Incidental Mutation 'R8772:Acacb'
ID 664453
Institutional Source Beutler Lab
Gene Symbol Acacb
Ensembl Gene ENSMUSG00000042010
Gene Name acetyl-Coenzyme A carboxylase beta
Synonyms Acc2, Accb
MMRRC Submission 068626-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8772 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 114284748-114388822 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 114322179 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 231 (D231V)
Ref Sequence ENSEMBL: ENSMUSP00000031583 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031583] [ENSMUST00000102582] [ENSMUST00000146841]
AlphaFold E9Q4Z2
Predicted Effect possibly damaging
Transcript: ENSMUST00000031583
AA Change: D231V

PolyPhen 2 Score 0.733 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000031583
Gene: ENSMUSG00000042010
AA Change: D231V

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 38 60 N/A INTRINSIC
Pfam:CPSase_L_chain 249 369 2.1e-32 PFAM
Pfam:CPSase_L_D2 405 606 3.3e-52 PFAM
Pfam:ATP-grasp_4 413 576 2.1e-9 PFAM
Biotin_carb_C 640 747 9.54e-26 SMART
Pfam:Biotin_lipoyl 885 951 1.9e-17 PFAM
Pfam:ACC_central 952 1678 2.2e-290 PFAM
Pfam:Carboxyl_trans 1770 2324 2.3e-181 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000102582
AA Change: D231V

PolyPhen 2 Score 0.733 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000099642
Gene: ENSMUSG00000042010
AA Change: D231V

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 38 60 N/A INTRINSIC
Pfam:CPSase_L_chain 249 369 8.2e-29 PFAM
Pfam:CPSase_L_D2 405 606 3.8e-52 PFAM
Pfam:ATP-grasp_4 409 576 1.4e-12 PFAM
Biotin_carb_C 640 747 9.54e-26 SMART
Pfam:Biotin_lipoyl 885 951 9.1e-17 PFAM
Pfam:ACC_central 952 1678 2.3e-250 PFAM
Pfam:Carboxyl_trans 1770 2324 4.8e-172 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000146841
AA Change: D39V

PolyPhen 2 Score 0.745 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000115432
Gene: ENSMUSG00000042010
AA Change: D39V

DomainStartEndE-ValueType
Pfam:CPSase_L_chain 57 146 6.4e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency 100% (83/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. ACC-beta is thought to control fatty acid oxidation by means of the ability of malonyl-CoA to inhibit carnitine-palmitoyl-CoA transferase I, the rate-limiting step in fatty acid uptake and oxidation by mitochondria. ACC-beta may be involved in the regulation of fatty acid oxidation, rather than fatty acid biosynthesis. There is evidence for the presence of two ACC-beta isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile and overtly normal but exhibit high levels of fatty acid oxidation, as well as reduced fat accumulation in their adipose tissue and liver, and decreased storage of glycogen in their liver. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 T C 17: 45,827,903 (GRCm39) V574A probably benign Het
AC157566.4 T C 15: 76,418,449 (GRCm39) Y20C probably benign Het
Acp7 C T 7: 28,315,909 (GRCm39) V226M probably damaging Het
Actr1a A G 19: 46,370,731 (GRCm39) probably null Het
Adamts16 T C 13: 70,984,453 (GRCm39) Y70C probably damaging Het
Adcy5 G A 16: 35,119,958 (GRCm39) A1156T probably damaging Het
Ago1 A T 4: 126,354,316 (GRCm39) probably benign Het
Akap9 G A 5: 4,096,255 (GRCm39) E2377K probably damaging Het
Asic2 A G 11: 81,858,713 (GRCm39) S100P probably benign Het
Atp1a1 A C 3: 101,487,124 (GRCm39) V895G probably benign Het
B3gnt7 A G 1: 86,233,294 (GRCm39) E180G possibly damaging Het
Cacna1c A T 6: 118,579,283 (GRCm39) F1805I Het
Cacna1g A G 11: 94,356,713 (GRCm39) I141T probably benign Het
Ccdc162 A G 10: 41,506,033 (GRCm39) L919P probably damaging Het
Cd47 A G 16: 49,704,575 (GRCm39) I116V Het
Cdca2 A T 14: 67,935,529 (GRCm39) D395E probably damaging Het
Celsr2 A T 3: 108,304,389 (GRCm39) I2285N possibly damaging Het
Chil5 T C 3: 105,925,536 (GRCm39) D157G probably damaging Het
Ciita A T 16: 10,298,026 (GRCm39) I7F probably damaging Het
Dok7 G T 5: 35,234,593 (GRCm39) G215C probably damaging Het
Eif2s2 T C 2: 154,729,659 (GRCm39) I88V probably null Het
Fasn A T 11: 120,711,362 (GRCm39) D217E probably benign Het
Fgd5 T A 6: 92,027,400 (GRCm39) I1030N probably damaging Het
Fpr-rs6 T A 17: 20,402,495 (GRCm39) N289Y probably damaging Het
Gm10392 C T 11: 77,409,280 (GRCm39) V49I possibly damaging Het
Gtf3c2 A T 5: 31,331,758 (GRCm39) M20K probably benign Het
Hoga1 A G 19: 42,034,384 (GRCm39) M10V probably benign Het
Homer1 T A 13: 93,528,239 (GRCm39) V258E probably damaging Het
Ifitm2 A G 7: 140,535,803 (GRCm39) L9S probably benign Het
Iqgap3 G A 3: 87,997,144 (GRCm39) A176T probably benign Het
Itga8 C G 2: 12,187,495 (GRCm39) G728A probably damaging Het
Lyst C T 13: 13,812,077 (GRCm39) Q830* probably null Het
Macc1 T C 12: 119,411,220 (GRCm39) W663R probably damaging Het
Mipol1 A T 12: 57,372,418 (GRCm39) H159L probably benign Het
Mocs1 T A 17: 49,757,402 (GRCm39) probably null Het
Ncoa1 T C 12: 4,372,940 (GRCm39) T154A possibly damaging Het
Noxred1 A C 12: 87,273,867 (GRCm39) L58R probably benign Het
Opcml T C 9: 27,702,707 (GRCm39) V9A probably benign Het
Or51e2 G A 7: 102,392,210 (GRCm39) probably benign Het
Or5ac23 A G 16: 59,149,051 (GRCm39) S274P probably damaging Het
Or8c17 G A 9: 38,180,231 (GRCm39) V133I probably benign Het
Otog A T 7: 45,934,352 (GRCm39) R1303S probably damaging Het
Parp11 T A 6: 127,468,667 (GRCm39) I322N probably damaging Het
Parp11 T A 6: 127,447,726 (GRCm39) M20K possibly damaging Het
Pde1b T C 15: 103,433,548 (GRCm39) probably benign Het
Pglyrp4 A T 3: 90,647,707 (GRCm39) T356S possibly damaging Het
Pitrm1 A G 13: 6,628,596 (GRCm39) D963G probably damaging Het
Plod3 T C 5: 137,017,773 (GRCm39) V183A probably damaging Het
Plxnb2 C T 15: 89,046,949 (GRCm39) V791M probably damaging Het
Poc1b T A 10: 98,992,219 (GRCm39) probably benign Het
Ppp1r7 A G 1: 93,282,150 (GRCm39) T234A probably benign Het
Pxdn C T 12: 30,065,463 (GRCm39) T1441I probably damaging Het
Rap1gap2 T C 11: 74,296,551 (GRCm39) K479E probably damaging Het
Rars2 A G 4: 34,623,488 (GRCm39) D63G probably benign Het
Rptor A C 11: 119,615,858 (GRCm39) D124A probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,229,115 (GRCm39) probably benign Het
Ryr1 C A 7: 28,815,557 (GRCm39) R118L probably benign Het
Sap130 G C 18: 31,813,517 (GRCm39) D525H probably damaging Het
Slc22a26 T C 19: 7,767,477 (GRCm39) N310D probably benign Het
Slc46a1 T G 11: 78,356,777 (GRCm39) N58K probably benign Het
Slc4a10 T A 2: 62,134,284 (GRCm39) I1000N probably damaging Het
Son C T 16: 91,454,826 (GRCm39) T1191I possibly damaging Het
Sppl2a T C 2: 126,768,231 (GRCm39) K146E probably benign Het
Srgap3 T A 6: 112,743,906 (GRCm39) K444I probably damaging Het
Sun1 T C 5: 139,209,447 (GRCm39) V59A probably benign Het
Sva T A 6: 42,015,443 (GRCm39) Y37N probably benign Het
Taar8c T A 10: 23,977,705 (GRCm39) M36L probably benign Het
Taf4b C T 18: 14,968,909 (GRCm39) T682I probably damaging Het
Tbx5 T A 5: 119,976,790 (GRCm39) H59Q probably benign Het
Tdrd1 A T 19: 56,843,760 (GRCm39) Y746F probably damaging Het
Tmem132e A G 11: 82,325,137 (GRCm39) S46G probably damaging Het
Tnfaip6 T A 2: 51,941,077 (GRCm39) V206E possibly damaging Het
Tpbpb T A 13: 61,049,193 (GRCm39) probably benign Het
Ttn T A 2: 76,768,025 (GRCm39) K3025* probably null Het
Tulp4 T A 17: 6,227,168 (GRCm39) I106N probably damaging Het
Ubp1 T A 9: 113,801,897 (GRCm39) F454Y probably benign Het
Ugt2b37 A T 5: 87,402,345 (GRCm39) N95K probably benign Het
Vps13d T A 4: 144,801,602 (GRCm39) R3539W Het
Vsnl1 T C 12: 11,382,180 (GRCm39) H67R probably damaging Het
Zbbx A G 3: 75,062,692 (GRCm39) Y22H probably benign Het
Zeb1 A G 18: 5,770,382 (GRCm39) probably null Het
Zfp142 A T 1: 74,610,825 (GRCm39) L990Q possibly damaging Het
Zmiz1 G A 14: 25,646,118 (GRCm39) G265D probably damaging Het
Other mutations in Acacb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Acacb APN 5 114,338,350 (GRCm39) missense probably damaging 1.00
IGL01291:Acacb APN 5 114,363,931 (GRCm39) missense probably benign 0.03
IGL01301:Acacb APN 5 114,384,559 (GRCm39) missense probably benign
IGL01633:Acacb APN 5 114,356,919 (GRCm39) splice site probably benign
IGL01736:Acacb APN 5 114,326,503 (GRCm39) missense possibly damaging 0.96
IGL01782:Acacb APN 5 114,338,581 (GRCm39) missense probably damaging 1.00
IGL01924:Acacb APN 5 114,362,047 (GRCm39) splice site probably benign
IGL01933:Acacb APN 5 114,322,251 (GRCm39) splice site probably benign
IGL02028:Acacb APN 5 114,304,076 (GRCm39) missense probably damaging 1.00
IGL02045:Acacb APN 5 114,378,721 (GRCm39) missense possibly damaging 0.95
IGL02346:Acacb APN 5 114,376,760 (GRCm39) missense probably damaging 1.00
IGL02421:Acacb APN 5 114,361,939 (GRCm39) missense probably benign 0.00
IGL02445:Acacb APN 5 114,383,198 (GRCm39) missense probably damaging 1.00
IGL02491:Acacb APN 5 114,330,166 (GRCm39) missense probably damaging 1.00
IGL02598:Acacb APN 5 114,384,098 (GRCm39) missense probably damaging 1.00
IGL02700:Acacb APN 5 114,356,942 (GRCm39) missense probably damaging 1.00
IGL02730:Acacb APN 5 114,304,210 (GRCm39) splice site probably benign
IGL03110:Acacb APN 5 114,333,295 (GRCm39) missense probably damaging 0.96
IGL03125:Acacb APN 5 114,342,866 (GRCm39) missense possibly damaging 0.49
IGL03263:Acacb APN 5 114,351,754 (GRCm39) missense probably damaging 1.00
IGL03324:Acacb APN 5 114,363,915 (GRCm39) nonsense probably null
acetone UTSW 5 114,364,918 (GRCm39) nonsense probably null
anabolism UTSW 5 114,383,281 (GRCm39) missense possibly damaging 0.63
ANU05:Acacb UTSW 5 114,363,931 (GRCm39) missense probably benign 0.03
ANU18:Acacb UTSW 5 114,384,559 (GRCm39) missense probably benign
BB001:Acacb UTSW 5 114,383,281 (GRCm39) missense possibly damaging 0.63
BB011:Acacb UTSW 5 114,383,281 (GRCm39) missense possibly damaging 0.63
I0000:Acacb UTSW 5 114,376,716 (GRCm39) missense probably damaging 0.99
R0001:Acacb UTSW 5 114,342,894 (GRCm39) splice site probably benign
R0219:Acacb UTSW 5 114,371,005 (GRCm39) missense possibly damaging 0.79
R0234:Acacb UTSW 5 114,347,878 (GRCm39) missense probably damaging 0.99
R0234:Acacb UTSW 5 114,347,878 (GRCm39) missense probably damaging 0.99
R0278:Acacb UTSW 5 114,371,320 (GRCm39) nonsense probably null
R0607:Acacb UTSW 5 114,338,362 (GRCm39) missense probably damaging 1.00
R0964:Acacb UTSW 5 114,367,813 (GRCm39) missense possibly damaging 0.64
R1116:Acacb UTSW 5 114,349,017 (GRCm39) missense probably damaging 1.00
R1196:Acacb UTSW 5 114,383,153 (GRCm39) missense probably benign 0.00
R1204:Acacb UTSW 5 114,328,214 (GRCm39) missense probably damaging 1.00
R1387:Acacb UTSW 5 114,338,573 (GRCm39) missense probably benign
R1415:Acacb UTSW 5 114,303,982 (GRCm39) missense probably benign
R1475:Acacb UTSW 5 114,333,313 (GRCm39) missense possibly damaging 0.87
R1497:Acacb UTSW 5 114,334,868 (GRCm39) missense probably damaging 1.00
R1520:Acacb UTSW 5 114,340,001 (GRCm39) missense possibly damaging 0.67
R1591:Acacb UTSW 5 114,341,484 (GRCm39) missense possibly damaging 0.87
R1644:Acacb UTSW 5 114,333,346 (GRCm39) missense probably damaging 1.00
R1732:Acacb UTSW 5 114,328,148 (GRCm39) missense possibly damaging 0.63
R1783:Acacb UTSW 5 114,347,828 (GRCm39) frame shift probably null
R1784:Acacb UTSW 5 114,347,828 (GRCm39) frame shift probably null
R1834:Acacb UTSW 5 114,373,536 (GRCm39) missense probably damaging 1.00
R1858:Acacb UTSW 5 114,334,770 (GRCm39) missense probably benign 0.13
R1886:Acacb UTSW 5 114,357,020 (GRCm39) missense probably damaging 1.00
R1901:Acacb UTSW 5 114,303,795 (GRCm39) nonsense probably null
R1902:Acacb UTSW 5 114,303,795 (GRCm39) nonsense probably null
R1903:Acacb UTSW 5 114,303,795 (GRCm39) nonsense probably null
R1924:Acacb UTSW 5 114,368,781 (GRCm39) missense possibly damaging 0.67
R1934:Acacb UTSW 5 114,336,343 (GRCm39) missense probably benign 0.27
R2051:Acacb UTSW 5 114,383,951 (GRCm39) missense probably damaging 1.00
R2132:Acacb UTSW 5 114,347,828 (GRCm39) frame shift probably null
R2133:Acacb UTSW 5 114,347,828 (GRCm39) frame shift probably null
R2260:Acacb UTSW 5 114,354,978 (GRCm39) missense probably damaging 0.99
R2967:Acacb UTSW 5 114,304,131 (GRCm39) missense possibly damaging 0.81
R3421:Acacb UTSW 5 114,350,697 (GRCm39) splice site probably null
R3729:Acacb UTSW 5 114,345,409 (GRCm39) missense probably damaging 0.99
R4206:Acacb UTSW 5 114,351,712 (GRCm39) missense probably benign
R4245:Acacb UTSW 5 114,368,845 (GRCm39) missense probably damaging 0.97
R4386:Acacb UTSW 5 114,379,982 (GRCm39) critical splice acceptor site probably null
R4439:Acacb UTSW 5 114,384,557 (GRCm39) missense possibly damaging 0.50
R4577:Acacb UTSW 5 114,364,892 (GRCm39) missense probably damaging 1.00
R4658:Acacb UTSW 5 114,338,625 (GRCm39) missense probably damaging 0.96
R4688:Acacb UTSW 5 114,342,824 (GRCm39) missense probably benign 0.01
R4720:Acacb UTSW 5 114,367,975 (GRCm39) missense possibly damaging 0.73
R4898:Acacb UTSW 5 114,370,999 (GRCm39) missense probably benign 0.04
R5044:Acacb UTSW 5 114,304,088 (GRCm39) missense probably benign 0.03
R5070:Acacb UTSW 5 114,384,089 (GRCm39) missense possibly damaging 0.46
R5294:Acacb UTSW 5 114,380,013 (GRCm39) missense probably damaging 1.00
R5350:Acacb UTSW 5 114,382,612 (GRCm39) missense probably damaging 1.00
R5401:Acacb UTSW 5 114,347,914 (GRCm39) missense possibly damaging 0.80
R5531:Acacb UTSW 5 114,342,767 (GRCm39) missense possibly damaging 0.92
R5542:Acacb UTSW 5 114,333,798 (GRCm39) missense probably damaging 1.00
R5751:Acacb UTSW 5 114,368,893 (GRCm39) missense possibly damaging 0.79
R5821:Acacb UTSW 5 114,322,167 (GRCm39) missense possibly damaging 0.69
R5893:Acacb UTSW 5 114,367,912 (GRCm39) missense probably benign 0.01
R5911:Acacb UTSW 5 114,370,951 (GRCm39) missense probably damaging 0.97
R5944:Acacb UTSW 5 114,384,041 (GRCm39) missense probably damaging 1.00
R5973:Acacb UTSW 5 114,364,928 (GRCm39) missense probably damaging 1.00
R6027:Acacb UTSW 5 114,303,661 (GRCm39) missense probably benign 0.43
R6103:Acacb UTSW 5 114,383,942 (GRCm39) missense probably damaging 1.00
R6139:Acacb UTSW 5 114,350,713 (GRCm39) missense probably damaging 1.00
R6292:Acacb UTSW 5 114,338,312 (GRCm39) missense probably damaging 1.00
R6368:Acacb UTSW 5 114,354,884 (GRCm39) missense probably damaging 0.98
R6429:Acacb UTSW 5 114,366,652 (GRCm39) missense probably damaging 1.00
R6942:Acacb UTSW 5 114,330,024 (GRCm39) critical splice donor site probably null
R7138:Acacb UTSW 5 114,345,387 (GRCm39) missense probably benign 0.12
R7241:Acacb UTSW 5 114,383,161 (GRCm39) missense possibly damaging 0.94
R7254:Acacb UTSW 5 114,347,812 (GRCm39) critical splice acceptor site probably null
R7396:Acacb UTSW 5 114,351,722 (GRCm39) missense possibly damaging 0.87
R7439:Acacb UTSW 5 114,333,703 (GRCm39) missense possibly damaging 0.84
R7484:Acacb UTSW 5 114,356,923 (GRCm39) missense probably damaging 1.00
R7585:Acacb UTSW 5 114,384,073 (GRCm39) missense probably damaging 0.99
R7712:Acacb UTSW 5 114,303,799 (GRCm39) missense probably benign 0.13
R7868:Acacb UTSW 5 114,386,288 (GRCm39) missense probably benign 0.22
R7873:Acacb UTSW 5 114,361,339 (GRCm39) missense possibly damaging 0.88
R7924:Acacb UTSW 5 114,383,281 (GRCm39) missense possibly damaging 0.63
R7940:Acacb UTSW 5 114,304,108 (GRCm39) missense possibly damaging 0.77
R7951:Acacb UTSW 5 114,326,401 (GRCm39) missense probably damaging 1.00
R7960:Acacb UTSW 5 114,368,922 (GRCm39) missense probably benign 0.00
R7972:Acacb UTSW 5 114,364,918 (GRCm39) nonsense probably null
R8007:Acacb UTSW 5 114,356,935 (GRCm39) missense probably damaging 0.97
R8022:Acacb UTSW 5 114,361,915 (GRCm39) missense probably benign
R8030:Acacb UTSW 5 114,371,228 (GRCm39) missense probably damaging 1.00
R8241:Acacb UTSW 5 114,333,297 (GRCm39) missense possibly damaging 0.49
R8264:Acacb UTSW 5 114,345,427 (GRCm39) missense probably benign 0.00
R8292:Acacb UTSW 5 114,338,555 (GRCm39) critical splice acceptor site probably null
R8678:Acacb UTSW 5 114,340,032 (GRCm39) nonsense probably null
R8693:Acacb UTSW 5 114,364,844 (GRCm39) missense probably damaging 0.99
R8697:Acacb UTSW 5 114,351,441 (GRCm39) missense probably damaging 0.96
R8918:Acacb UTSW 5 114,333,315 (GRCm39) missense probably damaging 1.00
R9008:Acacb UTSW 5 114,386,815 (GRCm39) splice site silent
R9044:Acacb UTSW 5 114,373,578 (GRCm39) missense probably benign 0.00
R9165:Acacb UTSW 5 114,354,744 (GRCm39) missense probably benign 0.01
R9231:Acacb UTSW 5 114,349,153 (GRCm39) missense probably benign 0.01
R9440:Acacb UTSW 5 114,384,085 (GRCm39) missense possibly damaging 0.56
R9444:Acacb UTSW 5 114,384,020 (GRCm39) missense probably damaging 0.99
R9562:Acacb UTSW 5 114,371,397 (GRCm39) missense probably damaging 0.99
R9794:Acacb UTSW 5 114,387,578 (GRCm39) missense probably benign 0.00
V1662:Acacb UTSW 5 114,376,769 (GRCm39) missense probably damaging 1.00
Z1176:Acacb UTSW 5 114,387,009 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ATGATACTCTCTGGCCACTGG -3'
(R):5'- GGGCTAATTCACCCATGCTG -3'

Sequencing Primer
(F):5'- GGCTTTGCCCGTACAGCTC -3'
(R):5'- AATTCACCCATGCTGTGTGTG -3'
Posted On 2021-03-08