Incidental Mutation 'R8770:Myo7b'
ID664381
Institutional Source Beutler Lab
Gene Symbol Myo7b
Ensembl Gene ENSMUSG00000024388
Gene Namemyosin VIIB
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8770 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location31959234-32036961 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 31981071 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 1076 (D1076N)
Ref Sequence ENSEMBL: ENSMUSP00000118046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000134663]
Predicted Effect probably benign
Transcript: ENSMUST00000134663
AA Change: D1076N

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000118046
Gene: ENSMUSG00000024388
AA Change: D1076N

DomainStartEndE-ValueType
MYSc 59 761 N/A SMART
IQ 762 784 1.07e-1 SMART
IQ 785 807 7.01e-6 SMART
IQ 831 853 4.93e-1 SMART
IQ 854 876 1.63e-1 SMART
MyTH4 989 1189 1.14e-71 SMART
B41 1190 1409 3.66e-16 SMART
SH3 1501 1563 3.25e-7 SMART
MyTH4 1641 1790 7.66e-55 SMART
B41 1792 2009 8.19e-28 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found in brush border microvilli of epithelial cells in the intestines and kidneys. The encoded protein is involved in linking protocadherins to the actin cytoskeleton and is essential for proper microvilli function. This protein aids in the accumulation of intermicrovillar adhesion components such as harmonin and ANKS4B, and this accumulation is necessary for normal brush border action. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn T C 17: 13,883,937 probably null Het
Aox2 A T 1: 58,339,604 K1004M probably benign Het
Atn1 C T 6: 124,745,638 probably null Het
Atp8b4 T C 2: 126,342,995 Y916C probably damaging Het
BC030867 A G 11: 102,255,150 N84S probably benign Het
Bicd1 T C 6: 149,518,950 L766S probably damaging Het
Bmpr2 T G 1: 59,845,525 D223E probably benign Het
Bpifc T G 10: 85,965,265 R406S probably damaging Het
Ccl6 A G 11: 83,588,832 I115T possibly damaging Het
Cdcp1 A T 9: 123,177,861 I607N possibly damaging Het
Cdyl2 T C 8: 116,595,083 Y235C probably damaging Het
Clns1a A G 7: 97,713,910 Q163R probably benign Het
Cntn3 T A 6: 102,277,316 M222L possibly damaging Het
Cpn1 A G 19: 43,963,769 V358A probably damaging Het
Dchs1 G A 7: 105,771,738 R492W probably damaging Het
Dmxl2 T C 9: 54,404,014 T1808A probably benign Het
Dnah10 A G 5: 124,775,346 I1880V possibly damaging Het
Dscam T C 16: 96,654,906 E1274G possibly damaging Het
Dtwd1 A G 2: 126,154,807 T71A probably damaging Het
Dusp4 T A 8: 34,807,784 M19K probably benign Het
Fam46a A G 9: 85,326,750 Y7H probably benign Het
Fbxo39 T C 11: 72,318,459 F382L probably damaging Het
Fbxw20 A T 9: 109,217,528 C455S probably benign Het
Fcmr T A 1: 130,876,062 V201E probably benign Het
Galnt2 C T 8: 124,334,286 R306* probably null Het
Gpr156 A G 16: 38,004,612 E397G possibly damaging Het
Gzmf A T 14: 56,206,494 V73D probably damaging Het
Laptm4b T C 15: 34,258,697 V39A possibly damaging Het
Mlf2 C A 6: 124,934,296 H91Q probably benign Het
Mylk3 T A 8: 85,364,831 E115V probably damaging Het
Myo6 A G 9: 80,264,199 E494G unknown Het
Neurl1b A G 17: 26,431,913 D53G probably damaging Het
Noc4l A G 5: 110,648,892 L508P possibly damaging Het
Nup210l C A 3: 90,118,543 F157L probably damaging Het
Ogdh T C 11: 6,355,336 Y959H probably damaging Het
Olfr1246 A G 2: 89,590,827 M96T probably benign Het
Olfr159 T G 4: 43,770,813 N66T probably damaging Het
Pik3ap1 A G 19: 41,328,160 Y264H possibly damaging Het
Plb1 T C 5: 32,247,509 Y4H unknown Het
Rad21 A G 15: 51,968,353 I444T probably benign Het
Recql5 T C 11: 115,897,117 I459V probably benign Het
Scaf1 T C 7: 45,006,705 T917A unknown Het
Sdc4 C T 2: 164,428,902 V146I probably damaging Het
Serpina6 T C 12: 103,653,939 S184G probably benign Het
Shkbp1 C A 7: 27,351,886 R218S possibly damaging Het
Slc17a3 A G 13: 23,855,624 D255G Het
Slc7a2 T G 8: 40,899,230 V110G probably damaging Het
Slf1 A C 13: 77,046,647 V853G probably damaging Het
Smarcad1 T C 6: 65,052,734 V102A probably benign Het
Sobp T C 10: 43,160,792 K50R probably damaging Het
Spink10 A T 18: 62,653,461 R47S probably benign Het
Sspo T A 6: 48,474,272 F2720Y probably null Het
Tdrkh T A 3: 94,429,133 V459D probably damaging Het
Tlcd2 T A 11: 75,469,804 D224E probably damaging Het
Tln2 T A 9: 67,323,022 Q87L probably benign Het
Tmem63a G A 1: 180,962,396 G378R probably benign Het
Trank1 C A 9: 111,390,824 Q2210K probably benign Het
Trim37 T A 11: 87,159,849 I238N probably damaging Het
Vps39 A T 2: 120,323,067 D675E probably benign Het
Wdr63 T C 3: 146,046,543 T793A probably benign Het
Zfp229 T A 17: 21,745,814 C342S probably damaging Het
Zfp759 A G 13: 67,140,353 H656R probably damaging Het
Zfp994 T C 17: 22,200,999 Y323C probably damaging Het
Other mutations in Myo7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Myo7b APN 18 32021556 utr 5 prime probably benign
IGL01799:Myo7b APN 18 31962770 missense probably damaging 1.00
IGL01881:Myo7b APN 18 32000267 splice site probably benign
IGL01883:Myo7b APN 18 31998151 missense probably damaging 1.00
IGL01934:Myo7b APN 18 32001341 critical splice donor site probably null
IGL01980:Myo7b APN 18 31961900 missense possibly damaging 0.86
IGL02506:Myo7b APN 18 31967154 missense probably damaging 1.00
IGL02704:Myo7b APN 18 31966961 missense probably benign 0.13
IGL02929:Myo7b APN 18 31994925 missense probably benign 0.19
IGL03149:Myo7b APN 18 32014302 missense probably damaging 1.00
IGL03335:Myo7b APN 18 31985020 missense possibly damaging 0.81
IGL03372:Myo7b APN 18 31998601 missense probably damaging 1.00
IGL03385:Myo7b APN 18 31989577 missense probably benign 0.00
PIT4131001:Myo7b UTSW 18 31961206 missense probably benign 0.17
PIT4445001:Myo7b UTSW 18 31959466 missense possibly damaging 0.80
PIT4445001:Myo7b UTSW 18 31962352 missense probably damaging 0.96
R0034:Myo7b UTSW 18 31960860 missense probably damaging 1.00
R0138:Myo7b UTSW 18 32010151 missense probably damaging 1.00
R0149:Myo7b UTSW 18 32014209 missense probably damaging 1.00
R0226:Myo7b UTSW 18 31972896 missense probably benign 0.00
R0312:Myo7b UTSW 18 32014337 missense possibly damaging 0.68
R0361:Myo7b UTSW 18 32014209 missense probably damaging 1.00
R0506:Myo7b UTSW 18 31964386 critical splice donor site probably null
R0524:Myo7b UTSW 18 32013424 missense possibly damaging 0.91
R0645:Myo7b UTSW 18 31994909 missense probably benign 0.10
R0724:Myo7b UTSW 18 32005549 splice site probably benign
R0731:Myo7b UTSW 18 31961825 splice site probably null
R0762:Myo7b UTSW 18 31983944 missense probably benign 0.01
R0843:Myo7b UTSW 18 31974084 missense possibly damaging 0.83
R0894:Myo7b UTSW 18 32000070 missense probably damaging 1.00
R0966:Myo7b UTSW 18 31998763 missense probably damaging 1.00
R1205:Myo7b UTSW 18 31994342 missense probably damaging 1.00
R1387:Myo7b UTSW 18 31983752 splice site probably benign
R1523:Myo7b UTSW 18 31966876 missense probably damaging 1.00
R1544:Myo7b UTSW 18 31994909 missense probably benign 0.10
R1623:Myo7b UTSW 18 32000051 missense probably damaging 1.00
R1780:Myo7b UTSW 18 31961185 missense probably damaging 1.00
R1785:Myo7b UTSW 18 31994897 missense probably benign
R1786:Myo7b UTSW 18 31994897 missense probably benign
R1796:Myo7b UTSW 18 31986675 missense possibly damaging 0.93
R1907:Myo7b UTSW 18 31976999 missense possibly damaging 0.89
R2027:Myo7b UTSW 18 31984960 missense probably benign
R2102:Myo7b UTSW 18 31999978 missense probably damaging 1.00
R2174:Myo7b UTSW 18 31983557 missense probably damaging 1.00
R2272:Myo7b UTSW 18 31977043 missense probably benign 0.41
R2323:Myo7b UTSW 18 31971345 missense probably damaging 1.00
R2365:Myo7b UTSW 18 32014331 missense probably damaging 0.98
R3078:Myo7b UTSW 18 31967184 missense probably benign 0.04
R3522:Myo7b UTSW 18 32010079 missense probably damaging 1.00
R3788:Myo7b UTSW 18 31974112 missense possibly damaging 0.95
R3880:Myo7b UTSW 18 31969514 missense probably damaging 0.96
R4334:Myo7b UTSW 18 31976987 missense probably damaging 1.00
R4343:Myo7b UTSW 18 31983627 missense probably damaging 1.00
R4497:Myo7b UTSW 18 32014229 missense probably benign 0.06
R4498:Myo7b UTSW 18 32014229 missense probably benign 0.06
R4551:Myo7b UTSW 18 31985108 missense probably benign 0.01
R4593:Myo7b UTSW 18 32013375 missense possibly damaging 0.77
R4616:Myo7b UTSW 18 32003487 splice site probably null
R4646:Myo7b UTSW 18 31994369 missense probably benign 0.25
R4648:Myo7b UTSW 18 31967125 splice site probably null
R4737:Myo7b UTSW 18 31998602 missense probably damaging 1.00
R4765:Myo7b UTSW 18 31961900 missense probably benign 0.00
R4790:Myo7b UTSW 18 32000105 splice site probably null
R4909:Myo7b UTSW 18 31964436 missense probably benign 0.01
R5027:Myo7b UTSW 18 31975212 missense probably benign 0.22
R5034:Myo7b UTSW 18 31971387 missense probably damaging 1.00
R5112:Myo7b UTSW 18 31983587 missense probably damaging 1.00
R5266:Myo7b UTSW 18 31998734 missense probably damaging 1.00
R5267:Myo7b UTSW 18 31998734 missense probably damaging 1.00
R5348:Myo7b UTSW 18 31983919 missense probably damaging 0.96
R5457:Myo7b UTSW 18 31971450 splice site probably null
R5540:Myo7b UTSW 18 32007090 missense probably damaging 1.00
R5628:Myo7b UTSW 18 31974187 missense probably benign
R5815:Myo7b UTSW 18 31966288 missense probably damaging 1.00
R6062:Myo7b UTSW 18 31967990 missense possibly damaging 0.94
R6137:Myo7b UTSW 18 31999974 missense probably damaging 1.00
R6158:Myo7b UTSW 18 31988549 missense probably benign 0.00
R6218:Myo7b UTSW 18 31959454 missense probably benign 0.10
R6256:Myo7b UTSW 18 31983695 missense probably damaging 1.00
R6257:Myo7b UTSW 18 32013415 missense probably damaging 1.00
R6265:Myo7b UTSW 18 31998150 missense probably damaging 1.00
R6302:Myo7b UTSW 18 31994386 missense probably damaging 0.98
R6438:Myo7b UTSW 18 31966329 missense probably damaging 1.00
R6654:Myo7b UTSW 18 31990269 missense possibly damaging 0.46
R7030:Myo7b UTSW 18 31971573 missense probably damaging 1.00
R7090:Myo7b UTSW 18 31998712 missense probably damaging 1.00
R7210:Myo7b UTSW 18 32007102 missense probably damaging 1.00
R7218:Myo7b UTSW 18 31981001 missense probably benign 0.05
R7378:Myo7b UTSW 18 31966239 missense probably damaging 1.00
R7458:Myo7b UTSW 18 31988551 missense possibly damaging 0.89
R7517:Myo7b UTSW 18 32013267 missense probably damaging 0.99
R7559:Myo7b UTSW 18 31983360 missense probably benign 0.01
R7667:Myo7b UTSW 18 31961905 missense probably benign
R7737:Myo7b UTSW 18 32014204 nonsense probably null
R7942:Myo7b UTSW 18 32013369 missense probably damaging 0.98
R8030:Myo7b UTSW 18 31998082 missense probably damaging 0.96
R8114:Myo7b UTSW 18 31965624 missense probably damaging 1.00
R8338:Myo7b UTSW 18 31971355 missense probably damaging 0.96
R8341:Myo7b UTSW 18 31983926 missense probably benign 0.39
R8406:Myo7b UTSW 18 31959813 missense probably damaging 1.00
R8464:Myo7b UTSW 18 31962704 missense probably benign 0.00
R8517:Myo7b UTSW 18 31967191 missense possibly damaging 0.87
R8537:Myo7b UTSW 18 31977089 missense probably benign 0.08
R8546:Myo7b UTSW 18 31990148 missense probably benign 0.19
R8721:Myo7b UTSW 18 32007011 missense probably damaging 1.00
R8841:Myo7b UTSW 18 31964437 missense probably benign 0.06
R8853:Myo7b UTSW 18 31986691 missense possibly damaging 0.67
X0027:Myo7b UTSW 18 31965636 missense probably damaging 1.00
Z1176:Myo7b UTSW 18 31980998 missense possibly damaging 0.82
Z1177:Myo7b UTSW 18 31985056 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCCAGGCTCATGTCAGAGTAG -3'
(R):5'- AGCCAGGAGATGATTTGTCTGTC -3'

Sequencing Primer
(F):5'- CTCATGTCAGAGTAGTTGAATAGCCG -3'
(R):5'- CAGGAGATGATTTGTCTGTCTGTCC -3'
Posted On2021-03-08