Incidental Mutation 'R8770:Recql5'
ID 664367
Institutional Source Beutler Lab
Gene Symbol Recql5
Ensembl Gene ENSMUSG00000020752
Gene Name RecQ protein-like 5
Synonyms Recq5b, Recql5b
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.488) question?
Stock # R8770 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 115892595-115933477 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 115897117 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 459 (I459V)
Ref Sequence ENSEMBL: ENSMUSP00000021097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021097] [ENSMUST00000093911] [ENSMUST00000131566] [ENSMUST00000131578] [ENSMUST00000140174] [ENSMUST00000142089] [ENSMUST00000152171] [ENSMUST00000167507] [ENSMUST00000222123]
AlphaFold Q8VID5
Predicted Effect probably benign
Transcript: ENSMUST00000021097
AA Change: I459V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000021097
Gene: ENSMUSG00000020752
AA Change: I459V

DomainStartEndE-ValueType
DEXDc 25 230 1.13e-29 SMART
HELICc 274 355 8.68e-22 SMART
Pfam:RecQ_Zn_bind 366 436 1.8e-12 PFAM
low complexity region 472 499 N/A INTRINSIC
PDB:4BK0|B 516 621 2e-51 PDB
Pfam:RecQ5 626 818 3.1e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093911
SMART Domains Protein: ENSMUSP00000091439
Gene: ENSMUSG00000034427

DomainStartEndE-ValueType
MYSc 1 640 2.4e-134 SMART
IQ 660 682 1.03e1 SMART
Pfam:MyTH4 837 945 2.1e-23 PFAM
low complexity region 1050 1068 N/A INTRINSIC
low complexity region 1136 1170 N/A INTRINSIC
low complexity region 1207 1246 N/A INTRINSIC
low complexity region 1302 1327 N/A INTRINSIC
low complexity region 1454 1468 N/A INTRINSIC
low complexity region 1489 1509 N/A INTRINSIC
SH3 1735 1792 1.15e-7 SMART
Pfam:MyTH4 1928 2029 8.3e-25 PFAM
B41 2032 2235 6.99e-4 SMART
low complexity region 2243 2253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131566
Predicted Effect probably benign
Transcript: ENSMUST00000131578
SMART Domains Protein: ENSMUSP00000136178
Gene: ENSMUSG00000020752

DomainStartEndE-ValueType
HELICc 1 82 8.68e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140174
SMART Domains Protein: ENSMUSP00000136506
Gene: ENSMUSG00000020752

DomainStartEndE-ValueType
DEXDc 25 230 1.13e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142089
SMART Domains Protein: ENSMUSP00000138928
Gene: ENSMUSG00000048442

DomainStartEndE-ValueType
transmembrane domain 30 52 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152171
SMART Domains Protein: ENSMUSP00000139148
Gene: ENSMUSG00000048442

DomainStartEndE-ValueType
transmembrane domain 30 52 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167507
SMART Domains Protein: ENSMUSP00000129226
Gene: ENSMUSG00000034427

DomainStartEndE-ValueType
Pfam:MyTH4 100 205 3.1e-24 PFAM
B41 207 410 6.99e-4 SMART
low complexity region 418 428 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000222123
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a helicase that is important for genome stability. The encoded protein also prevents aberrant homologous recombination by displacing RAD51 from ssDNA. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene express elevated levels of sister chromatid exchange due to a failure to suppress crossovers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn T C 17: 13,883,937 probably null Het
Aox2 A T 1: 58,339,604 K1004M probably benign Het
Atn1 C T 6: 124,745,638 probably null Het
Atp8b4 T C 2: 126,342,995 Y916C probably damaging Het
BC030867 A G 11: 102,255,150 N84S probably benign Het
Bicd1 T C 6: 149,518,950 L766S probably damaging Het
Bmpr2 T G 1: 59,845,525 D223E probably benign Het
Bpifc T G 10: 85,965,265 R406S probably damaging Het
Ccl6 A G 11: 83,588,832 I115T possibly damaging Het
Cdcp1 A T 9: 123,177,861 I607N possibly damaging Het
Cdyl2 T C 8: 116,595,083 Y235C probably damaging Het
Clns1a A G 7: 97,713,910 Q163R probably benign Het
Cntn3 T A 6: 102,277,316 M222L possibly damaging Het
Cpn1 A G 19: 43,963,769 V358A probably damaging Het
Dchs1 G A 7: 105,771,738 R492W probably damaging Het
Dmxl2 T C 9: 54,404,014 T1808A probably benign Het
Dnah10 A G 5: 124,775,346 I1880V possibly damaging Het
Dscam T C 16: 96,654,906 E1274G possibly damaging Het
Dtwd1 A G 2: 126,154,807 T71A probably damaging Het
Dusp4 T A 8: 34,807,784 M19K probably benign Het
Fam46a A G 9: 85,326,750 Y7H probably benign Het
Fbxo39 T C 11: 72,318,459 F382L probably damaging Het
Fbxw20 A T 9: 109,217,528 C455S probably benign Het
Fcmr T A 1: 130,876,062 V201E probably benign Het
Galnt2 C T 8: 124,334,286 R306* probably null Het
Gpr156 A G 16: 38,004,612 E397G possibly damaging Het
Gzmf A T 14: 56,206,494 V73D probably damaging Het
Laptm4b T C 15: 34,258,697 V39A possibly damaging Het
Mlf2 C A 6: 124,934,296 H91Q probably benign Het
Mylk3 T A 8: 85,364,831 E115V probably damaging Het
Myo6 A G 9: 80,264,199 E494G unknown Het
Myo7b C T 18: 31,981,071 D1076N probably benign Het
Neurl1b A G 17: 26,431,913 D53G probably damaging Het
Noc4l A G 5: 110,648,892 L508P possibly damaging Het
Nup210l C A 3: 90,118,543 F157L probably damaging Het
Ogdh T C 11: 6,355,336 Y959H probably damaging Het
Olfr1246 A G 2: 89,590,827 M96T probably benign Het
Olfr159 T G 4: 43,770,813 N66T probably damaging Het
Pik3ap1 A G 19: 41,328,160 Y264H possibly damaging Het
Plb1 T C 5: 32,247,509 Y4H unknown Het
Rad21 A G 15: 51,968,353 I444T probably benign Het
Scaf1 T C 7: 45,006,705 T917A unknown Het
Sdc4 C T 2: 164,428,902 V146I probably damaging Het
Serpina6 T C 12: 103,653,939 S184G probably benign Het
Shkbp1 C A 7: 27,351,886 R218S possibly damaging Het
Slc17a3 A G 13: 23,855,624 D255G Het
Slc7a2 T G 8: 40,899,230 V110G probably damaging Het
Slf1 A C 13: 77,046,647 V853G probably damaging Het
Smarcad1 T C 6: 65,052,734 V102A probably benign Het
Sobp T C 10: 43,160,792 K50R probably damaging Het
Spink10 A T 18: 62,653,461 R47S probably benign Het
Sspo T A 6: 48,474,272 F2720Y probably null Het
Tdrkh T A 3: 94,429,133 V459D probably damaging Het
Tlcd2 T A 11: 75,469,804 D224E probably damaging Het
Tln2 T A 9: 67,323,022 Q87L probably benign Het
Tmem131 A T 1: 36,799,105 probably benign Het
Tmem63a G A 1: 180,962,396 G378R probably benign Het
Trank1 C A 9: 111,390,824 Q2210K probably benign Het
Trim24 T A 6: 37,957,500 probably benign Het
Trim37 T A 11: 87,159,849 I238N probably damaging Het
Vps39 A T 2: 120,323,067 D675E probably benign Het
Wdr63 T C 3: 146,046,543 T793A probably benign Het
Zfp229 T A 17: 21,745,814 C342S probably damaging Het
Zfp759 A G 13: 67,140,353 H656R probably damaging Het
Zfp994 T C 17: 22,200,999 Y323C probably damaging Het
Other mutations in Recql5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Recql5 APN 11 115897181 missense probably benign 0.04
IGL01589:Recql5 APN 11 115894669 missense probably damaging 1.00
IGL02040:Recql5 APN 11 115932797 missense possibly damaging 0.89
IGL02131:Recql5 APN 11 115923242 missense probably benign 0.01
IGL02198:Recql5 APN 11 115894673 missense probably benign 0.00
IGL02236:Recql5 APN 11 115894030 missense probably benign 0.01
IGL02501:Recql5 APN 11 115895091 missense probably benign 0.26
IGL02980:Recql5 APN 11 115893944 splice site probably null
IGL03028:Recql5 APN 11 115894431 missense possibly damaging 0.94
PIT4581001:Recql5 UTSW 11 115932856 missense possibly damaging 0.53
R0152:Recql5 UTSW 11 115894673 missense probably benign
R0269:Recql5 UTSW 11 115928224 missense possibly damaging 0.91
R0317:Recql5 UTSW 11 115894673 missense probably benign
R0511:Recql5 UTSW 11 115928383 missense probably benign 0.00
R0786:Recql5 UTSW 11 115895802 missense probably benign
R0975:Recql5 UTSW 11 115923256 missense probably damaging 1.00
R1170:Recql5 UTSW 11 115897234 missense probably damaging 0.98
R1208:Recql5 UTSW 11 115893156 missense probably damaging 0.98
R1208:Recql5 UTSW 11 115893156 missense probably damaging 0.98
R1807:Recql5 UTSW 11 115895115 missense possibly damaging 0.63
R1872:Recql5 UTSW 11 115923309 missense probably benign 0.15
R1878:Recql5 UTSW 11 115895101 missense probably benign 0.00
R1935:Recql5 UTSW 11 115897191 missense probably benign 0.00
R1936:Recql5 UTSW 11 115897191 missense probably benign 0.00
R1945:Recql5 UTSW 11 115928297 nonsense probably null
R2011:Recql5 UTSW 11 115897097 missense probably benign 0.20
R2012:Recql5 UTSW 11 115897097 missense probably benign 0.20
R2023:Recql5 UTSW 11 115893640 missense probably benign
R2183:Recql5 UTSW 11 115896787 missense probably benign 0.00
R3881:Recql5 UTSW 11 115893954 missense probably benign
R3881:Recql5 UTSW 11 115893955 missense probably benign 0.00
R4093:Recql5 UTSW 11 115904888 missense probably benign 0.05
R4857:Recql5 UTSW 11 115928212 missense probably damaging 1.00
R5245:Recql5 UTSW 11 115893559 missense probably damaging 1.00
R5323:Recql5 UTSW 11 115927389 missense probably damaging 1.00
R5796:Recql5 UTSW 11 115927865 intron probably benign
R6160:Recql5 UTSW 11 115932787 critical splice donor site probably null
R6229:Recql5 UTSW 11 115930714 missense probably damaging 0.96
R6824:Recql5 UTSW 11 115923212 missense possibly damaging 0.83
R7013:Recql5 UTSW 11 115894576 missense probably benign 0.02
R7043:Recql5 UTSW 11 115930676 critical splice donor site probably null
R7135:Recql5 UTSW 11 115930672 splice site probably null
R7354:Recql5 UTSW 11 115928201 missense probably damaging 1.00
R7373:Recql5 UTSW 11 115928372 missense possibly damaging 0.92
R7503:Recql5 UTSW 11 115895055 missense probably benign 0.00
R7574:Recql5 UTSW 11 115928422 missense probably benign
R7597:Recql5 UTSW 11 115928381 missense probably benign 0.03
R7658:Recql5 UTSW 11 115923276 missense probably damaging 1.00
R8025:Recql5 UTSW 11 115928112 missense probably damaging 1.00
R8038:Recql5 UTSW 11 115927352 missense possibly damaging 0.90
R8316:Recql5 UTSW 11 115894035 missense possibly damaging 0.46
R8463:Recql5 UTSW 11 115896793 nonsense probably null
R8788:Recql5 UTSW 11 115895802 missense probably benign
R9083:Recql5 UTSW 11 115894649 missense possibly damaging 0.46
R9653:Recql5 UTSW 11 115897206 missense probably benign 0.01
R9711:Recql5 UTSW 11 115893541 missense probably damaging 1.00
X0026:Recql5 UTSW 11 115923261 missense probably damaging 1.00
X0028:Recql5 UTSW 11 115894606 missense probably benign
Predicted Primers PCR Primer
(F):5'- CATACCTAAAGGACAGGCTAGG -3'
(R):5'- AGGATGAGCCAACACTAGCC -3'

Sequencing Primer
(F):5'- ATGCAGGGGCTCTGTCCTTC -3'
(R):5'- TGAGCCAACACTAGCCACCTC -3'
Posted On 2021-03-08