Incidental Mutation 'R0310:Zic2'
ID66441
Institutional Source Beutler Lab
Gene Symbol Zic2
Ensembl Gene ENSMUSG00000061524
Gene Namezinc finger protein of the cerebellum 2
Synonymsodd-paired homolog, GENA 29, Ku
MMRRC Submission 038520-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.933) question?
Stock #R0310 (G1)
Quality Score136
Status Validated
Chromosome14
Chromosomal Location122475435-122479852 bp(+) (GRCm38)
Type of Mutationsmall deletion (2 aa in frame mutation)
DNA Base Change (assembly) CCCACCACCACCATCACCACCACCACC to CCCACCATCACCACCACCACC at 122476364 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000075283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075888]
Predicted Effect probably benign
Transcript: ENSMUST00000075888
SMART Domains Protein: ENSMUSP00000075283
Gene: ENSMUSG00000061524

DomainStartEndE-ValueType
low complexity region 18 33 N/A INTRINSIC
low complexity region 81 103 N/A INTRINSIC
low complexity region 131 150 N/A INTRINSIC
low complexity region 215 241 N/A INTRINSIC
ZnF_C2H2 265 290 5.68e1 SMART
ZnF_C2H2 299 326 6.92e0 SMART
ZnF_C2H2 332 356 8.02e-5 SMART
ZnF_C2H2 362 386 1.69e-3 SMART
ZnF_C2H2 392 414 4.54e-4 SMART
low complexity region 416 434 N/A INTRINSIC
low complexity region 455 519 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135485
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137059
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177306
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.3%
  • 10x: 93.3%
  • 20x: 82.5%
Validation Efficiency 99% (113/114)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ZIC family of C2H2-type zinc finger proteins. This protein functions as a transcriptional repressor and may regulate tissue specific expression of dopamine receptor D1. Expansion of an alanine repeat in the C-terminus of the encoded protein and other mutations in this gene cause holoprosencephaly type 5. Holoprosencephaly is the most common structural anomaly of the human brain. A polyhistidine tract polymorphism in this gene may be associated with increased risk of neural tube defects. This gene is closely linked to a gene encoding zinc finger protein of the cerebellum 5, a related family member on chromosome 13. [provided by RefSeq, Jul 2016]
PHENOTYPE: Defects in neurulation and forebrain development have been identified in both targeted and ENU induced homozygous mutants. Death occurs perinatally in the targeted mouse and during midgestation in the ENU mouse. Mice homozygous for a knock-down allele exhibit cognitive and social behavior defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 109 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik A C 9: 53,425,671 T92P probably damaging Het
9530053A07Rik G T 7: 28,142,274 V545L probably benign Het
Abca13 T C 11: 9,293,810 V1891A probably benign Het
Abcc1 T A 16: 14,410,927 I346N probably damaging Het
Afdn G T 17: 13,885,508 probably null Het
Ahrr G A 13: 74,283,024 probably benign Het
Akap13 A G 7: 75,614,930 D507G probably damaging Het
Akap8 A T 17: 32,316,260 M260K possibly damaging Het
Akr1b8 T C 6: 34,365,259 V265A probably benign Het
Alpk3 C G 7: 81,078,610 P496R possibly damaging Het
Ankrd13b A G 11: 77,472,745 V249A possibly damaging Het
Arid4a T C 12: 71,075,830 V995A probably benign Het
Ascc3 G T 10: 50,748,926 V1637L probably benign Het
Atad2 G A 15: 58,114,257 A499V probably damaging Het
Barhl2 G T 5: 106,457,387 A152E possibly damaging Het
Bbs12 T A 3: 37,321,045 D547E probably damaging Het
Btaf1 A G 19: 37,004,534 M1655V probably damaging Het
Ccdc50 T A 16: 27,406,658 H40Q probably damaging Het
Ccr9 A T 9: 123,774,552 probably benign Het
Cdh15 A G 8: 122,865,436 D654G probably damaging Het
Cebpz T C 17: 78,926,124 D758G probably damaging Het
Cgn C T 3: 94,765,653 R906K possibly damaging Het
Chil3 T A 3: 106,160,523 M109L possibly damaging Het
Cntnap4 A T 8: 112,842,516 probably null Het
Cyp4f18 C T 8: 72,001,012 probably benign Het
Daam2 A G 17: 49,463,924 probably null Het
Ddost T A 4: 138,310,611 H220Q probably benign Het
Dennd2a C T 6: 39,464,201 probably benign Het
Depdc1b G A 13: 108,373,841 V296I possibly damaging Het
Dnah5 A T 15: 28,299,110 R1539S probably benign Het
Dusp22 T C 13: 30,705,658 I74T probably damaging Het
Dyx1c1 A T 9: 72,972,336 D386V probably damaging Het
E130309D02Rik G T 5: 143,307,888 T278K probably benign Het
Epc1 A G 18: 6,440,202 probably benign Het
Epha7 A G 4: 28,961,301 I845V probably benign Het
Fanci C T 7: 79,407,417 probably benign Het
Fbn1 T A 2: 125,363,644 E1104V probably damaging Het
Fbxo8 T A 8: 56,590,097 F205L probably damaging Het
Fetub T C 16: 22,929,756 probably benign Het
Frs3 T C 17: 47,703,822 V480A probably benign Het
Gne C A 4: 44,060,157 E79* probably null Het
Hrc T A 7: 45,336,497 H357Q probably benign Het
Idh1 T C 1: 65,161,920 M291V probably damaging Het
Iltifb T A 10: 118,293,185 H133L probably benign Het
Ino80b T C 6: 83,124,091 E165G probably damaging Het
Inppl1 A T 7: 101,828,499 probably benign Het
Ip6k2 T C 9: 108,799,233 probably benign Het
Itga11 A T 9: 62,760,346 I654F probably damaging Het
Jag2 G T 12: 112,913,377 probably benign Het
Katna1 G T 10: 7,743,749 probably benign Het
Kcnh4 G T 11: 100,746,169 S707Y probably benign Het
Kcnn2 T G 18: 45,560,518 L387R probably damaging Het
Khnyn A G 14: 55,887,968 T503A probably damaging Het
Lama5 G T 2: 180,181,566 probably benign Het
Lmbr1l A T 15: 98,908,773 probably benign Het
Mast4 A T 13: 102,754,161 S870T possibly damaging Het
Med1 A G 11: 98,167,574 Y266H probably benign Het
Med13 A T 11: 86,346,003 N109K probably benign Het
Mgam T C 6: 40,761,035 probably benign Het
Mmp8 A G 9: 7,561,454 Q153R probably benign Het
Mpeg1 C A 19: 12,461,691 T171N probably benign Het
Mtus2 T C 5: 148,107,019 S806P probably benign Het
Naip2 T A 13: 100,148,842 E1226V probably damaging Het
Naip6 A G 13: 100,308,213 F246L possibly damaging Het
Nav3 T C 10: 109,767,128 I1187V possibly damaging Het
Nbeal1 T C 1: 60,305,370 probably benign Het
Nbeal2 C A 9: 110,638,163 V653L probably damaging Het
Ndufa9 G T 6: 126,827,532 probably benign Het
Nlrp5 G T 7: 23,430,157 C883F probably damaging Het
Nr0b2 C A 4: 133,555,992 probably null Het
Olfr24 T A 9: 18,755,333 M101L possibly damaging Het
Olfr799 T A 10: 129,647,731 V201E probably damaging Het
Olfr822 G A 10: 130,074,823 V138I probably benign Het
Olfr888 T A 9: 38,109,486 S267T possibly damaging Het
Pkhd1 A T 1: 20,549,822 probably null Het
Pkhd1l1 A G 15: 44,522,738 probably benign Het
Ppm1l A G 3: 69,549,461 K237R probably benign Het
Ppp1r18 T C 17: 35,873,711 probably benign Het
Ptpn3 A T 4: 57,204,958 D734E probably benign Het
Pxdn T C 12: 30,015,529 C1283R probably damaging Het
Rbm12 A G 2: 156,095,724 probably benign Het
Rttn A T 18: 89,009,460 probably benign Het
Sgsm1 G T 5: 113,263,705 H431Q probably benign Het
Siah3 A G 14: 75,525,927 N206S possibly damaging Het
Slc22a15 G T 3: 101,860,511 D521E probably benign Het
Sprr2k A T 3: 92,433,463 probably benign Het
Stab2 G A 10: 86,967,613 probably benign Het
Sval3 T A 6: 41,968,186 L16Q probably damaging Het
Sycp2 C G 2: 178,381,855 S456T probably benign Het
Tk1 T C 11: 117,817,095 probably benign Het
Tlk2 C A 11: 105,254,973 A335E probably benign Het
Tmtc1 T C 6: 148,249,581 K659E probably benign Het
Tnk2 C T 16: 32,680,590 P907L probably benign Het
Trim14 C A 4: 46,522,043 K211N probably damaging Het
Trim15 A C 17: 36,866,986 L39R probably damaging Het
Tspan15 T A 10: 62,188,093 T269S probably benign Het
Ttc7 T A 17: 87,361,864 D646E probably benign Het
Ttll6 A T 11: 96,147,556 Q410L probably benign Het
Unc79 A G 12: 103,061,407 Q419R probably damaging Het
Vcam1 A T 3: 116,114,416 Y666N possibly damaging Het
Vmn1r10 A T 6: 57,113,501 Y26F probably damaging Het
Vmn1r80 A G 7: 12,193,848 N295S probably benign Het
Vmn2r114 A T 17: 23,290,943 H854Q probably benign Het
Vmn2r2 A T 3: 64,134,618 D225E probably damaging Het
Vmn2r4 A T 3: 64,389,434 Y643* probably null Het
Vmn2r52 T A 7: 10,159,466 Y582F probably damaging Het
Vmn2r60 G T 7: 42,195,140 L642F possibly damaging Het
Zbtb20 T C 16: 43,609,746 S207P probably damaging Het
Zkscan7 G T 9: 122,888,893 E118* probably null Het
Other mutations in Zic2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00816:Zic2 APN 14 122478559 nonsense probably null
IGL01607:Zic2 APN 14 122478882 splice site probably benign
IGL02307:Zic2 APN 14 122476634 missense possibly damaging 0.76
IGL02311:Zic2 APN 14 122476194 missense probably damaging 0.99
IGL02561:Zic2 APN 14 122478545 nonsense probably null
IGL02982:Zic2 APN 14 122478567 missense probably damaging 0.98
R0001:Zic2 UTSW 14 122478957 missense probably damaging 0.99
R0027:Zic2 UTSW 14 122476343 missense possibly damaging 0.77
R0136:Zic2 UTSW 14 122476541 missense probably damaging 0.96
R0418:Zic2 UTSW 14 122476364 small deletion probably benign
R0420:Zic2 UTSW 14 122476364 small deletion probably benign
R0421:Zic2 UTSW 14 122476364 small deletion probably benign
R0518:Zic2 UTSW 14 122476364 small deletion probably benign
R0520:Zic2 UTSW 14 122476364 small deletion probably benign
R0521:Zic2 UTSW 14 122476364 small deletion probably benign
R0628:Zic2 UTSW 14 122476364 small deletion probably benign
R1733:Zic2 UTSW 14 122478947 missense probably damaging 0.97
R1757:Zic2 UTSW 14 122478619 missense possibly damaging 0.86
R2398:Zic2 UTSW 14 122478917 nonsense probably null
R5323:Zic2 UTSW 14 122476316 missense probably damaging 1.00
R5381:Zic2 UTSW 14 122475815 missense probably damaging 0.97
R6930:Zic2 UTSW 14 122476457 missense probably damaging 0.99
R7223:Zic2 UTSW 14 122476091 missense probably damaging 0.98
Z1088:Zic2 UTSW 14 122478675 missense probably damaging 0.98
Predicted Primers
Posted On2013-08-19