,675 (GRCm39) I238N probably damaging Het
Vps39 A T 2: 120,153,548 (GRCm39) D675E probably benign Het
Zfp229 T A 17: 21,964,795 (GRCm39) C342S probably damaging Het
Zfp759 A G 13: 67,288,417 (GRCm39) H656R probably damaging Het
Zfp994 T C 17: 22,419,980 (GRCm39) Y323C probably damaging Het
Other mutations in Nup210l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Nup210l APN 3 90,098,156 (GRCm39) splice site probably benign
IGL00813:Nup210l APN 3 90,039,725 (GRCm39) missense probably benign 0.00
IGL01375:Nup210l APN 3 90,067,200 (GRCm39) missense probably damaging 0.96
IGL01731:Nup210l APN 3 90,061,873 (GRCm39) missense probably damaging 1.00
IGL01786:Nup210l APN 3 90,030,083 (GRCm39) nonsense probably null
IGL01958:Nup210l APN 3 90,111,231 (GRCm39) missense possibly damaging 0.74
IGL02094:Nup210l APN 3 90,087,520 (GRCm39) critical splice donor site probably null
IGL02120:Nup210l APN 3 90,044,169 (GRCm39) missense probably damaging 1.00
IGL02313:Nup210l APN 3 90,030,099 (GRCm39) missense probably damaging 1.00
IGL02336:Nup210l APN 3 90,088,859 (GRCm39) critical splice donor site probably null
IGL02348:Nup210l APN 3 90,011,471 (GRCm39) utr 5 prime probably benign
IGL02372:Nup210l APN 3 90,109,278 (GRCm39) missense possibly damaging 0.80
IGL02557:Nup210l APN 3 90,031,537 (GRCm39) missense probably damaging 1.00
IGL02559:Nup210l APN 3 90,067,260 (GRCm39) missense probably benign 0.02
IGL02738:Nup210l APN 3 90,044,157 (GRCm39) missense possibly damaging 0.80
IGL03231:Nup210l APN 3 90,096,852 (GRCm39) missense probably damaging 1.00
IGL03257:Nup210l APN 3 90,087,455 (GRCm39) critical splice acceptor site probably null
IGL03388:Nup210l APN 3 90,077,351 (GRCm39) missense probably damaging 1.00
IGL03134:Nup210l UTSW 3 90,098,194 (GRCm39) missense possibly damaging 0.85
R0003:Nup210l UTSW 3 90,027,218 (GRCm39) missense probably damaging 1.00
R0040:Nup210l UTSW 3 90,089,212 (GRCm39) missense probably damaging 1.00
R0083:Nup210l UTSW 3 90,096,882 (GRCm39) missense probably damaging 1.00
R0090:Nup210l UTSW 3 90,119,086 (GRCm39) missense probably benign 0.00
R0108:Nup210l UTSW 3 90,096,882 (GRCm39) missense probably damaging 1.00
R0142:Nup210l UTSW 3 90,079,420 (GRCm39) missense probably damaging 1.00
R0306:Nup210l UTSW 3 90,114,675 (GRCm39) missense probably benign 0.13
R0332:Nup210l UTSW 3 90,039,616 (GRCm39) splice site probably benign
R0346:Nup210l UTSW 3 90,096,745 (GRCm39) missense probably damaging 1.00
R0463:Nup210l UTSW 3 90,087,518 (GRCm39) missense probably null 1.00
R0622:Nup210l UTSW 3 90,075,047 (GRCm39) missense probably damaging 0.98
R0765:Nup210l UTSW 3 90,027,184 (GRCm39) missense probably damaging 0.99
R0990:Nup210l UTSW 3 90,119,232 (GRCm39) missense probably benign 0.00
R1014:Nup210l UTSW 3 90,077,355 (GRCm39) missense possibly damaging 0.62
R1036:Nup210l UTSW 3 90,100,247 (GRCm39) splice site probably benign
R1177:Nup210l UTSW 3 90,109,310 (GRCm39) missense probably benign 0.11
R1183:Nup210l UTSW 3 90,067,252 (GRCm39) missense probably benign 0.04
R1188:Nup210l UTSW 3 90,105,486 (GRCm39) missense probably benign 0.16
R1457:Nup210l UTSW 3 90,098,279 (GRCm39) missense possibly damaging 0.68
R1471:Nup210l UTSW 3 90,077,869 (GRCm39) missense probably benign
R1627:Nup210l UTSW 3 90,051,476 (GRCm39) missense probably benign 0.15
R1778:Nup210l UTSW 3 90,096,793 (GRCm39) missense probably damaging 0.99
R1827:Nup210l UTSW 3 90,061,864 (GRCm39) missense probably damaging 1.00
R1843:Nup210l UTSW 3 90,079,393 (GRCm39) missense probably damaging 0.96
R1858:Nup210l UTSW 3 90,061,806 (GRCm39) missense probably damaging 0.97
R1942:Nup210l UTSW 3 90,058,544 (GRCm39) missense probably benign 0.01
R2015:Nup210l UTSW 3 90,092,739 (GRCm39) missense probably damaging 1.00
R2113:Nup210l UTSW 3 90,098,281 (GRCm39) missense possibly damaging 0.48
R2944:Nup210l UTSW 3 90,088,852 (GRCm39) missense probably damaging 1.00
R3736:Nup210l UTSW 3 90,027,320 (GRCm39) missense probably damaging 1.00
R3740:Nup210l UTSW 3 90,114,701 (GRCm39) missense probably benign 0.08
R3741:Nup210l UTSW 3 90,114,701 (GRCm39) missense probably benign 0.08
R3742:Nup210l UTSW 3 90,114,701 (GRCm39) missense probably benign 0.08
R3771:Nup210l UTSW 3 90,027,201 (GRCm39) nonsense probably null
R3773:Nup210l UTSW 3 90,027,201 (GRCm39) nonsense probably null
R3879:Nup210l UTSW 3 90,092,780 (GRCm39) missense probably damaging 1.00
R3882:Nup210l UTSW 3 90,031,517 (GRCm39) missense probably benign 0.19
R3953:Nup210l UTSW 3 90,100,361 (GRCm39) missense possibly damaging 0.89
R3954:Nup210l UTSW 3 90,100,361 (GRCm39) missense possibly damaging 0.89
R3955:Nup210l UTSW 3 90,100,361 (GRCm39) missense possibly damaging 0.89
R3956:Nup210l UTSW 3 90,100,361 (GRCm39) missense possibly damaging 0.89
R4200:Nup210l UTSW 3 90,027,218 (GRCm39) missense probably damaging 1.00
R4290:Nup210l UTSW 3 90,114,633 (GRCm39) missense probably benign 0.00
R4328:Nup210l UTSW 3 90,083,142 (GRCm39) splice site probably null
R4629:Nup210l UTSW 3 90,098,181 (GRCm39) nonsense probably null
R4629:Nup210l UTSW 3 90,075,182 (GRCm39) missense probably benign 0.21
R4897:Nup210l UTSW 3 90,100,378 (GRCm39) missense probably damaging 1.00
R4906:Nup210l UTSW 3 90,077,337 (GRCm39) missense probably benign 0.06
R4966:Nup210l UTSW 3 90,014,208 (GRCm39) missense probably benign 0.00
R5004:Nup210l UTSW 3 90,087,472 (GRCm39) nonsense probably null
R5237:Nup210l UTSW 3 90,087,505 (GRCm39) missense probably benign 0.00
R5499:Nup210l UTSW 3 90,081,677 (GRCm39) missense probably damaging 1.00
R5522:Nup210l UTSW 3 90,061,972 (GRCm39) missense probably benign 0.10
R5627:Nup210l UTSW 3 90,051,557 (GRCm39) missense probably damaging 0.97
R5678:Nup210l UTSW 3 90,098,266 (GRCm39) missense probably damaging 0.99
R5726:Nup210l UTSW 3 90,036,514 (GRCm39) splice site probably null
R5792:Nup210l UTSW 3 90,107,164 (GRCm39) missense probably damaging 1.00
R6129:Nup210l UTSW 3 90,011,483 (GRCm39) missense probably benign 0.00
R6272:Nup210l UTSW 3 90,077,331 (GRCm39) missense possibly damaging 0.57
R6290:Nup210l UTSW 3 90,027,216 (GRCm39) nonsense probably null
R6293:Nup210l UTSW 3 90,022,371 (GRCm39) missense probably damaging 1.00
R6446:Nup210l UTSW 3 90,079,375 (GRCm39) missense probably damaging 1.00
R6698:Nup210l UTSW 3 90,089,815 (GRCm39) missense possibly damaging 0.57
R6855:Nup210l UTSW 3 90,044,231 (GRCm39) missense probably benign 0.01
R6895:Nup210l UTSW 3 90,067,231 (GRCm39) missense probably damaging 0.97
R6899:Nup210l UTSW 3 90,075,204 (GRCm39) missense possibly damaging 0.77
R6978:Nup210l UTSW 3 90,061,873 (GRCm39) missense possibly damaging 0.86
R6980:Nup210l UTSW 3 90,027,234 (GRCm39) missense probably benign 0.04
R7038:Nup210l UTSW 3 90,067,254 (GRCm39) missense probably damaging 1.00
R7273:Nup210l UTSW 3 90,025,854 (GRCm39) missense probably benign 0.04
R7450:Nup210l UTSW 3 90,022,495 (GRCm39) critical splice donor site probably null
R7514:Nup210l UTSW 3 90,117,766 (GRCm39) critical splice donor site probably null
R7658:Nup210l UTSW 3 90,119,300 (GRCm39) missense probably benign 0.43
R7735:Nup210l UTSW 3 90,092,883 (GRCm39) missense probably damaging 1.00
R7772:Nup210l UTSW 3 90,067,233 (GRCm39) missense probably damaging 1.00
R7800:Nup210l UTSW 3 90,041,904 (GRCm39) missense probably damaging 1.00
R7840:Nup210l UTSW 3 90,030,036 (GRCm39) missense probably benign 0.08
R7847:Nup210l UTSW 3 90,058,430 (GRCm39) missense probably benign
R7848:Nup210l UTSW 3 90,111,212 (GRCm39) missense probably benign 0.01
R8084:Nup210l UTSW 3 90,043,365 (GRCm39) missense probably benign 0.15
R8121:Nup210l UTSW 3 90,022,428 (GRCm39) missense probably damaging 1.00
R8421:Nup210l UTSW 3 90,111,174 (GRCm39) missense probably damaging 1.00
R8458:Nup210l UTSW 3 90,092,874 (GRCm39) missense probably null 1.00
R8701:Nup210l UTSW 3 90,030,121 (GRCm39) missense probably benign 0.41
R8720:Nup210l UTSW 3 90,117,681 (GRCm39) missense probably benign 0.00
R8896:Nup210l UTSW 3 90,025,932 (GRCm39) missense probably damaging 1.00
R9033:Nup210l UTSW 3 90,105,396 (GRCm39) missense probably benign
R9371:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9373:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9381:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9426:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9427:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9501:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9523:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9574:Nup210l UTSW 3 90,117,693 (GRCm39) missense probably benign
R9612:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9654:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9660:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9660:Nup210l UTSW 3 90,105,402 (GRCm39) missense probably benign 0.30
R9662:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9682:Nup210l UTSW 3 90,051,469 (GRCm39) missense possibly damaging 0.79
R9729:Nup210l UTSW 3 90,107,173 (GRCm39) missense probably benign 0.01
R9750:Nup210l UTSW 3 90,117,659 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GGTAAGGATCATTCCAATCTGCG -3'
(R):5'- ACACTACCTTGCTGCACACG -3'

Sequencing Primer
(F):5'- GATCATTCCAATCTGCGTGTTTTAG -3'
(R):5'- TACCTTGCTGCACACGGATGG -3'
Posted On 2021-03-08