Incidental Mutation 'R8772:Atp1a1'
ID664444
Institutional Source Beutler Lab
Gene Symbol Atp1a1
Ensembl Gene ENSMUSG00000033161
Gene NameATPase, Na+/K+ transporting, alpha 1 polypeptide
SynonymsAtpa-1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8772 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location101576219-101604684 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 101579808 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 895 (V895G)
Ref Sequence ENSEMBL: ENSMUSP00000039657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036493]
Predicted Effect probably benign
Transcript: ENSMUST00000036493
AA Change: V895G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000039657
Gene: ENSMUSG00000033161
AA Change: V895G

DomainStartEndE-ValueType
low complexity region 21 28 N/A INTRINSIC
Cation_ATPase_N 42 116 5e-20 SMART
Pfam:E1-E2_ATPase 134 365 1.6e-59 PFAM
Pfam:Hydrolase 370 729 2.7e-19 PFAM
Pfam:HAD 373 726 1.3e-18 PFAM
Pfam:Cation_ATPase 426 521 2.2e-25 PFAM
Pfam:Cation_ATPase_C 799 1008 1.2e-46 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 1 subunit. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene have a lethal phenotype. Heterozygotes display increased anxiety and decreased exploratory behavior in a new environment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 T C 17: 45,516,977 V574A probably benign Het
AC157566.4 T C 15: 76,534,249 Y20C probably benign Het
Acacb A T 5: 114,184,118 D231V possibly damaging Het
Acp7 C T 7: 28,616,484 V226M probably damaging Het
Actr1a A G 19: 46,382,292 probably null Het
Adamts16 T C 13: 70,836,334 Y70C probably damaging Het
Adcy5 G A 16: 35,299,588 A1156T probably damaging Het
Akap9 G A 5: 4,046,255 E2377K probably damaging Het
Asic2 A G 11: 81,967,887 S100P probably benign Het
B3gnt7 A G 1: 86,305,572 E180G possibly damaging Het
Cacna1c A T 6: 118,602,322 F1805I Het
Cacna1g A G 11: 94,465,887 I141T probably benign Het
Ccdc162 A G 10: 41,630,037 L919P probably damaging Het
Cd47 A G 16: 49,884,212 I116V Het
Cdca2 A T 14: 67,698,080 D395E probably damaging Het
Celsr2 A T 3: 108,397,073 I2285N possibly damaging Het
Chil5 T C 3: 106,018,220 D157G probably damaging Het
Ciita A T 16: 10,480,162 I7F probably damaging Het
Dok7 G T 5: 35,077,249 G215C probably damaging Het
Eif2s2 T C 2: 154,887,739 I88V probably null Het
Fasn A T 11: 120,820,536 D217E probably benign Het
Fgd5 T A 6: 92,050,419 I1030N probably damaging Het
Fpr-rs6 T A 17: 20,182,233 N289Y probably damaging Het
Gm10392 C T 11: 77,518,454 V49I possibly damaging Het
Gtf3c2 A T 5: 31,174,414 M20K probably benign Het
Hoga1 A G 19: 42,045,945 M10V probably benign Het
Homer1 T A 13: 93,391,731 V258E probably damaging Het
Ifitm2 A G 7: 140,955,890 L9S probably benign Het
Iqgap3 G A 3: 88,089,837 A176T probably benign Het
Itga8 C G 2: 12,182,684 G728A probably damaging Het
Lyst C T 13: 13,637,492 Q830* probably null Het
Macc1 T C 12: 119,447,485 W663R probably damaging Het
Mipol1 A T 12: 57,325,632 H159L probably benign Het
Mocs1 T A 17: 49,450,374 probably null Het
Ncoa1 T C 12: 4,322,940 T154A possibly damaging Het
Noxred1 A C 12: 87,227,093 L58R probably benign Het
Olfr205 A G 16: 59,328,688 S274P probably damaging Het
Olfr78 G A 7: 102,743,003 probably benign Het
Olfr895 G A 9: 38,268,935 V133I probably benign Het
Opcml T C 9: 27,791,411 V9A probably benign Het
Otog A T 7: 46,284,928 R1303S probably damaging Het
Parp11 T A 6: 127,470,763 M20K possibly damaging Het
Parp11 T A 6: 127,491,704 I322N probably damaging Het
Pglyrp4 A T 3: 90,740,400 T356S possibly damaging Het
Pitrm1 A G 13: 6,578,560 D963G probably damaging Het
Plod3 T C 5: 136,988,919 V183A probably damaging Het
Plxnb2 C T 15: 89,162,746 V791M probably damaging Het
Ppp1r7 A G 1: 93,354,428 T234A probably benign Het
Pxdn C T 12: 30,015,464 T1441I probably damaging Het
Rap1gap2 T C 11: 74,405,725 K479E probably damaging Het
Rars2 A G 4: 34,623,488 D63G probably benign Het
Rptor A C 11: 119,725,032 D124A probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Ryr1 C A 7: 29,116,132 R118L probably benign Het
Sap130 G C 18: 31,680,464 D525H probably damaging Het
Slc22a26 T C 19: 7,790,112 N310D probably benign Het
Slc46a1 T G 11: 78,465,951 N58K probably benign Het
Slc4a10 T A 2: 62,303,940 I1000N probably damaging Het
Son C T 16: 91,657,938 T1191I possibly damaging Het
Sppl2a T C 2: 126,926,311 K146E probably benign Het
Srgap3 T A 6: 112,766,945 K444I probably damaging Het
Sun1 T C 5: 139,223,692 V59A probably benign Het
Sva T A 6: 42,038,509 Y37N probably benign Het
Taar8c T A 10: 24,101,807 M36L probably benign Het
Taf4b C T 18: 14,835,852 T682I probably damaging Het
Tbx5 T A 5: 119,838,725 H59Q probably benign Het
Tdrd1 A T 19: 56,855,328 Y746F probably damaging Het
Tmem132e A G 11: 82,434,311 S46G probably damaging Het
Tnfaip6 T A 2: 52,051,065 V206E possibly damaging Het
Ttn T A 2: 76,937,681 K3025* probably null Het
Tulp4 T A 17: 6,176,893 I106N probably damaging Het
Ubp1 T A 9: 113,972,829 F454Y probably benign Het
Ugt2b37 A T 5: 87,254,486 N95K probably benign Het
Vps13d T A 4: 145,075,032 R3539W Het
Vsnl1 T C 12: 11,332,179 H67R probably damaging Het
Zbbx A G 3: 75,155,385 Y22H probably benign Het
Zeb1 A G 18: 5,770,382 probably null Het
Zfp142 A T 1: 74,571,666 L990Q possibly damaging Het
Zmiz1 G A 14: 25,645,694 G265D probably damaging Het
Other mutations in Atp1a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01396:Atp1a1 APN 3 101591453 missense probably damaging 1.00
IGL01700:Atp1a1 APN 3 101594258 missense possibly damaging 0.95
IGL01836:Atp1a1 APN 3 101591414 missense probably damaging 1.00
IGL01863:Atp1a1 APN 3 101591889 nonsense probably null
IGL02021:Atp1a1 APN 3 101594208 missense probably benign 0.02
IGL02078:Atp1a1 APN 3 101591863 missense probably damaging 1.00
IGL02873:Atp1a1 APN 3 101576578 missense probably benign 0.16
IGL02934:Atp1a1 APN 3 101576992 nonsense probably null
IGL03068:Atp1a1 APN 3 101583859 missense probably benign 0.26
PIT4453001:Atp1a1 UTSW 3 101581179 missense probably benign 0.01
R0009:Atp1a1 UTSW 3 101579835 missense possibly damaging 0.67
R0506:Atp1a1 UTSW 3 101589812 missense probably damaging 0.96
R0724:Atp1a1 UTSW 3 101592439 missense possibly damaging 0.50
R0826:Atp1a1 UTSW 3 101584853 missense probably damaging 0.99
R1457:Atp1a1 UTSW 3 101590466 missense probably damaging 1.00
R1732:Atp1a1 UTSW 3 101584799 missense probably damaging 1.00
R1843:Atp1a1 UTSW 3 101582017 missense probably benign 0.43
R2172:Atp1a1 UTSW 3 101590548 missense probably benign
R3770:Atp1a1 UTSW 3 101581194 missense probably benign 0.17
R3905:Atp1a1 UTSW 3 101590612 missense probably benign 0.00
R4602:Atp1a1 UTSW 3 101586943 missense probably benign 0.00
R4611:Atp1a1 UTSW 3 101586943 missense probably benign 0.00
R4715:Atp1a1 UTSW 3 101591806 missense possibly damaging 0.90
R4777:Atp1a1 UTSW 3 101594996 critical splice donor site probably null
R4795:Atp1a1 UTSW 3 101583775 missense probably benign 0.15
R5030:Atp1a1 UTSW 3 101579817 missense probably benign 0.22
R5066:Atp1a1 UTSW 3 101582104 missense probably damaging 0.98
R5165:Atp1a1 UTSW 3 101581789 missense probably benign 0.01
R5297:Atp1a1 UTSW 3 101591127 missense possibly damaging 0.82
R5307:Atp1a1 UTSW 3 101589964 missense probably damaging 1.00
R5379:Atp1a1 UTSW 3 101582095 missense probably benign 0.01
R5495:Atp1a1 UTSW 3 101591425 missense probably benign 0.01
R5946:Atp1a1 UTSW 3 101589774 missense probably benign 0.12
R6125:Atp1a1 UTSW 3 101590707 missense probably damaging 1.00
R6789:Atp1a1 UTSW 3 101586298 missense possibly damaging 0.71
R7339:Atp1a1 UTSW 3 101589872 missense probably benign 0.44
R7552:Atp1a1 UTSW 3 101582121 nonsense probably null
R7825:Atp1a1 UTSW 3 101586169 missense probably benign 0.00
R8098:Atp1a1 UTSW 3 101582049 missense probably damaging 0.97
R8175:Atp1a1 UTSW 3 101584854 missense possibly damaging 0.79
R8281:Atp1a1 UTSW 3 101579624 missense probably benign 0.12
R8403:Atp1a1 UTSW 3 101586904 missense probably damaging 1.00
R8435:Atp1a1 UTSW 3 101582762 missense probably benign
R8461:Atp1a1 UTSW 3 101589089 missense probably benign 0.01
R8782:Atp1a1 UTSW 3 101594217 missense possibly damaging 0.63
R8919:Atp1a1 UTSW 3 101591231 missense probably damaging 1.00
R9066:Atp1a1 UTSW 3 101582022 missense probably damaging 1.00
X0019:Atp1a1 UTSW 3 101594213 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGCTCGTAGGTCTGAAAGGG -3'
(R):5'- AGTTGGTGATCCAGAATGGG -3'

Sequencing Primer
(F):5'- CTCGTAGGTCTGAAAGGGGAAGC -3'
(R):5'- AGAACTCTCTGGGGCTGCTG -3'
Posted On2021-03-08