Incidental Mutation 'R8770:Myo7b'
ID 664381
Institutional Source Beutler Lab
Gene Symbol Myo7b
Ensembl Gene ENSMUSG00000024388
Gene Name myosin VIIB
Synonyms
MMRRC Submission 068625-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8770 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 32092287-32169984 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 32114124 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 1076 (D1076N)
Ref Sequence ENSEMBL: ENSMUSP00000118046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000134663]
AlphaFold Q99MZ6
Predicted Effect probably benign
Transcript: ENSMUST00000134663
AA Change: D1076N

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000118046
Gene: ENSMUSG00000024388
AA Change: D1076N

DomainStartEndE-ValueType
MYSc 59 761 N/A SMART
IQ 762 784 1.07e-1 SMART
IQ 785 807 7.01e-6 SMART
IQ 831 853 4.93e-1 SMART
IQ 854 876 1.63e-1 SMART
MyTH4 989 1189 1.14e-71 SMART
B41 1190 1409 3.66e-16 SMART
SH3 1501 1563 3.25e-7 SMART
MyTH4 1641 1790 7.66e-55 SMART
B41 1792 2009 8.19e-28 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found in brush border microvilli of epithelial cells in the intestines and kidneys. The encoded protein is involved in linking protocadherins to the actin cytoskeleton and is essential for proper microvilli function. This protein aids in the accumulation of intermicrovillar adhesion components such as harmonin and ANKS4B, and this accumulation is necessary for normal brush border action. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn T C 17: 14,104,199 (GRCm39) probably null Het
Aox1 A T 1: 58,378,763 (GRCm39) K1004M probably benign Het
Atn1 C T 6: 124,722,601 (GRCm39) probably null Het
Atp8b4 T C 2: 126,184,915 (GRCm39) Y916C probably damaging Het
Bicd1 T C 6: 149,420,448 (GRCm39) L766S probably damaging Het
Bmpr2 T G 1: 59,884,684 (GRCm39) D223E probably benign Het
Bpifc T G 10: 85,801,129 (GRCm39) R406S probably damaging Het
Ccl6 A G 11: 83,479,658 (GRCm39) I115T possibly damaging Het
Cdcp1 A T 9: 123,006,926 (GRCm39) I607N possibly damaging Het
Cdyl2 T C 8: 117,321,822 (GRCm39) Y235C probably damaging Het
Clns1a A G 7: 97,363,117 (GRCm39) Q163R probably benign Het
Cntn3 T A 6: 102,254,277 (GRCm39) M222L possibly damaging Het
Cpn1 A G 19: 43,952,208 (GRCm39) V358A probably damaging Het
Dchs1 G A 7: 105,420,945 (GRCm39) R492W probably damaging Het
Dmxl2 T C 9: 54,311,298 (GRCm39) T1808A probably benign Het
Dnah10 A G 5: 124,852,410 (GRCm39) I1880V possibly damaging Het
Dnai3 T C 3: 145,752,298 (GRCm39) T793A probably benign Het
Dscam T C 16: 96,456,106 (GRCm39) E1274G possibly damaging Het
Dtwd1 A G 2: 125,996,727 (GRCm39) T71A probably damaging Het
Dusp4 T A 8: 35,274,938 (GRCm39) M19K probably benign Het
Fbxo39 T C 11: 72,209,285 (GRCm39) F382L probably damaging Het
Fbxw20 A T 9: 109,046,596 (GRCm39) C455S probably benign Het
Fcmr T A 1: 130,803,799 (GRCm39) V201E probably benign Het
Galnt2 C T 8: 125,061,025 (GRCm39) R306* probably null Het
Gpr156 A G 16: 37,824,974 (GRCm39) E397G possibly damaging Het
Gzmf A T 14: 56,443,951 (GRCm39) V73D probably damaging Het
Hrob A G 11: 102,145,976 (GRCm39) N84S probably benign Het
Laptm4b T C 15: 34,258,843 (GRCm39) V39A possibly damaging Het
Mlf2 C A 6: 124,911,259 (GRCm39) H91Q probably benign Het
Mylk3 T A 8: 86,091,460 (GRCm39) E115V probably damaging Het
Myo6 A G 9: 80,171,481 (GRCm39) E494G unknown Het
Neurl1b A G 17: 26,650,887 (GRCm39) D53G probably damaging Het
Noc4l A G 5: 110,796,758 (GRCm39) L508P possibly damaging Het
Nup210l C A 3: 90,025,850 (GRCm39) F157L probably damaging Het
Ogdh T C 11: 6,305,336 (GRCm39) Y959H probably damaging Het
Or13c7d T G 4: 43,770,813 (GRCm39) N66T probably damaging Het
Or4a73 A G 2: 89,421,171 (GRCm39) M96T probably benign Het
Pik3ap1 A G 19: 41,316,599 (GRCm39) Y264H possibly damaging Het
Plb1 T C 5: 32,404,853 (GRCm39) Y4H unknown Het
Rad21 A G 15: 51,831,749 (GRCm39) I444T probably benign Het
Recql5 T C 11: 115,787,943 (GRCm39) I459V probably benign Het
Scaf1 T C 7: 44,656,129 (GRCm39) T917A unknown Het
Sdc4 C T 2: 164,270,822 (GRCm39) V146I probably damaging Het
Serpina6 T C 12: 103,620,198 (GRCm39) S184G probably benign Het
Shkbp1 C A 7: 27,051,311 (GRCm39) R218S possibly damaging Het
Slc17a3 A G 13: 24,039,607 (GRCm39) D255G Het
Slc7a2 T G 8: 41,352,267 (GRCm39) V110G probably damaging Het
Slf1 A C 13: 77,194,766 (GRCm39) V853G probably damaging Het
Smarcad1 T C 6: 65,029,718 (GRCm39) V102A probably benign Het
Sobp T C 10: 43,036,788 (GRCm39) K50R probably damaging Het
Spink10 A T 18: 62,786,532 (GRCm39) R47S probably benign Het
Sspo T A 6: 48,451,206 (GRCm39) F2720Y probably null Het
Tdrkh T A 3: 94,336,440 (GRCm39) V459D probably damaging Het
Tent5a A G 9: 85,208,803 (GRCm39) Y7H probably benign Het
Tlcd2 T A 11: 75,360,630 (GRCm39) D224E probably damaging Het
Tln2 T A 9: 67,230,304 (GRCm39) Q87L probably benign Het
Tmem131 A T 1: 36,838,186 (GRCm39) probably benign Het
Tmem63a G A 1: 180,789,961 (GRCm39) G378R probably benign Het
Trank1 C A 9: 111,219,892 (GRCm39) Q2210K probably benign Het
Trim24 T A 6: 37,934,435 (GRCm39) probably benign Het
Trim37 T A 11: 87,050,675 (GRCm39) I238N probably damaging Het
Vps39 A T 2: 120,153,548 (GRCm39) D675E probably benign Het
Zfp229 T A 17: 21,964,795 (GRCm39) C342S probably damaging Het
Zfp759 A G 13: 67,288,417 (GRCm39) H656R probably damaging Het
Zfp994 T C 17: 22,419,980 (GRCm39) Y323C probably damaging Het
Other mutations in Myo7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Myo7b APN 18 32,154,609 (GRCm39) utr 5 prime probably benign
IGL01799:Myo7b APN 18 32,095,823 (GRCm39) missense probably damaging 1.00
IGL01881:Myo7b APN 18 32,133,320 (GRCm39) splice site probably benign
IGL01883:Myo7b APN 18 32,131,204 (GRCm39) missense probably damaging 1.00
IGL01934:Myo7b APN 18 32,134,394 (GRCm39) critical splice donor site probably null
IGL01980:Myo7b APN 18 32,094,953 (GRCm39) missense possibly damaging 0.86
IGL02506:Myo7b APN 18 32,100,207 (GRCm39) missense probably damaging 1.00
IGL02704:Myo7b APN 18 32,100,014 (GRCm39) missense probably benign 0.13
IGL02929:Myo7b APN 18 32,127,978 (GRCm39) missense probably benign 0.19
IGL03149:Myo7b APN 18 32,147,355 (GRCm39) missense probably damaging 1.00
IGL03335:Myo7b APN 18 32,118,073 (GRCm39) missense possibly damaging 0.81
IGL03372:Myo7b APN 18 32,131,654 (GRCm39) missense probably damaging 1.00
IGL03385:Myo7b APN 18 32,122,630 (GRCm39) missense probably benign 0.00
PIT4131001:Myo7b UTSW 18 32,094,259 (GRCm39) missense probably benign 0.17
PIT4445001:Myo7b UTSW 18 32,095,405 (GRCm39) missense probably damaging 0.96
PIT4445001:Myo7b UTSW 18 32,092,519 (GRCm39) missense possibly damaging 0.80
R0034:Myo7b UTSW 18 32,093,913 (GRCm39) missense probably damaging 1.00
R0138:Myo7b UTSW 18 32,143,204 (GRCm39) missense probably damaging 1.00
R0149:Myo7b UTSW 18 32,147,262 (GRCm39) missense probably damaging 1.00
R0226:Myo7b UTSW 18 32,105,949 (GRCm39) missense probably benign 0.00
R0312:Myo7b UTSW 18 32,147,390 (GRCm39) missense possibly damaging 0.68
R0361:Myo7b UTSW 18 32,147,262 (GRCm39) missense probably damaging 1.00
R0506:Myo7b UTSW 18 32,097,439 (GRCm39) critical splice donor site probably null
R0524:Myo7b UTSW 18 32,146,477 (GRCm39) missense possibly damaging 0.91
R0645:Myo7b UTSW 18 32,127,962 (GRCm39) missense probably benign 0.10
R0724:Myo7b UTSW 18 32,138,602 (GRCm39) splice site probably benign
R0731:Myo7b UTSW 18 32,094,878 (GRCm39) splice site probably null
R0762:Myo7b UTSW 18 32,116,997 (GRCm39) missense probably benign 0.01
R0843:Myo7b UTSW 18 32,107,137 (GRCm39) missense possibly damaging 0.83
R0894:Myo7b UTSW 18 32,133,123 (GRCm39) missense probably damaging 1.00
R0966:Myo7b UTSW 18 32,131,816 (GRCm39) missense probably damaging 1.00
R1205:Myo7b UTSW 18 32,127,395 (GRCm39) missense probably damaging 1.00
R1387:Myo7b UTSW 18 32,116,805 (GRCm39) splice site probably benign
R1523:Myo7b UTSW 18 32,099,929 (GRCm39) missense probably damaging 1.00
R1544:Myo7b UTSW 18 32,127,962 (GRCm39) missense probably benign 0.10
R1623:Myo7b UTSW 18 32,133,104 (GRCm39) missense probably damaging 1.00
R1780:Myo7b UTSW 18 32,094,238 (GRCm39) missense probably damaging 1.00
R1785:Myo7b UTSW 18 32,127,950 (GRCm39) missense probably benign
R1786:Myo7b UTSW 18 32,127,950 (GRCm39) missense probably benign
R1796:Myo7b UTSW 18 32,119,728 (GRCm39) missense possibly damaging 0.93
R1907:Myo7b UTSW 18 32,110,052 (GRCm39) missense possibly damaging 0.89
R2027:Myo7b UTSW 18 32,118,013 (GRCm39) missense probably benign
R2102:Myo7b UTSW 18 32,133,031 (GRCm39) missense probably damaging 1.00
R2174:Myo7b UTSW 18 32,116,610 (GRCm39) missense probably damaging 1.00
R2272:Myo7b UTSW 18 32,110,096 (GRCm39) missense probably benign 0.41
R2323:Myo7b UTSW 18 32,104,398 (GRCm39) missense probably damaging 1.00
R2365:Myo7b UTSW 18 32,147,384 (GRCm39) missense probably damaging 0.98
R3078:Myo7b UTSW 18 32,100,237 (GRCm39) missense probably benign 0.04
R3522:Myo7b UTSW 18 32,143,132 (GRCm39) missense probably damaging 1.00
R3788:Myo7b UTSW 18 32,107,165 (GRCm39) missense possibly damaging 0.95
R3880:Myo7b UTSW 18 32,102,567 (GRCm39) missense probably damaging 0.96
R4334:Myo7b UTSW 18 32,110,040 (GRCm39) missense probably damaging 1.00
R4343:Myo7b UTSW 18 32,116,680 (GRCm39) missense probably damaging 1.00
R4497:Myo7b UTSW 18 32,147,282 (GRCm39) missense probably benign 0.06
R4498:Myo7b UTSW 18 32,147,282 (GRCm39) missense probably benign 0.06
R4551:Myo7b UTSW 18 32,118,161 (GRCm39) missense probably benign 0.01
R4593:Myo7b UTSW 18 32,146,428 (GRCm39) missense possibly damaging 0.77
R4616:Myo7b UTSW 18 32,136,540 (GRCm39) splice site probably null
R4646:Myo7b UTSW 18 32,127,422 (GRCm39) missense probably benign 0.25
R4648:Myo7b UTSW 18 32,100,178 (GRCm39) splice site probably null
R4737:Myo7b UTSW 18 32,131,655 (GRCm39) missense probably damaging 1.00
R4765:Myo7b UTSW 18 32,094,953 (GRCm39) missense probably benign 0.00
R4790:Myo7b UTSW 18 32,133,158 (GRCm39) splice site probably null
R4909:Myo7b UTSW 18 32,097,489 (GRCm39) missense probably benign 0.01
R5027:Myo7b UTSW 18 32,108,265 (GRCm39) missense probably benign 0.22
R5034:Myo7b UTSW 18 32,104,440 (GRCm39) missense probably damaging 1.00
R5112:Myo7b UTSW 18 32,116,640 (GRCm39) missense probably damaging 1.00
R5266:Myo7b UTSW 18 32,131,787 (GRCm39) missense probably damaging 1.00
R5267:Myo7b UTSW 18 32,131,787 (GRCm39) missense probably damaging 1.00
R5348:Myo7b UTSW 18 32,116,972 (GRCm39) missense probably damaging 0.96
R5457:Myo7b UTSW 18 32,104,503 (GRCm39) splice site probably null
R5540:Myo7b UTSW 18 32,140,143 (GRCm39) missense probably damaging 1.00
R5628:Myo7b UTSW 18 32,107,240 (GRCm39) missense probably benign
R5815:Myo7b UTSW 18 32,099,341 (GRCm39) missense probably damaging 1.00
R6062:Myo7b UTSW 18 32,101,043 (GRCm39) missense possibly damaging 0.94
R6137:Myo7b UTSW 18 32,133,027 (GRCm39) missense probably damaging 1.00
R6158:Myo7b UTSW 18 32,121,602 (GRCm39) missense probably benign 0.00
R6218:Myo7b UTSW 18 32,092,507 (GRCm39) missense probably benign 0.10
R6256:Myo7b UTSW 18 32,116,748 (GRCm39) missense probably damaging 1.00
R6257:Myo7b UTSW 18 32,146,468 (GRCm39) missense probably damaging 1.00
R6265:Myo7b UTSW 18 32,131,203 (GRCm39) missense probably damaging 1.00
R6302:Myo7b UTSW 18 32,127,439 (GRCm39) missense probably damaging 0.98
R6438:Myo7b UTSW 18 32,099,382 (GRCm39) missense probably damaging 1.00
R6654:Myo7b UTSW 18 32,123,322 (GRCm39) missense possibly damaging 0.46
R7030:Myo7b UTSW 18 32,104,626 (GRCm39) missense probably damaging 1.00
R7090:Myo7b UTSW 18 32,131,765 (GRCm39) missense probably damaging 1.00
R7210:Myo7b UTSW 18 32,140,155 (GRCm39) missense probably damaging 1.00
R7218:Myo7b UTSW 18 32,114,054 (GRCm39) missense probably benign 0.05
R7378:Myo7b UTSW 18 32,099,292 (GRCm39) missense probably damaging 1.00
R7458:Myo7b UTSW 18 32,121,604 (GRCm39) missense possibly damaging 0.89
R7517:Myo7b UTSW 18 32,146,320 (GRCm39) missense probably damaging 0.99
R7559:Myo7b UTSW 18 32,116,413 (GRCm39) missense probably benign 0.01
R7667:Myo7b UTSW 18 32,094,958 (GRCm39) missense probably benign
R7737:Myo7b UTSW 18 32,147,257 (GRCm39) nonsense probably null
R7942:Myo7b UTSW 18 32,146,422 (GRCm39) missense probably damaging 0.98
R8030:Myo7b UTSW 18 32,131,135 (GRCm39) missense probably damaging 0.96
R8114:Myo7b UTSW 18 32,098,677 (GRCm39) missense probably damaging 1.00
R8338:Myo7b UTSW 18 32,104,408 (GRCm39) missense probably damaging 0.96
R8341:Myo7b UTSW 18 32,116,979 (GRCm39) missense probably benign 0.39
R8406:Myo7b UTSW 18 32,092,866 (GRCm39) missense probably damaging 1.00
R8464:Myo7b UTSW 18 32,095,757 (GRCm39) missense probably benign 0.00
R8517:Myo7b UTSW 18 32,100,244 (GRCm39) missense possibly damaging 0.87
R8537:Myo7b UTSW 18 32,110,142 (GRCm39) missense probably benign 0.08
R8546:Myo7b UTSW 18 32,123,201 (GRCm39) missense probably benign 0.19
R8721:Myo7b UTSW 18 32,140,064 (GRCm39) missense probably damaging 1.00
R8841:Myo7b UTSW 18 32,097,490 (GRCm39) missense probably benign 0.06
R8853:Myo7b UTSW 18 32,119,744 (GRCm39) missense possibly damaging 0.67
R8960:Myo7b UTSW 18 32,127,299 (GRCm39) splice site probably benign
R8984:Myo7b UTSW 18 32,099,402 (GRCm39) missense probably null 0.68
R9356:Myo7b UTSW 18 32,110,096 (GRCm39) missense probably damaging 1.00
R9357:Myo7b UTSW 18 32,093,129 (GRCm39) missense probably damaging 1.00
R9364:Myo7b UTSW 18 32,133,413 (GRCm39) missense probably benign 0.12
R9405:Myo7b UTSW 18 32,109,356 (GRCm39) missense probably benign 0.00
R9533:Myo7b UTSW 18 32,108,297 (GRCm39) missense probably benign 0.27
R9776:Myo7b UTSW 18 32,133,068 (GRCm39) missense probably benign 0.45
X0027:Myo7b UTSW 18 32,098,689 (GRCm39) missense probably damaging 1.00
Z1176:Myo7b UTSW 18 32,114,051 (GRCm39) missense possibly damaging 0.82
Z1177:Myo7b UTSW 18 32,118,109 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCCAGGCTCATGTCAGAGTAG -3'
(R):5'- AGCCAGGAGATGATTTGTCTGTC -3'

Sequencing Primer
(F):5'- CTCATGTCAGAGTAGTTGAATAGCCG -3'
(R):5'- CAGGAGATGATTTGTCTGTCTGTCC -3'
Posted On 2021-03-08