Incidental Mutation 'R8772:Pxdn'
ID 664484
Institutional Source Beutler Lab
Gene Symbol Pxdn
Ensembl Gene ENSMUSG00000020674
Gene Name peroxidasin
Synonyms 2310075M15Rik, VPO1
MMRRC Submission 068626-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.601) question?
Stock # R8772 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 29987607-30067657 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 30065463 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 1441 (T1441I)
Ref Sequence ENSEMBL: ENSMUSP00000113703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122328] [ENSMUST00000220271]
AlphaFold Q3UQ28
Predicted Effect probably damaging
Transcript: ENSMUST00000122328
AA Change: T1441I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113703
Gene: ENSMUSG00000020674
AA Change: T1441I

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LRRNT 32 63 2.52e-1 SMART
LRR 62 81 4.09e1 SMART
LRR_TYP 82 105 3.69e-4 SMART
LRR_TYP 106 129 1.45e-2 SMART
LRR_TYP 130 153 8.02e-5 SMART
LRR_TYP 154 177 1.06e-4 SMART
LRRCT 189 241 3.97e-5 SMART
IGc2 255 321 1.59e-15 SMART
IGc2 351 416 3.96e-16 SMART
IGc2 442 506 2.96e-15 SMART
IGc2 534 598 1.2e-15 SMART
Pfam:An_peroxidase 738 1286 1.1e-196 PFAM
VWC 1411 1466 8.8e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000220271
AA Change: T1261I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency 100% (83/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a heme-containing peroxidase that is secreted into the extracellular matrix. It is involved in extracellular matrix formation, and may function in the physiological and pathological fibrogenic response in fibrotic kidney. Mutations in this gene cause corneal opacification and other ocular anomalies, and also microphthalmia and anterior segment dysgenesis. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit abnormal eye development with early-onset glaucoma and progressive retinal dysgenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 T C 17: 45,827,903 (GRCm39) V574A probably benign Het
AC157566.4 T C 15: 76,418,449 (GRCm39) Y20C probably benign Het
Acacb A T 5: 114,322,179 (GRCm39) D231V possibly damaging Het
Acp7 C T 7: 28,315,909 (GRCm39) V226M probably damaging Het
Actr1a A G 19: 46,370,731 (GRCm39) probably null Het
Adamts16 T C 13: 70,984,453 (GRCm39) Y70C probably damaging Het
Adcy5 G A 16: 35,119,958 (GRCm39) A1156T probably damaging Het
Ago1 A T 4: 126,354,316 (GRCm39) probably benign Het
Akap9 G A 5: 4,096,255 (GRCm39) E2377K probably damaging Het
Asic2 A G 11: 81,858,713 (GRCm39) S100P probably benign Het
Atp1a1 A C 3: 101,487,124 (GRCm39) V895G probably benign Het
B3gnt7 A G 1: 86,233,294 (GRCm39) E180G possibly damaging Het
Cacna1c A T 6: 118,579,283 (GRCm39) F1805I Het
Cacna1g A G 11: 94,356,713 (GRCm39) I141T probably benign Het
Ccdc162 A G 10: 41,506,033 (GRCm39) L919P probably damaging Het
Cd47 A G 16: 49,704,575 (GRCm39) I116V Het
Cdca2 A T 14: 67,935,529 (GRCm39) D395E probably damaging Het
Celsr2 A T 3: 108,304,389 (GRCm39) I2285N possibly damaging Het
Chil5 T C 3: 105,925,536 (GRCm39) D157G probably damaging Het
Ciita A T 16: 10,298,026 (GRCm39) I7F probably damaging Het
Dok7 G T 5: 35,234,593 (GRCm39) G215C probably damaging Het
Eif2s2 T C 2: 154,729,659 (GRCm39) I88V probably null Het
Fasn A T 11: 120,711,362 (GRCm39) D217E probably benign Het
Fgd5 T A 6: 92,027,400 (GRCm39) I1030N probably damaging Het
Fpr-rs6 T A 17: 20,402,495 (GRCm39) N289Y probably damaging Het
Gm10392 C T 11: 77,409,280 (GRCm39) V49I possibly damaging Het
Gtf3c2 A T 5: 31,331,758 (GRCm39) M20K probably benign Het
Hoga1 A G 19: 42,034,384 (GRCm39) M10V probably benign Het
Homer1 T A 13: 93,528,239 (GRCm39) V258E probably damaging Het
Ifitm2 A G 7: 140,535,803 (GRCm39) L9S probably benign Het
Iqgap3 G A 3: 87,997,144 (GRCm39) A176T probably benign Het
Itga8 C G 2: 12,187,495 (GRCm39) G728A probably damaging Het
Lyst C T 13: 13,812,077 (GRCm39) Q830* probably null Het
Macc1 T C 12: 119,411,220 (GRCm39) W663R probably damaging Het
Mipol1 A T 12: 57,372,418 (GRCm39) H159L probably benign Het
Mocs1 T A 17: 49,757,402 (GRCm39) probably null Het
Ncoa1 T C 12: 4,372,940 (GRCm39) T154A possibly damaging Het
Noxred1 A C 12: 87,273,867 (GRCm39) L58R probably benign Het
Opcml T C 9: 27,702,707 (GRCm39) V9A probably benign Het
Or51e2 G A 7: 102,392,210 (GRCm39) probably benign Het
Or5ac23 A G 16: 59,149,051 (GRCm39) S274P probably damaging Het
Or8c17 G A 9: 38,180,231 (GRCm39) V133I probably benign Het
Otog A T 7: 45,934,352 (GRCm39) R1303S probably damaging Het
Parp11 T A 6: 127,468,667 (GRCm39) I322N probably damaging Het
Parp11 T A 6: 127,447,726 (GRCm39) M20K possibly damaging Het
Pde1b T C 15: 103,433,548 (GRCm39) probably benign Het
Pglyrp4 A T 3: 90,647,707 (GRCm39) T356S possibly damaging Het
Pitrm1 A G 13: 6,628,596 (GRCm39) D963G probably damaging Het
Plod3 T C 5: 137,017,773 (GRCm39) V183A probably damaging Het
Plxnb2 C T 15: 89,046,949 (GRCm39) V791M probably damaging Het
Poc1b T A 10: 98,992,219 (GRCm39) probably benign Het
Ppp1r7 A G 1: 93,282,150 (GRCm39) T234A probably benign Het
Rap1gap2 T C 11: 74,296,551 (GRCm39) K479E probably damaging Het
Rars2 A G 4: 34,623,488 (GRCm39) D63G probably benign Het
Rptor A C 11: 119,615,858 (GRCm39) D124A probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,229,115 (GRCm39) probably benign Het
Ryr1 C A 7: 28,815,557 (GRCm39) R118L probably benign Het
Sap130 G C 18: 31,813,517 (GRCm39) D525H probably damaging Het
Slc22a26 T C 19: 7,767,477 (GRCm39) N310D probably benign Het
Slc46a1 T G 11: 78,356,777 (GRCm39) N58K probably benign Het
Slc4a10 T A 2: 62,134,284 (GRCm39) I1000N probably damaging Het
Son C T 16: 91,454,826 (GRCm39) T1191I possibly damaging Het
Sppl2a T C 2: 126,768,231 (GRCm39) K146E probably benign Het
Srgap3 T A 6: 112,743,906 (GRCm39) K444I probably damaging Het
Sun1 T C 5: 139,209,447 (GRCm39) V59A probably benign Het
Sva T A 6: 42,015,443 (GRCm39) Y37N probably benign Het
Taar8c T A 10: 23,977,705 (GRCm39) M36L probably benign Het
Taf4b C T 18: 14,968,909 (GRCm39) T682I probably damaging Het
Tbx5 T A 5: 119,976,790 (GRCm39) H59Q probably benign Het
Tdrd1 A T 19: 56,843,760 (GRCm39) Y746F probably damaging Het
Tmem132e A G 11: 82,325,137 (GRCm39) S46G probably damaging Het
Tnfaip6 T A 2: 51,941,077 (GRCm39) V206E possibly damaging Het
Tpbpb T A 13: 61,049,193 (GRCm39) probably benign Het
Ttn T A 2: 76,768,025 (GRCm39) K3025* probably null Het
Tulp4 T A 17: 6,227,168 (GRCm39) I106N probably damaging Het
Ubp1 T A 9: 113,801,897 (GRCm39) F454Y probably benign Het
Ugt2b37 A T 5: 87,402,345 (GRCm39) N95K probably benign Het
Vps13d T A 4: 144,801,602 (GRCm39) R3539W Het
Vsnl1 T C 12: 11,382,180 (GRCm39) H67R probably damaging Het
Zbbx A G 3: 75,062,692 (GRCm39) Y22H probably benign Het
Zeb1 A G 18: 5,770,382 (GRCm39) probably null Het
Zfp142 A T 1: 74,610,825 (GRCm39) L990Q possibly damaging Het
Zmiz1 G A 14: 25,646,118 (GRCm39) G265D probably damaging Het
Other mutations in Pxdn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Pxdn APN 12 30,037,098 (GRCm39) missense probably damaging 1.00
IGL01152:Pxdn APN 12 30,051,936 (GRCm39) missense probably damaging 0.99
IGL01286:Pxdn APN 12 30,032,753 (GRCm39) missense probably benign 0.04
IGL01323:Pxdn APN 12 30,037,136 (GRCm39) missense probably benign 0.00
IGL01338:Pxdn APN 12 30,052,796 (GRCm39) missense probably damaging 1.00
IGL01341:Pxdn APN 12 30,052,486 (GRCm39) missense probably damaging 1.00
IGL01401:Pxdn APN 12 30,051,983 (GRCm39) missense probably damaging 1.00
IGL01580:Pxdn APN 12 30,034,492 (GRCm39) missense probably benign 0.18
IGL01650:Pxdn APN 12 30,052,400 (GRCm39) missense probably benign 0.01
IGL01679:Pxdn APN 12 30,049,901 (GRCm39) missense probably damaging 0.97
IGL01866:Pxdn APN 12 30,034,570 (GRCm39) missense probably benign 0.02
IGL02354:Pxdn APN 12 30,049,188 (GRCm39) missense probably damaging 1.00
IGL02361:Pxdn APN 12 30,049,188 (GRCm39) missense probably damaging 1.00
IGL02427:Pxdn APN 12 30,034,531 (GRCm39) missense probably damaging 1.00
IGL02955:Pxdn APN 12 30,053,156 (GRCm39) missense probably damaging 1.00
IGL03079:Pxdn APN 12 30,052,997 (GRCm39) missense probably damaging 0.97
IGL03111:Pxdn APN 12 30,032,755 (GRCm39) missense probably damaging 0.99
IGL02988:Pxdn UTSW 12 30,053,113 (GRCm39) nonsense probably null
PIT4280001:Pxdn UTSW 12 30,045,327 (GRCm39) missense probably damaging 0.99
PIT4469001:Pxdn UTSW 12 30,055,828 (GRCm39) missense probably benign 0.00
R0070:Pxdn UTSW 12 30,032,726 (GRCm39) missense probably damaging 0.99
R0070:Pxdn UTSW 12 30,032,726 (GRCm39) missense probably damaging 0.99
R0086:Pxdn UTSW 12 30,052,418 (GRCm39) missense possibly damaging 0.95
R0140:Pxdn UTSW 12 30,032,753 (GRCm39) missense probably benign 0.04
R0201:Pxdn UTSW 12 30,052,430 (GRCm39) missense possibly damaging 0.79
R0282:Pxdn UTSW 12 30,034,439 (GRCm39) nonsense probably null
R0310:Pxdn UTSW 12 30,065,528 (GRCm39) missense probably damaging 1.00
R0426:Pxdn UTSW 12 30,037,065 (GRCm39) missense possibly damaging 0.89
R0468:Pxdn UTSW 12 30,044,485 (GRCm39) missense probably damaging 0.99
R0825:Pxdn UTSW 12 30,034,995 (GRCm39) splice site probably benign
R0885:Pxdn UTSW 12 30,053,401 (GRCm39) missense probably benign 0.30
R1420:Pxdn UTSW 12 30,052,067 (GRCm39) missense probably damaging 1.00
R1588:Pxdn UTSW 12 30,052,558 (GRCm39) missense probably damaging 1.00
R2269:Pxdn UTSW 12 30,055,774 (GRCm39) missense probably damaging 0.97
R2280:Pxdn UTSW 12 30,034,905 (GRCm39) missense probably damaging 0.98
R2504:Pxdn UTSW 12 30,053,405 (GRCm39) missense probably damaging 1.00
R2679:Pxdn UTSW 12 30,025,568 (GRCm39) splice site probably benign
R3116:Pxdn UTSW 12 30,052,306 (GRCm39) missense possibly damaging 0.89
R3607:Pxdn UTSW 12 30,040,917 (GRCm39) missense probably benign 0.04
R4033:Pxdn UTSW 12 30,053,224 (GRCm39) missense probably benign 0.19
R4576:Pxdn UTSW 12 30,061,922 (GRCm39) missense probably benign
R4659:Pxdn UTSW 12 30,044,552 (GRCm39) missense probably benign 0.01
R4681:Pxdn UTSW 12 30,062,325 (GRCm39) missense probably benign 0.45
R4968:Pxdn UTSW 12 30,050,011 (GRCm39) missense probably benign 0.25
R5032:Pxdn UTSW 12 30,053,140 (GRCm39) missense probably benign 0.08
R5232:Pxdn UTSW 12 30,040,987 (GRCm39) missense probably benign 0.08
R5366:Pxdn UTSW 12 30,052,899 (GRCm39) missense probably damaging 1.00
R5504:Pxdn UTSW 12 30,052,800 (GRCm39) missense probably damaging 1.00
R5586:Pxdn UTSW 12 30,053,141 (GRCm39) missense probably damaging 0.99
R5739:Pxdn UTSW 12 30,032,333 (GRCm39) missense probably benign 0.03
R5877:Pxdn UTSW 12 30,053,045 (GRCm39) missense probably damaging 1.00
R6167:Pxdn UTSW 12 30,024,000 (GRCm39) missense probably damaging 1.00
R6191:Pxdn UTSW 12 30,032,716 (GRCm39) missense possibly damaging 0.94
R6200:Pxdn UTSW 12 30,053,111 (GRCm39) missense probably damaging 1.00
R6609:Pxdn UTSW 12 30,052,940 (GRCm39) missense probably benign 0.00
R6628:Pxdn UTSW 12 30,049,917 (GRCm39) missense probably damaging 1.00
R6865:Pxdn UTSW 12 30,064,582 (GRCm39) splice site probably null
R6921:Pxdn UTSW 12 30,065,504 (GRCm39) missense probably damaging 0.96
R6995:Pxdn UTSW 12 30,045,370 (GRCm39) missense possibly damaging 0.95
R7211:Pxdn UTSW 12 30,034,903 (GRCm39) missense possibly damaging 0.77
R7220:Pxdn UTSW 12 30,044,479 (GRCm39) missense probably benign 0.02
R7347:Pxdn UTSW 12 30,062,260 (GRCm39) missense probably benign 0.01
R7402:Pxdn UTSW 12 30,052,438 (GRCm39) missense probably damaging 1.00
R7408:Pxdn UTSW 12 30,040,944 (GRCm39) missense probably benign 0.29
R7413:Pxdn UTSW 12 30,052,927 (GRCm39) missense probably benign 0.00
R7447:Pxdn UTSW 12 30,034,926 (GRCm39) missense probably damaging 1.00
R7572:Pxdn UTSW 12 30,056,704 (GRCm39) missense probably damaging 1.00
R7708:Pxdn UTSW 12 30,056,601 (GRCm39) missense probably damaging 0.99
R7815:Pxdn UTSW 12 30,055,824 (GRCm39) missense probably damaging 0.96
R7972:Pxdn UTSW 12 30,056,601 (GRCm39) missense probably damaging 0.99
R8097:Pxdn UTSW 12 30,056,601 (GRCm39) missense probably damaging 0.99
R8098:Pxdn UTSW 12 30,056,601 (GRCm39) missense probably damaging 0.99
R8205:Pxdn UTSW 12 30,056,566 (GRCm39) missense probably damaging 1.00
R8262:Pxdn UTSW 12 30,049,195 (GRCm39) nonsense probably null
R8335:Pxdn UTSW 12 30,052,096 (GRCm39) missense probably damaging 0.99
R8356:Pxdn UTSW 12 30,061,889 (GRCm39) missense probably damaging 0.99
R8437:Pxdn UTSW 12 30,052,043 (GRCm39) missense probably damaging 1.00
R8456:Pxdn UTSW 12 30,061,889 (GRCm39) missense probably damaging 0.99
R8709:Pxdn UTSW 12 30,056,601 (GRCm39) missense probably damaging 0.99
R8903:Pxdn UTSW 12 30,040,992 (GRCm39) missense probably benign
R9310:Pxdn UTSW 12 30,052,051 (GRCm39) missense probably damaging 1.00
R9487:Pxdn UTSW 12 30,044,552 (GRCm39) missense possibly damaging 0.90
Z1177:Pxdn UTSW 12 30,040,851 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTTGTAGCTGAAACGCTCC -3'
(R):5'- ACTTGTCCTGTGGTCTGAAG -3'

Sequencing Primer
(F):5'- GCTGAAACGCTCCAATTAGTGTC -3'
(R):5'- GAAGCTCCCCATGTTGTCATCTAGG -3'
Posted On 2021-03-08