Incidental Mutation 'R8772:Slc22a26'
ID 664508
Institutional Source Beutler Lab
Gene Symbol Slc22a26
Ensembl Gene ENSMUSG00000053303
Gene Name solute carrier family 22 (organic cation transporter), member 26
Synonyms BC014805
MMRRC Submission 068626-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.049) question?
Stock # R8772 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 7758406-7780032 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 7767477 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 310 (N310D)
Ref Sequence ENSEMBL: ENSMUSP00000064809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065634] [ENSMUST00000120522]
AlphaFold Q91WJ2
Predicted Effect probably benign
Transcript: ENSMUST00000065634
AA Change: N310D

PolyPhen 2 Score 0.274 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000064809
Gene: ENSMUSG00000053303
AA Change: N310D

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
low complexity region 53 64 N/A INTRINSIC
Pfam:Sugar_tr 96 528 1.1e-23 PFAM
Pfam:MFS_1 124 370 7.8e-17 PFAM
Pfam:MFS_1 350 547 2.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120522
AA Change: N309D

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000113607
Gene: ENSMUSG00000053303
AA Change: N309D

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
low complexity region 53 64 N/A INTRINSIC
Pfam:Sugar_tr 94 527 4.9e-23 PFAM
Pfam:MFS_1 124 358 1.2e-15 PFAM
Pfam:MFS_1 349 547 2.4e-12 PFAM
Meta Mutation Damage Score 0.1573 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency 100% (83/83)
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 T C 17: 45,827,903 (GRCm39) V574A probably benign Het
AC157566.4 T C 15: 76,418,449 (GRCm39) Y20C probably benign Het
Acacb A T 5: 114,322,179 (GRCm39) D231V possibly damaging Het
Acp7 C T 7: 28,315,909 (GRCm39) V226M probably damaging Het
Actr1a A G 19: 46,370,731 (GRCm39) probably null Het
Adamts16 T C 13: 70,984,453 (GRCm39) Y70C probably damaging Het
Adcy5 G A 16: 35,119,958 (GRCm39) A1156T probably damaging Het
Ago1 A T 4: 126,354,316 (GRCm39) probably benign Het
Akap9 G A 5: 4,096,255 (GRCm39) E2377K probably damaging Het
Asic2 A G 11: 81,858,713 (GRCm39) S100P probably benign Het
Atp1a1 A C 3: 101,487,124 (GRCm39) V895G probably benign Het
B3gnt7 A G 1: 86,233,294 (GRCm39) E180G possibly damaging Het
Cacna1c A T 6: 118,579,283 (GRCm39) F1805I Het
Cacna1g A G 11: 94,356,713 (GRCm39) I141T probably benign Het
Ccdc162 A G 10: 41,506,033 (GRCm39) L919P probably damaging Het
Cd47 A G 16: 49,704,575 (GRCm39) I116V Het
Cdca2 A T 14: 67,935,529 (GRCm39) D395E probably damaging Het
Celsr2 A T 3: 108,304,389 (GRCm39) I2285N possibly damaging Het
Chil5 T C 3: 105,925,536 (GRCm39) D157G probably damaging Het
Ciita A T 16: 10,298,026 (GRCm39) I7F probably damaging Het
Dok7 G T 5: 35,234,593 (GRCm39) G215C probably damaging Het
Eif2s2 T C 2: 154,729,659 (GRCm39) I88V probably null Het
Fasn A T 11: 120,711,362 (GRCm39) D217E probably benign Het
Fgd5 T A 6: 92,027,400 (GRCm39) I1030N probably damaging Het
Fpr-rs6 T A 17: 20,402,495 (GRCm39) N289Y probably damaging Het
Gm10392 C T 11: 77,409,280 (GRCm39) V49I possibly damaging Het
Gtf3c2 A T 5: 31,331,758 (GRCm39) M20K probably benign Het
Hoga1 A G 19: 42,034,384 (GRCm39) M10V probably benign Het
Homer1 T A 13: 93,528,239 (GRCm39) V258E probably damaging Het
Ifitm2 A G 7: 140,535,803 (GRCm39) L9S probably benign Het
Iqgap3 G A 3: 87,997,144 (GRCm39) A176T probably benign Het
Itga8 C G 2: 12,187,495 (GRCm39) G728A probably damaging Het
Lyst C T 13: 13,812,077 (GRCm39) Q830* probably null Het
Macc1 T C 12: 119,411,220 (GRCm39) W663R probably damaging Het
Mipol1 A T 12: 57,372,418 (GRCm39) H159L probably benign Het
Mocs1 T A 17: 49,757,402 (GRCm39) probably null Het
Ncoa1 T C 12: 4,372,940 (GRCm39) T154A possibly damaging Het
Noxred1 A C 12: 87,273,867 (GRCm39) L58R probably benign Het
Opcml T C 9: 27,702,707 (GRCm39) V9A probably benign Het
Or51e2 G A 7: 102,392,210 (GRCm39) probably benign Het
Or5ac23 A G 16: 59,149,051 (GRCm39) S274P probably damaging Het
Or8c17 G A 9: 38,180,231 (GRCm39) V133I probably benign Het
Otog A T 7: 45,934,352 (GRCm39) R1303S probably damaging Het
Parp11 T A 6: 127,468,667 (GRCm39) I322N probably damaging Het
Parp11 T A 6: 127,447,726 (GRCm39) M20K possibly damaging Het
Pde1b T C 15: 103,433,548 (GRCm39) probably benign Het
Pglyrp4 A T 3: 90,647,707 (GRCm39) T356S possibly damaging Het
Pitrm1 A G 13: 6,628,596 (GRCm39) D963G probably damaging Het
Plod3 T C 5: 137,017,773 (GRCm39) V183A probably damaging Het
Plxnb2 C T 15: 89,046,949 (GRCm39) V791M probably damaging Het
Poc1b T A 10: 98,992,219 (GRCm39) probably benign Het
Ppp1r7 A G 1: 93,282,150 (GRCm39) T234A probably benign Het
Pxdn C T 12: 30,065,463 (GRCm39) T1441I probably damaging Het
Rap1gap2 T C 11: 74,296,551 (GRCm39) K479E probably damaging Het
Rars2 A G 4: 34,623,488 (GRCm39) D63G probably benign Het
Rptor A C 11: 119,615,858 (GRCm39) D124A probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,229,115 (GRCm39) probably benign Het
Ryr1 C A 7: 28,815,557 (GRCm39) R118L probably benign Het
Sap130 G C 18: 31,813,517 (GRCm39) D525H probably damaging Het
Slc46a1 T G 11: 78,356,777 (GRCm39) N58K probably benign Het
Slc4a10 T A 2: 62,134,284 (GRCm39) I1000N probably damaging Het
Son C T 16: 91,454,826 (GRCm39) T1191I possibly damaging Het
Sppl2a T C 2: 126,768,231 (GRCm39) K146E probably benign Het
Srgap3 T A 6: 112,743,906 (GRCm39) K444I probably damaging Het
Sun1 T C 5: 139,209,447 (GRCm39) V59A probably benign Het
Sva T A 6: 42,015,443 (GRCm39) Y37N probably benign Het
Taar8c T A 10: 23,977,705 (GRCm39) M36L probably benign Het
Taf4b C T 18: 14,968,909 (GRCm39) T682I probably damaging Het
Tbx5 T A 5: 119,976,790 (GRCm39) H59Q probably benign Het
Tdrd1 A T 19: 56,843,760 (GRCm39) Y746F probably damaging Het
Tmem132e A G 11: 82,325,137 (GRCm39) S46G probably damaging Het
Tnfaip6 T A 2: 51,941,077 (GRCm39) V206E possibly damaging Het
Tpbpb T A 13: 61,049,193 (GRCm39) probably benign Het
Ttn T A 2: 76,768,025 (GRCm39) K3025* probably null Het
Tulp4 T A 17: 6,227,168 (GRCm39) I106N probably damaging Het
Ubp1 T A 9: 113,801,897 (GRCm39) F454Y probably benign Het
Ugt2b37 A T 5: 87,402,345 (GRCm39) N95K probably benign Het
Vps13d T A 4: 144,801,602 (GRCm39) R3539W Het
Vsnl1 T C 12: 11,382,180 (GRCm39) H67R probably damaging Het
Zbbx A G 3: 75,062,692 (GRCm39) Y22H probably benign Het
Zeb1 A G 18: 5,770,382 (GRCm39) probably null Het
Zfp142 A T 1: 74,610,825 (GRCm39) L990Q possibly damaging Het
Zmiz1 G A 14: 25,646,118 (GRCm39) G265D probably damaging Het
Other mutations in Slc22a26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Slc22a26 APN 19 7,760,201 (GRCm39) missense probably damaging 0.99
IGL00338:Slc22a26 APN 19 7,760,340 (GRCm39) missense probably benign 0.25
IGL00736:Slc22a26 APN 19 7,767,527 (GRCm39) missense possibly damaging 0.50
IGL01085:Slc22a26 APN 19 7,767,464 (GRCm39) missense probably benign 0.02
IGL01581:Slc22a26 APN 19 7,779,549 (GRCm39) missense probably benign 0.15
IGL02502:Slc22a26 APN 19 7,768,125 (GRCm39) critical splice donor site probably null
IGL02658:Slc22a26 APN 19 7,765,613 (GRCm39) missense probably benign 0.25
IGL02936:Slc22a26 APN 19 7,768,470 (GRCm39) missense probably damaging 0.99
IGL03162:Slc22a26 APN 19 7,779,466 (GRCm39) missense probably benign 0.00
R0034:Slc22a26 UTSW 19 7,779,618 (GRCm39) missense probably benign 0.03
R0633:Slc22a26 UTSW 19 7,765,575 (GRCm39) critical splice donor site probably null
R0676:Slc22a26 UTSW 19 7,773,509 (GRCm39) splice site probably benign
R2156:Slc22a26 UTSW 19 7,779,480 (GRCm39) missense probably damaging 1.00
R4043:Slc22a26 UTSW 19 7,765,694 (GRCm39) critical splice acceptor site probably null
R4781:Slc22a26 UTSW 19 7,767,500 (GRCm39) missense probably benign 0.34
R4896:Slc22a26 UTSW 19 7,768,419 (GRCm39) missense probably benign 0.14
R4999:Slc22a26 UTSW 19 7,779,546 (GRCm39) missense probably damaging 1.00
R5125:Slc22a26 UTSW 19 7,767,540 (GRCm39) missense possibly damaging 0.62
R5178:Slc22a26 UTSW 19 7,767,540 (GRCm39) missense possibly damaging 0.62
R6161:Slc22a26 UTSW 19 7,763,812 (GRCm39) missense possibly damaging 0.50
R6494:Slc22a26 UTSW 19 7,779,651 (GRCm39) missense probably damaging 1.00
R6512:Slc22a26 UTSW 19 7,779,865 (GRCm39) start gained probably benign
R6724:Slc22a26 UTSW 19 7,779,726 (GRCm39) missense probably benign 0.14
R7323:Slc22a26 UTSW 19 7,768,259 (GRCm39) missense probably damaging 0.97
R7375:Slc22a26 UTSW 19 7,760,509 (GRCm39) splice site probably null
R7558:Slc22a26 UTSW 19 7,762,651 (GRCm39) missense possibly damaging 0.94
R7634:Slc22a26 UTSW 19 7,779,952 (GRCm39) splice site probably null
R8905:Slc22a26 UTSW 19 7,760,331 (GRCm39) missense probably damaging 0.97
R8937:Slc22a26 UTSW 19 7,768,390 (GRCm39) splice site probably benign
R9059:Slc22a26 UTSW 19 7,762,559 (GRCm39) missense probably benign 0.01
R9659:Slc22a26 UTSW 19 7,763,798 (GRCm39) missense probably benign 0.02
R9788:Slc22a26 UTSW 19 7,763,798 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CACGAAAGATATCATCAAATCAGGG -3'
(R):5'- GTTCCCAGTCTGCATTCCAG -3'

Sequencing Primer
(F):5'- CAGGGTTTTTACAAAGTCCTCTTG -3'
(R):5'- CCAGAGATTCATATACATTGCATTGC -3'
Posted On 2021-03-08