Incidental Mutation 'R8772:Tmem132e'
ID664478
Institutional Source Beutler Lab
Gene Symbol Tmem132e
Ensembl Gene ENSMUSG00000020701
Gene Nametransmembrane protein 132E
SynonymsLOC270893
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.406) question?
Stock #R8772 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location82388900-82446332 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 82434311 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 46 (S46G)
Ref Sequence ENSEMBL: ENSMUSP00000052484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054245] [ENSMUST00000092852]
Predicted Effect probably damaging
Transcript: ENSMUST00000054245
AA Change: S46G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000052484
Gene: ENSMUSG00000020701
AA Change: S46G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:TMEM132D_N 45 176 1.1e-52 PFAM
low complexity region 202 216 N/A INTRINSIC
low complexity region 241 262 N/A INTRINSIC
low complexity region 318 328 N/A INTRINSIC
Pfam:TMEM132 451 797 1.7e-136 PFAM
low complexity region 827 837 N/A INTRINSIC
low complexity region 841 854 N/A INTRINSIC
Pfam:TMEM132D_C 867 944 2e-34 PFAM
low complexity region 967 998 N/A INTRINSIC
low complexity region 1016 1027 N/A INTRINSIC
low complexity region 1036 1043 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000092852
AA Change: S46G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000090528
Gene: ENSMUSG00000020701
AA Change: S46G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 226 236 N/A INTRINSIC
low complexity region 471 489 N/A INTRINSIC
low complexity region 735 745 N/A INTRINSIC
low complexity region 749 762 N/A INTRINSIC
transmembrane domain 798 820 N/A INTRINSIC
low complexity region 875 906 N/A INTRINSIC
low complexity region 924 935 N/A INTRINSIC
low complexity region 944 951 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 T C 17: 45,516,977 V574A probably benign Het
AC157566.4 T C 15: 76,534,249 Y20C probably benign Het
Acacb A T 5: 114,184,118 D231V possibly damaging Het
Acp7 C T 7: 28,616,484 V226M probably damaging Het
Actr1a A G 19: 46,382,292 probably null Het
Adamts16 T C 13: 70,836,334 Y70C probably damaging Het
Adcy5 G A 16: 35,299,588 A1156T probably damaging Het
Akap9 G A 5: 4,046,255 E2377K probably damaging Het
Asic2 A G 11: 81,967,887 S100P probably benign Het
Atp1a1 A C 3: 101,579,808 V895G probably benign Het
B3gnt7 A G 1: 86,305,572 E180G possibly damaging Het
Cacna1c A T 6: 118,602,322 F1805I Het
Cacna1g A G 11: 94,465,887 I141T probably benign Het
Ccdc162 A G 10: 41,630,037 L919P probably damaging Het
Cd47 A G 16: 49,884,212 I116V Het
Cdca2 A T 14: 67,698,080 D395E probably damaging Het
Celsr2 A T 3: 108,397,073 I2285N possibly damaging Het
Chil5 T C 3: 106,018,220 D157G probably damaging Het
Ciita A T 16: 10,480,162 I7F probably damaging Het
Dok7 G T 5: 35,077,249 G215C probably damaging Het
Eif2s2 T C 2: 154,887,739 I88V probably null Het
Fasn A T 11: 120,820,536 D217E probably benign Het
Fgd5 T A 6: 92,050,419 I1030N probably damaging Het
Fpr-rs6 T A 17: 20,182,233 N289Y probably damaging Het
Gm10392 C T 11: 77,518,454 V49I possibly damaging Het
Gtf3c2 A T 5: 31,174,414 M20K probably benign Het
Hoga1 A G 19: 42,045,945 M10V probably benign Het
Homer1 T A 13: 93,391,731 V258E probably damaging Het
Ifitm2 A G 7: 140,955,890 L9S probably benign Het
Iqgap3 G A 3: 88,089,837 A176T probably benign Het
Itga8 C G 2: 12,182,684 G728A probably damaging Het
Lyst C T 13: 13,637,492 Q830* probably null Het
Macc1 T C 12: 119,447,485 W663R probably damaging Het
Mipol1 A T 12: 57,325,632 H159L probably benign Het
Mocs1 T A 17: 49,450,374 probably null Het
Ncoa1 T C 12: 4,322,940 T154A possibly damaging Het
Noxred1 A C 12: 87,227,093 L58R probably benign Het
Olfr205 A G 16: 59,328,688 S274P probably damaging Het
Olfr78 G A 7: 102,743,003 probably benign Het
Olfr895 G A 9: 38,268,935 V133I probably benign Het
Opcml T C 9: 27,791,411 V9A probably benign Het
Otog A T 7: 46,284,928 R1303S probably damaging Het
Parp11 T A 6: 127,470,763 M20K possibly damaging Het
Parp11 T A 6: 127,491,704 I322N probably damaging Het
Pglyrp4 A T 3: 90,740,400 T356S possibly damaging Het
Pitrm1 A G 13: 6,578,560 D963G probably damaging Het
Plod3 T C 5: 136,988,919 V183A probably damaging Het
Plxnb2 C T 15: 89,162,746 V791M probably damaging Het
Ppp1r7 A G 1: 93,354,428 T234A probably benign Het
Pxdn C T 12: 30,015,464 T1441I probably damaging Het
Rap1gap2 T C 11: 74,405,725 K479E probably damaging Het
Rars2 A G 4: 34,623,488 D63G probably benign Het
Rptor A C 11: 119,725,032 D124A probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Ryr1 C A 7: 29,116,132 R118L probably benign Het
Sap130 G C 18: 31,680,464 D525H probably damaging Het
Slc22a26 T C 19: 7,790,112 N310D probably benign Het
Slc46a1 T G 11: 78,465,951 N58K probably benign Het
Slc4a10 T A 2: 62,303,940 I1000N probably damaging Het
Son C T 16: 91,657,938 T1191I possibly damaging Het
Sppl2a T C 2: 126,926,311 K146E probably benign Het
Srgap3 T A 6: 112,766,945 K444I probably damaging Het
Sun1 T C 5: 139,223,692 V59A probably benign Het
Sva T A 6: 42,038,509 Y37N probably benign Het
Taar8c T A 10: 24,101,807 M36L probably benign Het
Taf4b C T 18: 14,835,852 T682I probably damaging Het
Tbx5 T A 5: 119,838,725 H59Q probably benign Het
Tdrd1 A T 19: 56,855,328 Y746F probably damaging Het
Tnfaip6 T A 2: 52,051,065 V206E possibly damaging Het
Ttn T A 2: 76,937,681 K3025* probably null Het
Tulp4 T A 17: 6,176,893 I106N probably damaging Het
Ubp1 T A 9: 113,972,829 F454Y probably benign Het
Ugt2b37 A T 5: 87,254,486 N95K probably benign Het
Vps13d T A 4: 145,075,032 R3539W Het
Vsnl1 T C 12: 11,332,179 H67R probably damaging Het
Zbbx A G 3: 75,155,385 Y22H probably benign Het
Zeb1 A G 18: 5,770,382 probably null Het
Zfp142 A T 1: 74,571,666 L990Q possibly damaging Het
Zmiz1 G A 14: 25,645,694 G265D probably damaging Het
Other mutations in Tmem132e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01576:Tmem132e APN 11 82438374 missense probably damaging 1.00
IGL01586:Tmem132e APN 11 82434669 missense probably damaging 1.00
IGL01729:Tmem132e APN 11 82435116 missense possibly damaging 0.89
IGL02592:Tmem132e APN 11 82434636 missense probably damaging 1.00
R0029:Tmem132e UTSW 11 82444761 missense probably damaging 1.00
R0501:Tmem132e UTSW 11 82435068 missense possibly damaging 0.90
R0612:Tmem132e UTSW 11 82443372 missense probably damaging 1.00
R0613:Tmem132e UTSW 11 82438338 missense probably damaging 1.00
R1311:Tmem132e UTSW 11 82444296 missense probably damaging 1.00
R1430:Tmem132e UTSW 11 82438296 missense probably damaging 1.00
R1607:Tmem132e UTSW 11 82437370 missense probably benign 0.39
R1710:Tmem132e UTSW 11 82443517 missense probably damaging 1.00
R1913:Tmem132e UTSW 11 82443417 missense probably damaging 1.00
R1951:Tmem132e UTSW 11 82445082 missense possibly damaging 0.84
R2018:Tmem132e UTSW 11 82445163 missense probably benign 0.26
R2051:Tmem132e UTSW 11 82440438 missense probably damaging 1.00
R2076:Tmem132e UTSW 11 82435068 missense possibly damaging 0.90
R2100:Tmem132e UTSW 11 82444531 missense probably damaging 1.00
R2325:Tmem132e UTSW 11 82434515 missense probably damaging 1.00
R2924:Tmem132e UTSW 11 82444323 missense probably damaging 1.00
R3436:Tmem132e UTSW 11 82444330 missense probably damaging 1.00
R3437:Tmem132e UTSW 11 82444330 missense probably damaging 1.00
R4594:Tmem132e UTSW 11 82435068 missense possibly damaging 0.83
R4704:Tmem132e UTSW 11 82443531 missense probably damaging 0.97
R4754:Tmem132e UTSW 11 82444851 nonsense probably null
R4764:Tmem132e UTSW 11 82434512 missense probably damaging 0.99
R5245:Tmem132e UTSW 11 82442638 missense probably damaging 0.96
R5720:Tmem132e UTSW 11 82442450 splice site probably null
R5793:Tmem132e UTSW 11 82444858 missense probably damaging 1.00
R5984:Tmem132e UTSW 11 82445097 missense probably damaging 1.00
R6980:Tmem132e UTSW 11 82438386 critical splice donor site probably null
R7052:Tmem132e UTSW 11 82437363 missense probably damaging 0.99
R7637:Tmem132e UTSW 11 82434516 missense probably damaging 1.00
R7918:Tmem132e UTSW 11 82445290 missense probably damaging 1.00
R8262:Tmem132e UTSW 11 82434840 missense probably benign 0.33
Z1177:Tmem132e UTSW 11 82435178 missense probably damaging 1.00
Z1177:Tmem132e UTSW 11 82445104 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AACCTCACTGAAGGCTCTCTG -3'
(R):5'- CAGTTAACCGTCAAGCGCTC -3'

Sequencing Primer
(F):5'- TGAAGGCTCTCTGCAGGAG -3'
(R):5'- TGCAAAAGCTCCCGTGC -3'
Posted On2021-03-08