Mutagenetix > Incidental Mutation

Incidental Mutation 'R8772:Acacb'

664453

Institutional Source

Beutler Lab

Gene Symbol

Acacb

Ensembl Gene

ENSMUSG00000042010

Gene Name

acetyl-Coenzyme A carboxylase beta

Synonyms

Acc2, Accb

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8772 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

114146535-114250761 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 114184118 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 231 (D231V)

Ref Sequence

ENSEMBL: ENSMUSP00000031583 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031583] [ENSMUST00000102582] [ENSMUST00000146841]

AlphaFold

E9Q4Z2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000031583
AA Change: D231V

PolyPhen 2 Score 0.733 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000031583
Gene: ENSMUSG00000042010
AA Change: D231V

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
low complexity region	38	60	N/A	INTRINSIC
Pfam:CPSase_L_chain	249	369	2.1e-32	PFAM
Pfam:CPSase_L_D2	405	606	3.3e-52	PFAM
Pfam:ATP-grasp_4	413	576	2.1e-9	PFAM
Biotin_carb_C	640	747	9.54e-26	SMART
Pfam:Biotin_lipoyl	885	951	1.9e-17	PFAM
Pfam:ACC_central	952	1678	2.2e-290	PFAM
Pfam:Carboxyl_trans	1770	2324	2.3e-181	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102582
AA Change: D231V

PolyPhen 2 Score 0.733 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000099642
Gene: ENSMUSG00000042010
AA Change: D231V

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
low complexity region	38	60	N/A	INTRINSIC
Pfam:CPSase_L_chain	249	369	8.2e-29	PFAM
Pfam:CPSase_L_D2	405	606	3.8e-52	PFAM
Pfam:ATP-grasp_4	409	576	1.4e-12	PFAM
Biotin_carb_C	640	747	9.54e-26	SMART
Pfam:Biotin_lipoyl	885	951	9.1e-17	PFAM
Pfam:ACC_central	952	1678	2.3e-250	PFAM
Pfam:Carboxyl_trans	1770	2324	4.8e-172	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000146841
AA Change: D39V

PolyPhen 2 Score 0.745 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000115432
Gene: ENSMUSG00000042010
AA Change: D39V

Domain	Start	End	E-Value	Type
Pfam:CPSase_L_chain	57	146	6.4e-19	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.8%

Validation Efficiency

100% (83/83)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. ACC-beta is thought to control fatty acid oxidation by means of the ability of malonyl-CoA to inhibit carnitine-palmitoyl-CoA transferase I, the rate-limiting step in fatty acid uptake and oxidation by mitochondria. ACC-beta may be involved in the regulation of fatty acid oxidation, rather than fatty acid biosynthesis. There is evidence for the presence of two ACC-beta isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile and overtly normal but exhibit high levels of fatty acid oxidation, as well as reduced fat accumulation in their adipose tissue and liver, and decreased storage of glycogen in their liver. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aars2	T	C	17: 45,516,977	V574A	probably benign	Het
AC157566.4	T	C	15: 76,534,249	Y20C	probably benign	Het
Acp7	C	T	7: 28,616,484	V226M	probably damaging	Het
Actr1a	A	G	19: 46,382,292		probably null	Het
Adamts16	T	C	13: 70,836,334	Y70C	probably damaging	Het
Adcy5	G	A	16: 35,299,588	A1156T	probably damaging	Het
Ago1	A	T	4: 126,460,523		probably benign	Het
Akap9	G	A	5: 4,046,255	E2377K	probably damaging	Het
Asic2	A	G	11: 81,967,887	S100P	probably benign	Het
Atp1a1	A	C	3: 101,579,808	V895G	probably benign	Het
B3gnt7	A	G	1: 86,305,572	E180G	possibly damaging	Het
Cacna1c	A	T	6: 118,602,322	F1805I		Het
Cacna1g	A	G	11: 94,465,887	I141T	probably benign	Het
Ccdc162	A	G	10: 41,630,037	L919P	probably damaging	Het
Cd47	A	G	16: 49,884,212	I116V		Het
Cdca2	A	T	14: 67,698,080	D395E	probably damaging	Het
Celsr2	A	T	3: 108,397,073	I2285N	possibly damaging	Het
Chil5	T	C	3: 106,018,220	D157G	probably damaging	Het
Ciita	A	T	16: 10,480,162	I7F	probably damaging	Het
Dok7	G	T	5: 35,077,249	G215C	probably damaging	Het
Eif2s2	T	C	2: 154,887,739	I88V	probably null	Het
Fasn	A	T	11: 120,820,536	D217E	probably benign	Het
Fgd5	T	A	6: 92,050,419	I1030N	probably damaging	Het
Fpr-rs6	T	A	17: 20,182,233	N289Y	probably damaging	Het
Gm10392	C	T	11: 77,518,454	V49I	possibly damaging	Het
Gtf3c2	A	T	5: 31,174,414	M20K	probably benign	Het
Hoga1	A	G	19: 42,045,945	M10V	probably benign	Het
Homer1	T	A	13: 93,391,731	V258E	probably damaging	Het
Ifitm2	A	G	7: 140,955,890	L9S	probably benign	Het
Iqgap3	G	A	3: 88,089,837	A176T	probably benign	Het
Itga8	C	G	2: 12,182,684	G728A	probably damaging	Het
Lyst	C	T	13: 13,637,492	Q830*	probably null	Het
Macc1	T	C	12: 119,447,485	W663R	probably damaging	Het
Mipol1	A	T	12: 57,325,632	H159L	probably benign	Het
Mocs1	T	A	17: 49,450,374		probably null	Het
Ncoa1	T	C	12: 4,322,940	T154A	possibly damaging	Het
Noxred1	A	C	12: 87,227,093	L58R	probably benign	Het
Olfr205	A	G	16: 59,328,688	S274P	probably damaging	Het
Olfr78	G	A	7: 102,743,003		probably benign	Het
Olfr895	G	A	9: 38,268,935	V133I	probably benign	Het
Opcml	T	C	9: 27,791,411	V9A	probably benign	Het
Otog	A	T	7: 46,284,928	R1303S	probably damaging	Het
Parp11	T	A	6: 127,470,763	M20K	possibly damaging	Het
Parp11	T	A	6: 127,491,704	I322N	probably damaging	Het
Pde1b	T	C	15: 103,525,121		probably benign	Het
Pglyrp4	A	T	3: 90,740,400	T356S	possibly damaging	Het
Pitrm1	A	G	13: 6,578,560	D963G	probably damaging	Het
Plod3	T	C	5: 136,988,919	V183A	probably damaging	Het
Plxnb2	C	T	15: 89,162,746	V791M	probably damaging	Het
Poc1b	T	A	10: 99,156,357		probably benign	Het
Ppp1r7	A	G	1: 93,354,428	T234A	probably benign	Het
Pxdn	C	T	12: 30,015,464	T1441I	probably damaging	Het
Rap1gap2	T	C	11: 74,405,725	K479E	probably damaging	Het
Rars2	A	G	4: 34,623,488	D63G	probably benign	Het
Rptor	A	C	11: 119,725,032	D124A	probably damaging	Het
Rsf1	CG	CGACGGCGGTG	7: 97,579,908		probably benign	Het
Ryr1	C	A	7: 29,116,132	R118L	probably benign	Het
Sap130	G	C	18: 31,680,464	D525H	probably damaging	Het
Slc22a26	T	C	19: 7,790,112	N310D	probably benign	Het
Slc46a1	T	G	11: 78,465,951	N58K	probably benign	Het
Slc4a10	T	A	2: 62,303,940	I1000N	probably damaging	Het
Son	C	T	16: 91,657,938	T1191I	possibly damaging	Het
Sppl2a	T	C	2: 126,926,311	K146E	probably benign	Het
Srgap3	T	A	6: 112,766,945	K444I	probably damaging	Het
Sun1	T	C	5: 139,223,692	V59A	probably benign	Het
Sva	T	A	6: 42,038,509	Y37N	probably benign	Het
Taar8c	T	A	10: 24,101,807	M36L	probably benign	Het
Taf4b	C	T	18: 14,835,852	T682I	probably damaging	Het
Tbx5	T	A	5: 119,838,725	H59Q	probably benign	Het
Tdrd1	A	T	19: 56,855,328	Y746F	probably damaging	Het
Tmem132e	A	G	11: 82,434,311	S46G	probably damaging	Het
Tnfaip6	T	A	2: 52,051,065	V206E	possibly damaging	Het
Tpbpb	T	A	13: 60,901,379		probably benign	Het
Ttn	T	A	2: 76,937,681	K3025*	probably null	Het
Tulp4	T	A	17: 6,176,893	I106N	probably damaging	Het
Ubp1	T	A	9: 113,972,829	F454Y	probably benign	Het
Ugt2b37	A	T	5: 87,254,486	N95K	probably benign	Het
Vps13d	T	A	4: 145,075,032	R3539W		Het
Vsnl1	T	C	12: 11,332,179	H67R	probably damaging	Het
Zbbx	A	G	3: 75,155,385	Y22H	probably benign	Het
Zeb1	A	G	18: 5,770,382		probably null	Het
Zfp142	A	T	1: 74,571,666	L990Q	possibly damaging	Het
Zmiz1	G	A	14: 25,645,694	G265D	probably damaging	Het

Other mutations in Acacb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00482:Acacb	APN	5	114200289	missense	probably damaging	1.00
IGL01291:Acacb	APN	5	114225870	missense	probably benign	0.03
IGL01301:Acacb	APN	5	114246498	missense	probably benign
IGL01633:Acacb	APN	5	114218858	splice site	probably benign
IGL01736:Acacb	APN	5	114188442	missense	possibly damaging	0.96
IGL01782:Acacb	APN	5	114200520	missense	probably damaging	1.00
IGL01924:Acacb	APN	5	114223986	splice site	probably benign
IGL01933:Acacb	APN	5	114184190	splice site	probably benign
IGL02028:Acacb	APN	5	114166015	missense	probably damaging	1.00
IGL02045:Acacb	APN	5	114240660	missense	possibly damaging	0.95
IGL02346:Acacb	APN	5	114238699	missense	probably damaging	1.00
IGL02421:Acacb	APN	5	114223878	missense	probably benign	0.00
IGL02445:Acacb	APN	5	114245137	missense	probably damaging	1.00
IGL02491:Acacb	APN	5	114192105	missense	probably damaging	1.00
IGL02598:Acacb	APN	5	114246037	missense	probably damaging	1.00
IGL02700:Acacb	APN	5	114218881	missense	probably damaging	1.00
IGL02730:Acacb	APN	5	114166149	splice site	probably benign
IGL03110:Acacb	APN	5	114195234	missense	probably damaging	0.96
IGL03125:Acacb	APN	5	114204805	missense	possibly damaging	0.49
IGL03263:Acacb	APN	5	114213693	missense	probably damaging	1.00
IGL03324:Acacb	APN	5	114225854	nonsense	probably null
acetone	UTSW	5	114226857	nonsense	probably null
anabolism	UTSW	5	114245220	missense	possibly damaging	0.63
ANU05:Acacb	UTSW	5	114225870	missense	probably benign	0.03
ANU18:Acacb	UTSW	5	114246498	missense	probably benign
BB001:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
BB011:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
I0000:Acacb	UTSW	5	114238655	missense	probably damaging	0.99
R0001:Acacb	UTSW	5	114204833	splice site	probably benign
R0219:Acacb	UTSW	5	114232944	missense	possibly damaging	0.79
R0234:Acacb	UTSW	5	114209817	missense	probably damaging	0.99
R0234:Acacb	UTSW	5	114209817	missense	probably damaging	0.99
R0278:Acacb	UTSW	5	114233259	nonsense	probably null
R0607:Acacb	UTSW	5	114200301	missense	probably damaging	1.00
R0964:Acacb	UTSW	5	114229752	missense	possibly damaging	0.64
R1116:Acacb	UTSW	5	114210956	missense	probably damaging	1.00
R1196:Acacb	UTSW	5	114245092	missense	probably benign	0.00
R1204:Acacb	UTSW	5	114190153	missense	probably damaging	1.00
R1387:Acacb	UTSW	5	114200512	missense	probably benign
R1415:Acacb	UTSW	5	114165921	missense	probably benign
R1475:Acacb	UTSW	5	114195252	missense	possibly damaging	0.87
R1497:Acacb	UTSW	5	114196807	missense	probably damaging	1.00
R1520:Acacb	UTSW	5	114201940	missense	possibly damaging	0.67
R1591:Acacb	UTSW	5	114203423	missense	possibly damaging	0.87
R1644:Acacb	UTSW	5	114195285	missense	probably damaging	1.00
R1732:Acacb	UTSW	5	114190087	missense	possibly damaging	0.63
R1783:Acacb	UTSW	5	114209767	frame shift	probably null
R1784:Acacb	UTSW	5	114209767	frame shift	probably null
R1834:Acacb	UTSW	5	114235475	missense	probably damaging	1.00
R1858:Acacb	UTSW	5	114196709	missense	probably benign	0.13
R1886:Acacb	UTSW	5	114218959	missense	probably damaging	1.00
R1901:Acacb	UTSW	5	114165734	nonsense	probably null
R1902:Acacb	UTSW	5	114165734	nonsense	probably null
R1903:Acacb	UTSW	5	114165734	nonsense	probably null
R1924:Acacb	UTSW	5	114230720	missense	possibly damaging	0.67
R1934:Acacb	UTSW	5	114198282	missense	probably benign	0.27
R2051:Acacb	UTSW	5	114245890	missense	probably damaging	1.00
R2132:Acacb	UTSW	5	114209767	frame shift	probably null
R2133:Acacb	UTSW	5	114209767	frame shift	probably null
R2260:Acacb	UTSW	5	114216917	missense	probably damaging	0.99
R2967:Acacb	UTSW	5	114166070	missense	possibly damaging	0.81
R3421:Acacb	UTSW	5	114212636	splice site	probably null
R3729:Acacb	UTSW	5	114207348	missense	probably damaging	0.99
R4206:Acacb	UTSW	5	114213651	missense	probably benign
R4245:Acacb	UTSW	5	114230784	missense	probably damaging	0.97
R4386:Acacb	UTSW	5	114241921	critical splice acceptor site	probably null
R4439:Acacb	UTSW	5	114246496	missense	possibly damaging	0.50
R4577:Acacb	UTSW	5	114226831	missense	probably damaging	1.00
R4658:Acacb	UTSW	5	114200564	missense	probably damaging	0.96
R4688:Acacb	UTSW	5	114204763	missense	probably benign	0.01
R4720:Acacb	UTSW	5	114229914	missense	possibly damaging	0.73
R4898:Acacb	UTSW	5	114232938	missense	probably benign	0.04
R5044:Acacb	UTSW	5	114166027	missense	probably benign	0.03
R5070:Acacb	UTSW	5	114246028	missense	possibly damaging	0.46
R5294:Acacb	UTSW	5	114241952	missense	probably damaging	1.00
R5350:Acacb	UTSW	5	114244551	missense	probably damaging	1.00
R5401:Acacb	UTSW	5	114209853	missense	possibly damaging	0.80
R5531:Acacb	UTSW	5	114204706	missense	possibly damaging	0.92
R5542:Acacb	UTSW	5	114195737	missense	probably damaging	1.00
R5751:Acacb	UTSW	5	114230832	missense	possibly damaging	0.79
R5821:Acacb	UTSW	5	114184106	missense	possibly damaging	0.69
R5893:Acacb	UTSW	5	114229851	missense	probably benign	0.01
R5911:Acacb	UTSW	5	114232890	missense	probably damaging	0.97
R5944:Acacb	UTSW	5	114245980	missense	probably damaging	1.00
R5973:Acacb	UTSW	5	114226867	missense	probably damaging	1.00
R6027:Acacb	UTSW	5	114165600	missense	probably benign	0.43
R6103:Acacb	UTSW	5	114245881	missense	probably damaging	1.00
R6139:Acacb	UTSW	5	114212652	missense	probably damaging	1.00
R6292:Acacb	UTSW	5	114200251	missense	probably damaging	1.00
R6368:Acacb	UTSW	5	114216823	missense	probably damaging	0.98
R6429:Acacb	UTSW	5	114228591	missense	probably damaging	1.00
R6942:Acacb	UTSW	5	114191963	critical splice donor site	probably null
R7138:Acacb	UTSW	5	114207326	missense	probably benign	0.12
R7241:Acacb	UTSW	5	114245100	missense	possibly damaging	0.94
R7254:Acacb	UTSW	5	114209751	critical splice acceptor site	probably null
R7396:Acacb	UTSW	5	114213661	missense	possibly damaging	0.87
R7439:Acacb	UTSW	5	114195642	missense	possibly damaging	0.84
R7484:Acacb	UTSW	5	114218862	missense	probably damaging	1.00
R7585:Acacb	UTSW	5	114246012	missense	probably damaging	0.99
R7712:Acacb	UTSW	5	114165738	missense	probably benign	0.13
R7868:Acacb	UTSW	5	114248227	missense	probably benign	0.22
R7873:Acacb	UTSW	5	114223278	missense	possibly damaging	0.88
R7924:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
R7940:Acacb	UTSW	5	114166047	missense	possibly damaging	0.77
R7951:Acacb	UTSW	5	114188340	missense	probably damaging	1.00
R7960:Acacb	UTSW	5	114230861	missense	probably benign	0.00
R7972:Acacb	UTSW	5	114226857	nonsense	probably null
R8007:Acacb	UTSW	5	114218874	missense	probably damaging	0.97
R8022:Acacb	UTSW	5	114223854	missense	probably benign
R8030:Acacb	UTSW	5	114233167	missense	probably damaging	1.00
R8241:Acacb	UTSW	5	114195236	missense	possibly damaging	0.49
R8264:Acacb	UTSW	5	114207366	missense	probably benign	0.00
R8292:Acacb	UTSW	5	114200494	critical splice acceptor site	probably null
R8678:Acacb	UTSW	5	114201971	nonsense	probably null
R8693:Acacb	UTSW	5	114226783	missense	probably damaging	0.99
R8697:Acacb	UTSW	5	114213380	missense	probably damaging	0.96
R8918:Acacb	UTSW	5	114195254	missense	probably damaging	1.00
R9008:Acacb	UTSW	5	114248754	splice site	silent
R9044:Acacb	UTSW	5	114235517	missense	probably benign	0.00
R9165:Acacb	UTSW	5	114216683	missense	probably benign	0.01
R9231:Acacb	UTSW	5	114211092	missense	probably benign	0.01
R9440:Acacb	UTSW	5	114246024	missense	possibly damaging	0.56
R9444:Acacb	UTSW	5	114245959	missense	probably damaging	0.99
R9562:Acacb	UTSW	5	114233336	missense	probably damaging	0.99
R9794:Acacb	UTSW	5	114249517	missense	probably benign	0.00
V1662:Acacb	UTSW	5	114238708	missense	probably damaging	1.00
Z1176:Acacb	UTSW	5	114248948	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- ATGATACTCTCTGGCCACTGG -3'
(R):5'- GGGCTAATTCACCCATGCTG -3'

Sequencing Primer
(F):5'- GGCTTTGCCCGTACAGCTC -3'
(R):5'- AATTCACCCATGCTGTGTGTG -3'

Posted On

2021-03-08