Incidental Mutation 'R8773:Cr2'
ID 664516
Institutional Source Beutler Lab
Gene Symbol Cr2
Ensembl Gene ENSMUSG00000026616
Gene Name complement receptor 2
Synonyms C3DR, CD21, Cr-2, Cr1, Cr-1, CD35
MMRRC Submission 068627-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.112) question?
Stock # R8773 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 194819119-194859024 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 194840913 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 460 (W460R)
Ref Sequence ENSEMBL: ENSMUSP00000080938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082321] [ENSMUST00000193356] [ENSMUST00000193801] [ENSMUST00000195120] [ENSMUST00000210219]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000082321
AA Change: W460R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080938
Gene: ENSMUSG00000026616
AA Change: W460R

DomainStartEndE-ValueType
CCP 23 82 1.01e-11 SMART
CCP 91 147 9.1e-14 SMART
CCP 155 211 1.9e-16 SMART
CCP 216 272 1.6e-9 SMART
CCP 277 343 1.01e-11 SMART
CCP 352 407 1.2e-13 SMART
CCP 411 467 2.34e-16 SMART
CCP 472 523 1.24e0 SMART
CCP 528 594 4.48e-13 SMART
CCP 603 658 1.95e-13 SMART
CCP 718 778 1.75e-15 SMART
CCP 787 842 2.06e-12 SMART
CCP 850 906 7.92e-14 SMART
CCP 911 967 1.29e-13 SMART
transmembrane domain 975 997 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000193356
AA Change: W163R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141706
Gene: ENSMUSG00000026616
AA Change: W163R

DomainStartEndE-ValueType
CCP 1 46 1.2e-1 SMART
CCP 55 110 5.9e-16 SMART
CCP 114 170 1.1e-18 SMART
CCP 175 226 6.1e-3 SMART
CCP 231 297 2.2e-15 SMART
CCP 306 361 9.4e-16 SMART
CCP 421 481 8.3e-18 SMART
CCP 490 545 1e-14 SMART
CCP 553 609 4e-16 SMART
CCP 614 670 6.2e-16 SMART
transmembrane domain 678 700 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193801
SMART Domains Protein: ENSMUSP00000141276
Gene: ENSMUSG00000026616

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000195120
AA Change: W460R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141538
Gene: ENSMUSG00000026616
AA Change: W460R

DomainStartEndE-ValueType
CCP 23 82 4.9e-14 SMART
CCP 91 147 4.5e-16 SMART
CCP 155 211 9.1e-19 SMART
CCP 216 272 8e-12 SMART
CCP 277 343 5e-14 SMART
CCP 352 407 5.9e-16 SMART
CCP 411 467 1.1e-18 SMART
CCP 472 523 6.1e-3 SMART
CCP 528 594 2.2e-15 SMART
CCP 603 658 9.4e-16 SMART
CCP 718 778 8.3e-18 SMART
CCP 787 842 1e-14 SMART
CCP 850 906 4e-16 SMART
CCP 911 967 6.2e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000210219
AA Change: W836R

PolyPhen 2 Score 0.251 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.9557 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein, which functions as a receptor for Epstein-Barr virus (EBV) binding on B and T lymphocytes. Genetic variations in this gene are associated with susceptibility to systemic lupus erythematosus type 9 (SLEB9). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired humoral immune responses to T cell-dependent antigens, with limited affinity maturation, and reduced memory B cell and germinal center formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A T 2: 151,314,062 (GRCm39) S539T possibly damaging Het
Abcc6 C T 7: 45,634,569 (GRCm39) R1136Q probably benign Het
Abhd12b A C 12: 70,213,708 (GRCm39) probably null Het
Agk T G 6: 40,334,050 (GRCm39) V98G possibly damaging Het
Apbb2 A G 5: 66,609,252 (GRCm39) S132P probably damaging Het
Apc2 T C 10: 80,142,046 (GRCm39) S322P probably damaging Het
Armc3 T C 2: 19,293,667 (GRCm39) V486A probably benign Het
Asxl2 A G 12: 3,507,200 (GRCm39) K131E probably damaging Het
Atp13a4 A G 16: 29,260,398 (GRCm39) V560A Het
Bnc1 C T 7: 81,623,719 (GRCm39) G503S probably damaging Het
Bsn C A 9: 107,987,704 (GRCm39) V2683F unknown Het
Btbd7 A T 12: 102,804,241 (GRCm39) N266K probably benign Het
Ccdc121rt2 T C 5: 112,597,681 (GRCm39) V76A probably benign Het
Cdca7l G A 12: 117,839,346 (GRCm39) D350N possibly damaging Het
Cfap251 A G 5: 123,411,913 (GRCm39) D515G probably benign Het
Ciao2a A T 9: 66,045,667 (GRCm39) N145I probably damaging Het
Col6a3 T A 1: 90,696,171 (GRCm39) D3239V unknown Het
Col9a1 T A 1: 24,224,208 (GRCm39) I130N unknown Het
Cyb561d2 A G 9: 107,417,583 (GRCm39) F56S probably damaging Het
Dnaaf1 A G 8: 120,302,194 (GRCm39) I32V probably benign Het
Dnah11 T A 12: 117,958,950 (GRCm39) T2978S possibly damaging Het
Dsg2 T A 18: 20,716,056 (GRCm39) D302E probably damaging Het
Faf1 T A 4: 109,699,507 (GRCm39) F351I possibly damaging Het
Gimap8 C A 6: 48,633,545 (GRCm39) Q455K probably benign Het
Hps6 C G 19: 45,994,141 (GRCm39) R693G possibly damaging Het
Irx1 C T 13: 72,107,635 (GRCm39) G349D probably damaging Het
Itga8 C G 2: 12,187,495 (GRCm39) G728A probably damaging Het
Lcat T C 8: 106,666,710 (GRCm39) T271A possibly damaging Het
Mapkapk2 T C 1: 130,983,679 (GRCm39) H308R probably damaging Het
Mast1 A T 8: 85,642,953 (GRCm39) N947K probably damaging Het
Mpeg1 A T 19: 12,440,419 (GRCm39) I626F probably damaging Het
Mrtfa T C 15: 80,902,274 (GRCm39) S349G possibly damaging Het
Myh15 T C 16: 49,015,900 (GRCm39) S1859P possibly damaging Het
Nlrx1 A T 9: 44,167,712 (GRCm39) D728E probably benign Het
Or1j8 A G 2: 36,192,387 (GRCm39) T279A probably benign Het
Or8c19-ps1 G T 9: 38,220,516 (GRCm39) V142F probably benign Het
Pcdhb18 A T 18: 37,624,562 (GRCm39) S631C probably damaging Het
Pcdhga11 C A 18: 37,890,364 (GRCm39) Y457* probably null Het
Pcdhga5 T C 18: 37,829,823 (GRCm39) I757T probably benign Het
Pcgf5 G A 19: 36,389,348 (GRCm39) probably benign Het
Pdf A G 8: 107,775,100 (GRCm39) V44A possibly damaging Het
Pip4p1 T C 14: 51,166,503 (GRCm39) T194A possibly damaging Het
Prtg A T 9: 72,819,583 (GRCm39) *1192L probably null Het
Ptk7 A G 17: 46,877,193 (GRCm39) F955S possibly damaging Het
Rbp3 C A 14: 33,684,492 (GRCm39) Q1174K possibly damaging Het
Rufy1 T C 11: 50,321,796 (GRCm39) D46G possibly damaging Het
Sbf2 A G 7: 109,948,202 (GRCm39) V1216A probably benign Het
Serpina11 A G 12: 103,952,722 (GRCm39) V18A unknown Het
Serpinb6a T A 13: 34,115,543 (GRCm39) N47I probably damaging Het
Shc2 T C 10: 79,456,924 (GRCm39) H564R probably damaging Het
Sirt7 T A 11: 120,514,888 (GRCm39) R115* probably null Het
Slc22a14 A T 9: 119,059,290 (GRCm39) probably benign Het
Stra8 T A 6: 34,912,581 (GRCm39) S331T probably damaging Het
Tm9sf2 A G 14: 122,380,883 (GRCm39) T324A probably benign Het
Tmem268 T C 4: 63,498,530 (GRCm39) S224P probably benign Het
Tns1 T C 1: 73,976,407 (GRCm39) D1147G probably damaging Het
Tomm22 C T 15: 79,555,311 (GRCm39) probably benign Het
Top1 A G 2: 160,556,158 (GRCm39) Y539C probably damaging Het
Tpp2 T A 1: 44,009,552 (GRCm39) probably benign Het
Trav3-1 T C 14: 52,818,428 (GRCm39) V34A probably damaging Het
Tspyl5 T C 15: 33,687,238 (GRCm39) N236D possibly damaging Het
Ttc41 A G 10: 86,565,679 (GRCm39) D411G probably benign Het
Vmn1r128 A T 7: 21,083,922 (GRCm39) M209L probably benign Het
Xirp2 T A 2: 67,355,527 (GRCm39) D3429E probably benign Het
Zfp418 A T 7: 7,185,797 (GRCm39) T587S probably benign Het
Other mutations in Cr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Cr2 APN 1 194,836,559 (GRCm39) missense possibly damaging 0.76
IGL01326:Cr2 APN 1 194,823,529 (GRCm39) missense probably null 1.00
IGL01358:Cr2 APN 1 194,842,128 (GRCm39) missense probably damaging 1.00
IGL01410:Cr2 APN 1 194,845,542 (GRCm39) missense possibly damaging 0.49
IGL01468:Cr2 APN 1 194,850,843 (GRCm39) missense probably damaging 1.00
IGL01608:Cr2 APN 1 194,837,528 (GRCm39) missense possibly damaging 0.50
IGL01810:Cr2 APN 1 194,841,903 (GRCm39) missense possibly damaging 0.49
IGL01843:Cr2 APN 1 194,833,222 (GRCm39) splice site probably benign
IGL02332:Cr2 APN 1 194,842,630 (GRCm39) missense probably benign 0.19
IGL02934:Cr2 APN 1 194,836,633 (GRCm39) splice site probably benign
IGL02938:Cr2 APN 1 194,848,696 (GRCm39) missense probably damaging 1.00
IGL03149:Cr2 APN 1 194,848,674 (GRCm39) missense probably damaging 1.00
IGL03327:Cr2 APN 1 194,852,067 (GRCm39) missense probably damaging 1.00
IGL03346:Cr2 APN 1 194,852,067 (GRCm39) missense probably damaging 1.00
Pillar UTSW 1 194,838,196 (GRCm39) nonsense probably null
PIT4354001:Cr2 UTSW 1 194,848,617 (GRCm39) missense probably damaging 1.00
PIT4418001:Cr2 UTSW 1 194,839,760 (GRCm39) missense probably benign 0.08
R0128:Cr2 UTSW 1 194,848,539 (GRCm39) missense probably damaging 0.99
R0130:Cr2 UTSW 1 194,848,539 (GRCm39) missense probably damaging 0.99
R0380:Cr2 UTSW 1 194,839,715 (GRCm39) missense probably damaging 1.00
R0538:Cr2 UTSW 1 194,842,667 (GRCm39) splice site probably benign
R0605:Cr2 UTSW 1 194,845,904 (GRCm39) splice site probably benign
R0626:Cr2 UTSW 1 194,853,419 (GRCm39) missense possibly damaging 0.95
R1135:Cr2 UTSW 1 194,839,498 (GRCm39) missense probably damaging 1.00
R1396:Cr2 UTSW 1 194,851,561 (GRCm39) splice site probably null
R1422:Cr2 UTSW 1 194,853,433 (GRCm39) missense probably benign 0.01
R1467:Cr2 UTSW 1 194,839,817 (GRCm39) missense probably damaging 1.00
R1467:Cr2 UTSW 1 194,839,817 (GRCm39) missense probably damaging 1.00
R1511:Cr2 UTSW 1 194,837,580 (GRCm39) missense possibly damaging 0.92
R1572:Cr2 UTSW 1 194,845,622 (GRCm39) missense probably damaging 1.00
R1714:Cr2 UTSW 1 194,833,994 (GRCm39) missense possibly damaging 0.46
R1748:Cr2 UTSW 1 194,838,213 (GRCm39) nonsense probably null
R1761:Cr2 UTSW 1 194,837,431 (GRCm39) critical splice donor site probably null
R1824:Cr2 UTSW 1 194,839,624 (GRCm39) missense probably damaging 1.00
R1893:Cr2 UTSW 1 194,837,495 (GRCm39) missense probably benign 0.03
R1990:Cr2 UTSW 1 194,836,458 (GRCm39) missense possibly damaging 0.63
R1991:Cr2 UTSW 1 194,836,458 (GRCm39) missense possibly damaging 0.63
R1992:Cr2 UTSW 1 194,836,458 (GRCm39) missense possibly damaging 0.63
R2191:Cr2 UTSW 1 194,845,689 (GRCm39) missense possibly damaging 0.94
R2276:Cr2 UTSW 1 194,839,676 (GRCm39) missense possibly damaging 0.94
R2277:Cr2 UTSW 1 194,839,676 (GRCm39) missense possibly damaging 0.94
R3548:Cr2 UTSW 1 194,838,196 (GRCm39) nonsense probably null
R3743:Cr2 UTSW 1 194,832,274 (GRCm39) splice site probably benign
R3941:Cr2 UTSW 1 194,848,122 (GRCm39) missense probably damaging 0.97
R3963:Cr2 UTSW 1 194,842,047 (GRCm39) missense probably damaging 1.00
R4211:Cr2 UTSW 1 194,838,636 (GRCm39) missense probably damaging 0.96
R4484:Cr2 UTSW 1 194,836,482 (GRCm39) missense probably damaging 1.00
R4546:Cr2 UTSW 1 194,853,349 (GRCm39) missense possibly damaging 0.94
R4791:Cr2 UTSW 1 194,838,243 (GRCm39) missense probably damaging 1.00
R4801:Cr2 UTSW 1 194,845,619 (GRCm39) missense probably damaging 1.00
R4802:Cr2 UTSW 1 194,845,619 (GRCm39) missense probably damaging 1.00
R4874:Cr2 UTSW 1 194,858,878 (GRCm39) missense possibly damaging 0.82
R4885:Cr2 UTSW 1 194,841,039 (GRCm39) missense possibly damaging 0.92
R4889:Cr2 UTSW 1 194,858,893 (GRCm39) missense possibly damaging 0.70
R5154:Cr2 UTSW 1 194,841,754 (GRCm39) missense probably damaging 1.00
R5574:Cr2 UTSW 1 194,823,544 (GRCm39) missense probably damaging 1.00
R5594:Cr2 UTSW 1 194,839,498 (GRCm39) missense probably damaging 1.00
R5645:Cr2 UTSW 1 194,836,581 (GRCm39) missense probably damaging 1.00
R5700:Cr2 UTSW 1 194,842,065 (GRCm39) missense probably damaging 0.96
R5929:Cr2 UTSW 1 194,853,419 (GRCm39) missense possibly damaging 0.91
R6237:Cr2 UTSW 1 194,839,810 (GRCm39) missense probably damaging 1.00
R6299:Cr2 UTSW 1 194,850,954 (GRCm39) missense probably damaging 1.00
R6368:Cr2 UTSW 1 194,850,780 (GRCm39) missense probably damaging 1.00
R6406:Cr2 UTSW 1 194,852,079 (GRCm39) missense probably damaging 1.00
R6618:Cr2 UTSW 1 194,839,687 (GRCm39) missense probably damaging 0.98
R6684:Cr2 UTSW 1 194,853,329 (GRCm39) nonsense probably null
R6720:Cr2 UTSW 1 194,837,508 (GRCm39) missense probably damaging 0.97
R6866:Cr2 UTSW 1 194,833,999 (GRCm39) missense probably damaging 1.00
R6915:Cr2 UTSW 1 194,853,454 (GRCm39) missense probably benign 0.06
R7057:Cr2 UTSW 1 194,833,918 (GRCm39) missense possibly damaging 0.83
R7117:Cr2 UTSW 1 194,842,909 (GRCm39) missense possibly damaging 0.79
R7200:Cr2 UTSW 1 194,845,557 (GRCm39) missense probably damaging 1.00
R7209:Cr2 UTSW 1 194,851,032 (GRCm39) missense probably damaging 1.00
R7350:Cr2 UTSW 1 194,837,594 (GRCm39) missense probably benign 0.21
R7414:Cr2 UTSW 1 194,832,344 (GRCm39) missense probably benign
R7453:Cr2 UTSW 1 194,847,565 (GRCm39) splice site probably null
R7479:Cr2 UTSW 1 194,840,718 (GRCm39) critical splice donor site probably null
R7480:Cr2 UTSW 1 194,836,484 (GRCm39) missense probably damaging 1.00
R7570:Cr2 UTSW 1 194,851,648 (GRCm39) nonsense probably null
R7666:Cr2 UTSW 1 194,836,533 (GRCm39) missense probably damaging 1.00
R7921:Cr2 UTSW 1 194,833,975 (GRCm39) missense possibly damaging 0.94
R7923:Cr2 UTSW 1 194,850,995 (GRCm39) missense probably benign 0.03
R8396:Cr2 UTSW 1 194,840,376 (GRCm39) missense probably damaging 1.00
R8503:Cr2 UTSW 1 194,845,850 (GRCm39) missense probably benign
R8517:Cr2 UTSW 1 194,838,207 (GRCm39) missense probably benign 0.03
R8849:Cr2 UTSW 1 194,839,547 (GRCm39) missense probably damaging 1.00
R8896:Cr2 UTSW 1 194,851,581 (GRCm39) missense possibly damaging 0.58
R8938:Cr2 UTSW 1 194,853,424 (GRCm39) missense probably damaging 0.99
R9027:Cr2 UTSW 1 194,834,029 (GRCm39) missense probably benign 0.08
R9045:Cr2 UTSW 1 194,837,680 (GRCm39) missense possibly damaging 0.61
R9116:Cr2 UTSW 1 194,840,977 (GRCm39) nonsense probably null
R9137:Cr2 UTSW 1 194,850,640 (GRCm39) critical splice donor site probably null
R9476:Cr2 UTSW 1 194,840,416 (GRCm39) missense probably damaging 0.97
R9497:Cr2 UTSW 1 194,850,743 (GRCm39) missense probably damaging 0.99
R9510:Cr2 UTSW 1 194,840,416 (GRCm39) missense probably damaging 0.97
R9752:Cr2 UTSW 1 194,823,575 (GRCm39) missense probably benign 0.37
R9799:Cr2 UTSW 1 194,842,988 (GRCm39) missense probably benign 0.02
X0028:Cr2 UTSW 1 194,832,290 (GRCm39) missense probably benign 0.09
X0066:Cr2 UTSW 1 194,848,629 (GRCm39) missense probably damaging 0.99
Z1176:Cr2 UTSW 1 194,836,461 (GRCm39) missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- CAGCTGTCCTAATAAACTGATTCTG -3'
(R):5'- GACAACTGCCATGCAAATGG -3'

Sequencing Primer
(F):5'- CTGATTCTGAGGCCTCTTAAAGAG -3'
(R):5'- CAACTGCCATGCAAATGGTATTATC -3'
Posted On 2021-03-08