Incidental Mutation 'R8772:Olfr205'
ID664499
Institutional Source Beutler Lab
Gene Symbol Olfr205
Ensembl Gene ENSMUSG00000094422
Gene Nameolfactory receptor 205
SynonymsMOR182-11P, GA_x54KRFPKG5P-55543875-55542958
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R8772 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location59328005-59331138 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59328688 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 274 (S274P)
Ref Sequence ENSEMBL: ENSMUSP00000149415 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074125] [ENSMUST00000213910]
Predicted Effect probably damaging
Transcript: ENSMUST00000074125
AA Change: S274P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073762
Gene: ENSMUSG00000094422
AA Change: S274P

DomainStartEndE-ValueType
Pfam:7tm_4 30 305 1.6e-49 PFAM
Pfam:7TM_GPCR_Srsx 34 302 1.6e-7 PFAM
Pfam:7tm_1 40 289 7.8e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213910
AA Change: S274P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 T C 17: 45,516,977 V574A probably benign Het
AC157566.4 T C 15: 76,534,249 Y20C probably benign Het
Acacb A T 5: 114,184,118 D231V possibly damaging Het
Acp7 C T 7: 28,616,484 V226M probably damaging Het
Actr1a A G 19: 46,382,292 probably null Het
Adamts16 T C 13: 70,836,334 Y70C probably damaging Het
Adcy5 G A 16: 35,299,588 A1156T probably damaging Het
Akap9 G A 5: 4,046,255 E2377K probably damaging Het
Asic2 A G 11: 81,967,887 S100P probably benign Het
Atp1a1 A C 3: 101,579,808 V895G probably benign Het
B3gnt7 A G 1: 86,305,572 E180G possibly damaging Het
Cacna1c A T 6: 118,602,322 F1805I Het
Cacna1g A G 11: 94,465,887 I141T probably benign Het
Ccdc162 A G 10: 41,630,037 L919P probably damaging Het
Cd47 A G 16: 49,884,212 I116V Het
Cdca2 A T 14: 67,698,080 D395E probably damaging Het
Celsr2 A T 3: 108,397,073 I2285N possibly damaging Het
Chil5 T C 3: 106,018,220 D157G probably damaging Het
Ciita A T 16: 10,480,162 I7F probably damaging Het
Dok7 G T 5: 35,077,249 G215C probably damaging Het
Eif2s2 T C 2: 154,887,739 I88V probably null Het
Fasn A T 11: 120,820,536 D217E probably benign Het
Fgd5 T A 6: 92,050,419 I1030N probably damaging Het
Fpr-rs6 T A 17: 20,182,233 N289Y probably damaging Het
Gm10392 C T 11: 77,518,454 V49I possibly damaging Het
Gtf3c2 A T 5: 31,174,414 M20K probably benign Het
Hoga1 A G 19: 42,045,945 M10V probably benign Het
Homer1 T A 13: 93,391,731 V258E probably damaging Het
Ifitm2 A G 7: 140,955,890 L9S probably benign Het
Iqgap3 G A 3: 88,089,837 A176T probably benign Het
Itga8 C G 2: 12,182,684 G728A probably damaging Het
Lyst C T 13: 13,637,492 Q830* probably null Het
Macc1 T C 12: 119,447,485 W663R probably damaging Het
Mipol1 A T 12: 57,325,632 H159L probably benign Het
Mocs1 T A 17: 49,450,374 probably null Het
Ncoa1 T C 12: 4,322,940 T154A possibly damaging Het
Noxred1 A C 12: 87,227,093 L58R probably benign Het
Olfr78 G A 7: 102,743,003 probably benign Het
Olfr895 G A 9: 38,268,935 V133I probably benign Het
Opcml T C 9: 27,791,411 V9A probably benign Het
Otog A T 7: 46,284,928 R1303S probably damaging Het
Parp11 T A 6: 127,470,763 M20K possibly damaging Het
Parp11 T A 6: 127,491,704 I322N probably damaging Het
Pglyrp4 A T 3: 90,740,400 T356S possibly damaging Het
Pitrm1 A G 13: 6,578,560 D963G probably damaging Het
Plod3 T C 5: 136,988,919 V183A probably damaging Het
Plxnb2 C T 15: 89,162,746 V791M probably damaging Het
Ppp1r7 A G 1: 93,354,428 T234A probably benign Het
Pxdn C T 12: 30,015,464 T1441I probably damaging Het
Rap1gap2 T C 11: 74,405,725 K479E probably damaging Het
Rars2 A G 4: 34,623,488 D63G probably benign Het
Rptor A C 11: 119,725,032 D124A probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Ryr1 C A 7: 29,116,132 R118L probably benign Het
Sap130 G C 18: 31,680,464 D525H probably damaging Het
Slc22a26 T C 19: 7,790,112 N310D probably benign Het
Slc46a1 T G 11: 78,465,951 N58K probably benign Het
Slc4a10 T A 2: 62,303,940 I1000N probably damaging Het
Son C T 16: 91,657,938 T1191I possibly damaging Het
Sppl2a T C 2: 126,926,311 K146E probably benign Het
Srgap3 T A 6: 112,766,945 K444I probably damaging Het
Sun1 T C 5: 139,223,692 V59A probably benign Het
Sva T A 6: 42,038,509 Y37N probably benign Het
Taar8c T A 10: 24,101,807 M36L probably benign Het
Taf4b C T 18: 14,835,852 T682I probably damaging Het
Tbx5 T A 5: 119,838,725 H59Q probably benign Het
Tdrd1 A T 19: 56,855,328 Y746F probably damaging Het
Tmem132e A G 11: 82,434,311 S46G probably damaging Het
Tnfaip6 T A 2: 52,051,065 V206E possibly damaging Het
Ttn T A 2: 76,937,681 K3025* probably null Het
Tulp4 T A 17: 6,176,893 I106N probably damaging Het
Ubp1 T A 9: 113,972,829 F454Y probably benign Het
Ugt2b37 A T 5: 87,254,486 N95K probably benign Het
Vps13d T A 4: 145,075,032 R3539W Het
Vsnl1 T C 12: 11,332,179 H67R probably damaging Het
Zbbx A G 3: 75,155,385 Y22H probably benign Het
Zeb1 A G 18: 5,770,382 probably null Het
Zfp142 A T 1: 74,571,666 L990Q possibly damaging Het
Zmiz1 G A 14: 25,645,694 G265D probably damaging Het
Other mutations in Olfr205
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02475:Olfr205 APN 16 59328725 missense probably benign 0.21
IGL03236:Olfr205 APN 16 59328837 missense probably damaging 0.97
R0054:Olfr205 UTSW 16 59329065 missense possibly damaging 0.57
R0054:Olfr205 UTSW 16 59329065 missense possibly damaging 0.57
R0167:Olfr205 UTSW 16 59328974 nonsense probably null
R0178:Olfr205 UTSW 16 59329420 missense probably damaging 1.00
R0371:Olfr205 UTSW 16 59329222 missense possibly damaging 0.60
R0577:Olfr205 UTSW 16 59328698 missense probably benign 0.01
R0597:Olfr205 UTSW 16 59328760 missense probably damaging 1.00
R0967:Olfr205 UTSW 16 59329183 missense possibly damaging 0.66
R1670:Olfr205 UTSW 16 59329244 missense probably benign 0.03
R1702:Olfr205 UTSW 16 59329141 missense probably benign 0.12
R1995:Olfr205 UTSW 16 59329291 missense probably damaging 1.00
R2239:Olfr205 UTSW 16 59329375 missense probably damaging 0.99
R4063:Olfr205 UTSW 16 59328880 missense probably benign 0.05
R4400:Olfr205 UTSW 16 59328598 missense probably benign
R4666:Olfr205 UTSW 16 59329210 missense possibly damaging 0.91
R4795:Olfr205 UTSW 16 59328850 missense probably benign 0.09
R5327:Olfr205 UTSW 16 59329098 missense probably benign 0.01
R5471:Olfr205 UTSW 16 59328631 missense probably damaging 1.00
R5770:Olfr205 UTSW 16 59329151 nonsense probably null
R6195:Olfr205 UTSW 16 59329422 missense possibly damaging 0.81
R6702:Olfr205 UTSW 16 59328598 missense probably benign
R7686:Olfr205 UTSW 16 59329016 missense probably damaging 1.00
R7908:Olfr205 UTSW 16 59329243 missense possibly damaging 0.48
R7911:Olfr205 UTSW 16 59329243 missense possibly damaging 0.48
R7912:Olfr205 UTSW 16 59329243 missense possibly damaging 0.48
R7913:Olfr205 UTSW 16 59329243 missense possibly damaging 0.48
R7998:Olfr205 UTSW 16 59329270 missense probably benign 0.09
X0026:Olfr205 UTSW 16 59329350 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AACAGACATTCACAGTCTAAACTTG -3'
(R):5'- ATGCCCGTGTCCTATTTGCG -3'

Sequencing Primer
(F):5'- GATGGAAAAGGCTTTGAAATATT -3'
(R):5'- CCTATTTGCGGTCCTGAACATGAAG -3'
Posted On2021-03-08