Incidental Mutation 'R8770:Nup210l'
ID 664330
Institutional Source Beutler Lab
Gene Symbol Nup210l
Ensembl Gene ENSMUSG00000027939
Gene Name nucleoporin 210-like
Synonyms 4930548O11Rik, R26-EGFP, Tg(Gt(ROSA)26Sor-EGFP)130910Eps
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.350) question?
Stock # R8770 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 90104132-90212048 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 90118543 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 157 (F157L)
Ref Sequence ENSEMBL: ENSMUSP00000029548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029548] [ENSMUST00000200410]
AlphaFold Q9D2F7
Predicted Effect probably damaging
Transcript: ENSMUST00000029548
AA Change: F157L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029548
Gene: ENSMUSG00000027939
AA Change: F157L

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
BID_2 457 536 2.05e1 SMART
Blast:S1 949 1023 2e-16 BLAST
BID_2 1077 1152 4.51e-11 SMART
Blast:BID_2 1468 1550 7e-15 BLAST
transmembrane domain 1807 1829 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200410
AA Change: F157L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143368
Gene: ENSMUSG00000027939
AA Change: F157L

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
BID_2 457 536 6.9e-2 SMART
Blast:S1 938 1023 9e-17 BLAST
BID_2 1077 1152 1.5e-13 SMART
Blast:BID_2 1468 1550 7e-15 BLAST
transmembrane domain 1807 1829 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 99% (66/67)
MGI Phenotype PHENOTYPE: Mice homozygous for a transgene insertion exhibit male infertility, asthenozoospermia, teratozoospermia, azoospermia, and seminiferous tubule degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn T C 17: 13,883,937 probably null Het
Aox2 A T 1: 58,339,604 K1004M probably benign Het
Atn1 C T 6: 124,745,638 probably null Het
Atp8b4 T C 2: 126,342,995 Y916C probably damaging Het
BC030867 A G 11: 102,255,150 N84S probably benign Het
Bicd1 T C 6: 149,518,950 L766S probably damaging Het
Bmpr2 T G 1: 59,845,525 D223E probably benign Het
Bpifc T G 10: 85,965,265 R406S probably damaging Het
Ccl6 A G 11: 83,588,832 I115T possibly damaging Het
Cdcp1 A T 9: 123,177,861 I607N possibly damaging Het
Cdyl2 T C 8: 116,595,083 Y235C probably damaging Het
Clns1a A G 7: 97,713,910 Q163R probably benign Het
Cntn3 T A 6: 102,277,316 M222L possibly damaging Het
Cpn1 A G 19: 43,963,769 V358A probably damaging Het
Dchs1 G A 7: 105,771,738 R492W probably damaging Het
Dmxl2 T C 9: 54,404,014 T1808A probably benign Het
Dnah10 A G 5: 124,775,346 I1880V possibly damaging Het
Dscam T C 16: 96,654,906 E1274G possibly damaging Het
Dtwd1 A G 2: 126,154,807 T71A probably damaging Het
Dusp4 T A 8: 34,807,784 M19K probably benign Het
Fam46a A G 9: 85,326,750 Y7H probably benign Het
Fbxo39 T C 11: 72,318,459 F382L probably damaging Het
Fbxw20 A T 9: 109,217,528 C455S probably benign Het
Fcmr T A 1: 130,876,062 V201E probably benign Het
Galnt2 C T 8: 124,334,286 R306* probably null Het
Gpr156 A G 16: 38,004,612 E397G possibly damaging Het
Gzmf A T 14: 56,206,494 V73D probably damaging Het
Laptm4b T C 15: 34,258,697 V39A possibly damaging Het
Mlf2 C A 6: 124,934,296 H91Q probably benign Het
Mylk3 T A 8: 85,364,831 E115V probably damaging Het
Myo6 A G 9: 80,264,199 E494G unknown Het
Myo7b C T 18: 31,981,071 D1076N probably benign Het
Neurl1b A G 17: 26,431,913 D53G probably damaging Het
Noc4l A G 5: 110,648,892 L508P possibly damaging Het
Ogdh T C 11: 6,355,336 Y959H probably damaging Het
Olfr1246 A G 2: 89,590,827 M96T probably benign Het
Olfr159 T G 4: 43,770,813 N66T probably damaging Het
Pik3ap1 A G 19: 41,328,160 Y264H possibly damaging Het
Plb1 T C 5: 32,247,509 Y4H unknown Het
Rad21 A G 15: 51,968,353 I444T probably benign Het
Recql5 T C 11: 115,897,117 I459V probably benign Het
Scaf1 T C 7: 45,006,705 T917A unknown Het
Sdc4 C T 2: 164,428,902 V146I probably damaging Het
Serpina6 T C 12: 103,653,939 S184G probably benign Het
Shkbp1 C A 7: 27,351,886 R218S possibly damaging Het
Slc17a3 A G 13: 23,855,624 D255G Het
Slc7a2 T G 8: 40,899,230 V110G probably damaging Het
Slf1 A C 13: 77,046,647 V853G probably damaging Het
Smarcad1 T C 6: 65,052,734 V102A probably benign Het
Sobp T C 10: 43,160,792 K50R probably damaging Het
Spink10 A T 18: 62,653,461 R47S probably benign Het
Sspo T A 6: 48,474,272 F2720Y probably null Het
Tdrkh T A 3: 94,429,133 V459D probably damaging Het
Tlcd2 T A 11: 75,469,804 D224E probably damaging Het
Tln2 T A 9: 67,323,022 Q87L probably benign Het
Tmem131 A T 1: 36,799,105 probably benign Het
Tmem63a G A 1: 180,962,396 G378R probably benign Het
Trank1 C A 9: 111,390,824 Q2210K probably benign Het
Trim24 T A 6: 37,957,500 probably benign Het
Trim37 T A 11: 87,159,849 I238N probably damaging Het
Vps39 A T 2: 120,323,067 D675E probably benign Het
Wdr63 T C 3: 146,046,543 T793A probably benign Het
Zfp229 T A 17: 21,745,814 C342S probably damaging Het
Zfp759 A G 13: 67,140,353 H656R probably damaging Het
Zfp994 T C 17: 22,200,999 Y323C probably damaging Het
Other mutations in Nup210l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Nup210l APN 3 90190849 splice site probably benign
IGL00813:Nup210l APN 3 90132418 missense probably benign 0.00
IGL01375:Nup210l APN 3 90159893 missense probably damaging 0.96
IGL01731:Nup210l APN 3 90154566 missense probably damaging 1.00
IGL01786:Nup210l APN 3 90122776 nonsense probably null
IGL01958:Nup210l APN 3 90203924 missense possibly damaging 0.74
IGL02094:Nup210l APN 3 90180213 critical splice donor site probably null
IGL02120:Nup210l APN 3 90136862 missense probably damaging 1.00
IGL02313:Nup210l APN 3 90122792 missense probably damaging 1.00
IGL02336:Nup210l APN 3 90181552 critical splice donor site probably null
IGL02348:Nup210l APN 3 90104164 utr 5 prime probably benign
IGL02372:Nup210l APN 3 90201971 missense possibly damaging 0.80
IGL02557:Nup210l APN 3 90124230 missense probably damaging 1.00
IGL02559:Nup210l APN 3 90159953 missense probably benign 0.02
IGL02738:Nup210l APN 3 90136850 missense possibly damaging 0.80
IGL03231:Nup210l APN 3 90189545 missense probably damaging 1.00
IGL03257:Nup210l APN 3 90180148 critical splice acceptor site probably null
IGL03388:Nup210l APN 3 90170044 missense probably damaging 1.00
IGL03134:Nup210l UTSW 3 90190887 missense possibly damaging 0.85
R0003:Nup210l UTSW 3 90119911 missense probably damaging 1.00
R0040:Nup210l UTSW 3 90181905 missense probably damaging 1.00
R0083:Nup210l UTSW 3 90189575 missense probably damaging 1.00
R0090:Nup210l UTSW 3 90211779 missense probably benign 0.00
R0108:Nup210l UTSW 3 90189575 missense probably damaging 1.00
R0142:Nup210l UTSW 3 90172113 missense probably damaging 1.00
R0306:Nup210l UTSW 3 90207368 missense probably benign 0.13
R0332:Nup210l UTSW 3 90132309 splice site probably benign
R0346:Nup210l UTSW 3 90189438 missense probably damaging 1.00
R0463:Nup210l UTSW 3 90180211 missense probably null 1.00
R0622:Nup210l UTSW 3 90167740 missense probably damaging 0.98
R0765:Nup210l UTSW 3 90119877 missense probably damaging 0.99
R0990:Nup210l UTSW 3 90211925 missense probably benign 0.00
R1014:Nup210l UTSW 3 90170048 missense possibly damaging 0.62
R1036:Nup210l UTSW 3 90192940 splice site probably benign
R1177:Nup210l UTSW 3 90202003 missense probably benign 0.11
R1183:Nup210l UTSW 3 90159945 missense probably benign 0.04
R1188:Nup210l UTSW 3 90198179 missense probably benign 0.16
R1457:Nup210l UTSW 3 90190972 missense possibly damaging 0.68
R1471:Nup210l UTSW 3 90170562 missense probably benign
R1627:Nup210l UTSW 3 90144169 missense probably benign 0.15
R1778:Nup210l UTSW 3 90189486 missense probably damaging 0.99
R1827:Nup210l UTSW 3 90154557 missense probably damaging 1.00
R1843:Nup210l UTSW 3 90172086 missense probably damaging 0.96
R1858:Nup210l UTSW 3 90154499 missense probably damaging 0.97
R1942:Nup210l UTSW 3 90151237 missense probably benign 0.01
R2015:Nup210l UTSW 3 90185432 missense probably damaging 1.00
R2113:Nup210l UTSW 3 90190974 missense possibly damaging 0.48
R2944:Nup210l UTSW 3 90181545 missense probably damaging 1.00
R3736:Nup210l UTSW 3 90120013 missense probably damaging 1.00
R3740:Nup210l UTSW 3 90207394 missense probably benign 0.08
R3741:Nup210l UTSW 3 90207394 missense probably benign 0.08
R3742:Nup210l UTSW 3 90207394 missense probably benign 0.08
R3771:Nup210l UTSW 3 90119894 nonsense probably null
R3773:Nup210l UTSW 3 90119894 nonsense probably null
R3879:Nup210l UTSW 3 90185473 missense probably damaging 1.00
R3882:Nup210l UTSW 3 90124210 missense probably benign 0.19
R3953:Nup210l UTSW 3 90193054 missense possibly damaging 0.89
R3954:Nup210l UTSW 3 90193054 missense possibly damaging 0.89
R3955:Nup210l UTSW 3 90193054 missense possibly damaging 0.89
R3956:Nup210l UTSW 3 90193054 missense possibly damaging 0.89
R4200:Nup210l UTSW 3 90119911 missense probably damaging 1.00
R4290:Nup210l UTSW 3 90207326 missense probably benign 0.00
R4328:Nup210l UTSW 3 90175835 splice site probably null
R4629:Nup210l UTSW 3 90167875 missense probably benign 0.21
R4629:Nup210l UTSW 3 90190874 nonsense probably null
R4897:Nup210l UTSW 3 90193071 missense probably damaging 1.00
R4906:Nup210l UTSW 3 90170030 missense probably benign 0.06
R4966:Nup210l UTSW 3 90106901 missense probably benign 0.00
R5004:Nup210l UTSW 3 90180165 nonsense probably null
R5237:Nup210l UTSW 3 90180198 missense probably benign 0.00
R5499:Nup210l UTSW 3 90174370 missense probably damaging 1.00
R5522:Nup210l UTSW 3 90154665 missense probably benign 0.10
R5627:Nup210l UTSW 3 90144250 missense probably damaging 0.97
R5678:Nup210l UTSW 3 90190959 missense probably damaging 0.99
R5726:Nup210l UTSW 3 90129207 splice site probably null
R5792:Nup210l UTSW 3 90199857 missense probably damaging 1.00
R6129:Nup210l UTSW 3 90104176 missense probably benign 0.00
R6272:Nup210l UTSW 3 90170024 missense possibly damaging 0.57
R6290:Nup210l UTSW 3 90119909 nonsense probably null
R6293:Nup210l UTSW 3 90115064 missense probably damaging 1.00
R6446:Nup210l UTSW 3 90172068 missense probably damaging 1.00
R6698:Nup210l UTSW 3 90182508 missense possibly damaging 0.57
R6855:Nup210l UTSW 3 90136924 missense probably benign 0.01
R6895:Nup210l UTSW 3 90159924 missense probably damaging 0.97
R6899:Nup210l UTSW 3 90167897 missense possibly damaging 0.77
R6978:Nup210l UTSW 3 90154566 missense possibly damaging 0.86
R6980:Nup210l UTSW 3 90119927 missense probably benign 0.04
R7038:Nup210l UTSW 3 90159947 missense probably damaging 1.00
R7273:Nup210l UTSW 3 90118547 missense probably benign 0.04
R7450:Nup210l UTSW 3 90115188 critical splice donor site probably null
R7514:Nup210l UTSW 3 90210459 critical splice donor site probably null
R7658:Nup210l UTSW 3 90211993 missense probably benign 0.43
R7735:Nup210l UTSW 3 90185576 missense probably damaging 1.00
R7772:Nup210l UTSW 3 90159926 missense probably damaging 1.00
R7800:Nup210l UTSW 3 90134597 missense probably damaging 1.00
R7840:Nup210l UTSW 3 90122729 missense probably benign 0.08
R7847:Nup210l UTSW 3 90151123 missense probably benign
R7848:Nup210l UTSW 3 90203905 missense probably benign 0.01
R8084:Nup210l UTSW 3 90136058 missense probably benign 0.15
R8121:Nup210l UTSW 3 90115121 missense probably damaging 1.00
R8421:Nup210l UTSW 3 90203867 missense probably damaging 1.00
R8458:Nup210l UTSW 3 90185567 missense probably null 1.00
R8701:Nup210l UTSW 3 90122814 missense probably benign 0.41
R8720:Nup210l UTSW 3 90210374 missense probably benign 0.00
R8896:Nup210l UTSW 3 90118625 missense probably damaging 1.00
R9033:Nup210l UTSW 3 90198089 missense probably benign
R9371:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9373:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9381:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9426:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9427:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9501:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9523:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9574:Nup210l UTSW 3 90210386 missense probably benign
R9612:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9654:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9660:Nup210l UTSW 3 90198095 missense probably benign 0.30
R9660:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9662:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9682:Nup210l UTSW 3 90144162 missense possibly damaging 0.79
R9729:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9750:Nup210l UTSW 3 90210352 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GGTAAGGATCATTCCAATCTGCG -3'
(R):5'- ACACTACCTTGCTGCACACG -3'

Sequencing Primer
(F):5'- GATCATTCCAATCTGCGTGTTTTAG -3'
(R):5'- TACCTTGCTGCACACGGATGG -3'
Posted On 2021-03-08