Incidental Mutation 'R8770:Laptm4b'
ID 664373
Institutional Source Beutler Lab
Gene Symbol Laptm4b
Ensembl Gene ENSMUSG00000022257
Gene Name lysosomal-associated protein transmembrane 4B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock # R8770 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 34238028-34284302 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 34258697 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 39 (V39A)
Ref Sequence ENSEMBL: ENSMUSP00000022867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022867] [ENSMUST00000226437] [ENSMUST00000226627]
AlphaFold Q91XQ6
Predicted Effect possibly damaging
Transcript: ENSMUST00000022867
AA Change: V39A

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000022867
Gene: ENSMUSG00000022257
AA Change: V39A

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
transmembrane domain 72 94 N/A INTRINSIC
transmembrane domain 101 123 N/A INTRINSIC
Pfam:Mtp 139 226 6.4e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226437
Predicted Effect probably damaging
Transcript: ENSMUST00000226627
AA Change: V39A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 99% (66/67)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn T C 17: 13,883,937 probably null Het
Aox2 A T 1: 58,339,604 K1004M probably benign Het
Atn1 C T 6: 124,745,638 probably null Het
Atp8b4 T C 2: 126,342,995 Y916C probably damaging Het
BC030867 A G 11: 102,255,150 N84S probably benign Het
Bicd1 T C 6: 149,518,950 L766S probably damaging Het
Bmpr2 T G 1: 59,845,525 D223E probably benign Het
Bpifc T G 10: 85,965,265 R406S probably damaging Het
Ccl6 A G 11: 83,588,832 I115T possibly damaging Het
Cdcp1 A T 9: 123,177,861 I607N possibly damaging Het
Cdyl2 T C 8: 116,595,083 Y235C probably damaging Het
Clns1a A G 7: 97,713,910 Q163R probably benign Het
Cntn3 T A 6: 102,277,316 M222L possibly damaging Het
Cpn1 A G 19: 43,963,769 V358A probably damaging Het
Dchs1 G A 7: 105,771,738 R492W probably damaging Het
Dmxl2 T C 9: 54,404,014 T1808A probably benign Het
Dnah10 A G 5: 124,775,346 I1880V possibly damaging Het
Dscam T C 16: 96,654,906 E1274G possibly damaging Het
Dtwd1 A G 2: 126,154,807 T71A probably damaging Het
Dusp4 T A 8: 34,807,784 M19K probably benign Het
Fam46a A G 9: 85,326,750 Y7H probably benign Het
Fbxo39 T C 11: 72,318,459 F382L probably damaging Het
Fbxw20 A T 9: 109,217,528 C455S probably benign Het
Fcmr T A 1: 130,876,062 V201E probably benign Het
Galnt2 C T 8: 124,334,286 R306* probably null Het
Gpr156 A G 16: 38,004,612 E397G possibly damaging Het
Gzmf A T 14: 56,206,494 V73D probably damaging Het
Mlf2 C A 6: 124,934,296 H91Q probably benign Het
Mylk3 T A 8: 85,364,831 E115V probably damaging Het
Myo6 A G 9: 80,264,199 E494G unknown Het
Myo7b C T 18: 31,981,071 D1076N probably benign Het
Neurl1b A G 17: 26,431,913 D53G probably damaging Het
Noc4l A G 5: 110,648,892 L508P possibly damaging Het
Nup210l C A 3: 90,118,543 F157L probably damaging Het
Ogdh T C 11: 6,355,336 Y959H probably damaging Het
Olfr1246 A G 2: 89,590,827 M96T probably benign Het
Olfr159 T G 4: 43,770,813 N66T probably damaging Het
Pik3ap1 A G 19: 41,328,160 Y264H possibly damaging Het
Plb1 T C 5: 32,247,509 Y4H unknown Het
Rad21 A G 15: 51,968,353 I444T probably benign Het
Recql5 T C 11: 115,897,117 I459V probably benign Het
Scaf1 T C 7: 45,006,705 T917A unknown Het
Sdc4 C T 2: 164,428,902 V146I probably damaging Het
Serpina6 T C 12: 103,653,939 S184G probably benign Het
Shkbp1 C A 7: 27,351,886 R218S possibly damaging Het
Slc17a3 A G 13: 23,855,624 D255G Het
Slc7a2 T G 8: 40,899,230 V110G probably damaging Het
Slf1 A C 13: 77,046,647 V853G probably damaging Het
Smarcad1 T C 6: 65,052,734 V102A probably benign Het
Sobp T C 10: 43,160,792 K50R probably damaging Het
Spink10 A T 18: 62,653,461 R47S probably benign Het
Sspo T A 6: 48,474,272 F2720Y probably null Het
Tdrkh T A 3: 94,429,133 V459D probably damaging Het
Tlcd2 T A 11: 75,469,804 D224E probably damaging Het
Tln2 T A 9: 67,323,022 Q87L probably benign Het
Tmem131 A T 1: 36,799,105 probably benign Het
Tmem63a G A 1: 180,962,396 G378R probably benign Het
Trank1 C A 9: 111,390,824 Q2210K probably benign Het
Trim24 T A 6: 37,957,500 probably benign Het
Trim37 T A 11: 87,159,849 I238N probably damaging Het
Vps39 A T 2: 120,323,067 D675E probably benign Het
Wdr63 T C 3: 146,046,543 T793A probably benign Het
Zfp229 T A 17: 21,745,814 C342S probably damaging Het
Zfp759 A G 13: 67,140,353 H656R probably damaging Het
Zfp994 T C 17: 22,200,999 Y323C probably damaging Het
Other mutations in Laptm4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02458:Laptm4b APN 15 34258742 missense probably benign 0.01
IGL02638:Laptm4b APN 15 34277484 missense probably benign 0.06
R0609:Laptm4b UTSW 15 34258689 missense probably damaging 1.00
R2140:Laptm4b UTSW 15 34238332 missense probably benign 0.10
R2142:Laptm4b UTSW 15 34238332 missense probably benign 0.10
R5907:Laptm4b UTSW 15 34258684 missense possibly damaging 0.59
R6275:Laptm4b UTSW 15 34283327 missense probably benign 0.12
R7749:Laptm4b UTSW 15 34276200 missense probably benign 0.21
R8208:Laptm4b UTSW 15 34277445 missense probably damaging 1.00
R8711:Laptm4b UTSW 15 34277502 missense probably damaging 1.00
R8755:Laptm4b UTSW 15 34273274 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCTTCGTACTTGTCCAGCTG -3'
(R):5'- GCAGCTCAAATAGGCCCTTG -3'

Sequencing Primer
(F):5'- TACTTGTCCAGCTGAGCCG -3'
(R):5'- TTGTAATTTAGCAGAAAAGGCAGAC -3'
Posted On 2021-03-08