Mutagenetix > Incidental Mutation

Incidental Mutation 'R8773:Cr2'

664516

Institutional Source

Beutler Lab

Gene Symbol

Cr2

Ensembl Gene

ENSMUSG00000026616

Gene Name

complement receptor 2

Synonyms

C3DR, CD21, Cr-1, Cr1, CD35, Cr-2

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.125) question?

Stock #

R8773 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

195136811-195176716 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 195158605 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 460 (W460R)

Ref Sequence

ENSEMBL: ENSMUSP00000080938 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000082321] [ENSMUST00000193356] [ENSMUST00000193801] [ENSMUST00000195120] [ENSMUST00000210219]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000082321
AA Change: W460R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000080938
Gene: ENSMUSG00000026616
AA Change: W460R

Domain	Start	End	E-Value	Type
CCP	23	82	1.01e-11	SMART
CCP	91	147	9.1e-14	SMART
CCP	155	211	1.9e-16	SMART
CCP	216	272	1.6e-9	SMART
CCP	277	343	1.01e-11	SMART
CCP	352	407	1.2e-13	SMART
CCP	411	467	2.34e-16	SMART
CCP	472	523	1.24e0	SMART
CCP	528	594	4.48e-13	SMART
CCP	603	658	1.95e-13	SMART
CCP	718	778	1.75e-15	SMART
CCP	787	842	2.06e-12	SMART
CCP	850	906	7.92e-14	SMART
CCP	911	967	1.29e-13	SMART
transmembrane domain	975	997	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000193356
AA Change: W163R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000141706
Gene: ENSMUSG00000026616
AA Change: W163R

Domain	Start	End	E-Value	Type
CCP	1	46	1.2e-1	SMART
CCP	55	110	5.9e-16	SMART
CCP	114	170	1.1e-18	SMART
CCP	175	226	6.1e-3	SMART
CCP	231	297	2.2e-15	SMART
CCP	306	361	9.4e-16	SMART
CCP	421	481	8.3e-18	SMART
CCP	490	545	1e-14	SMART
CCP	553	609	4e-16	SMART
CCP	614	670	6.2e-16	SMART
transmembrane domain	678	700	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000193801

SMART Domains

Protein: ENSMUSP00000141276
Gene: ENSMUSG00000026616

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000195120
AA Change: W460R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000141538
Gene: ENSMUSG00000026616
AA Change: W460R

Domain	Start	End	E-Value	Type
CCP	23	82	4.9e-14	SMART
CCP	91	147	4.5e-16	SMART
CCP	155	211	9.1e-19	SMART
CCP	216	272	8e-12	SMART
CCP	277	343	5e-14	SMART
CCP	352	407	5.9e-16	SMART
CCP	411	467	1.1e-18	SMART
CCP	472	523	6.1e-3	SMART
CCP	528	594	2.2e-15	SMART
CCP	603	658	9.4e-16	SMART
CCP	718	778	8.3e-18	SMART
CCP	787	842	1e-14	SMART
CCP	850	906	4e-16	SMART
CCP	911	967	6.2e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000210219
AA Change: W836R

PolyPhen 2 Score 0.251 (Sensitivity: 0.91; Specificity: 0.88)

Meta Mutation Damage Score

0.9557

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

98% (63/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein, which functions as a receptor for Epstein-Barr virus (EBV) binding on B and T lymphocytes. Genetic variations in this gene are associated with susceptibility to systemic lupus erythematosus type 9 (SLEB9). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired humoral immune responses to T cell-dependent antigens, with limited affinity maturation, and reduced memory B cell and germinal center formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921509C19Rik	A	T	2: 151,472,142	S539T	possibly damaging	Het
Abcc6	C	T	7: 45,985,145	R1136Q	probably benign	Het
Abhd12b	A	C	12: 70,166,934		probably null	Het
Agk	T	G	6: 40,357,116	V98G	possibly damaging	Het
Apbb2	A	G	5: 66,451,909	S132P	probably damaging	Het
Apc2	T	C	10: 80,306,212	S322P	probably damaging	Het
Armc3	T	C	2: 19,288,856	V486A	probably benign	Het
Asxl2	A	G	12: 3,457,200	K131E	probably damaging	Het
Atp13a4	A	G	16: 29,441,580	V560A		Het
Bnc1	C	T	7: 81,973,971	G503S	probably damaging	Het
Bsn	C	A	9: 108,110,505	V2683F	unknown	Het
Btbd7	A	T	12: 102,837,982	N266K	probably benign	Het
Cdca7l	G	A	12: 117,875,611	D350N	possibly damaging	Het
Col6a3	T	A	1: 90,768,449	D3239V	unknown	Het
Col9a1	T	A	1: 24,185,127	I130N	unknown	Het
Cyb561d2	A	G	9: 107,540,384	F56S	probably damaging	Het
Dnaaf1	A	G	8: 119,575,455	I32V	probably benign	Het
Dnah11	T	A	12: 117,995,215	T2978S	possibly damaging	Het
Dsg2	T	A	18: 20,582,999	D302E	probably damaging	Het
Faf1	T	A	4: 109,842,310	F351I	possibly damaging	Het
Fam96a	A	T	9: 66,138,385	N145I	probably damaging	Het
Gimap8	C	A	6: 48,656,611	Q455K	probably benign	Het
Gm6588	T	C	5: 112,449,815	V76A	probably benign	Het
Hps6	C	G	19: 46,005,702	R693G	possibly damaging	Het
Irx1	C	T	13: 71,959,516	G349D	probably damaging	Het
Itga8	C	G	2: 12,182,684	G728A	probably damaging	Het
Lcat	T	C	8: 105,940,078	T271A	possibly damaging	Het
Mapkapk2	T	C	1: 131,055,942	H308R	probably damaging	Het
Mast1	A	T	8: 84,916,324	N947K	probably damaging	Het
Mkl1	T	C	15: 81,018,073	S349G	possibly damaging	Het
Mpeg1	A	T	19: 12,463,055	I626F	probably damaging	Het
Myh15	T	C	16: 49,195,537	S1859P	possibly damaging	Het
Nlrx1	A	T	9: 44,256,415	D728E	probably benign	Het
Olfr335-ps	A	G	2: 36,302,375	T279A	probably benign	Het
Olfr897-ps1	G	T	9: 38,309,220	V142F	probably benign	Het
Pcdhb18	A	T	18: 37,491,509	S631C	probably damaging	Het
Pcdhga11	C	A	18: 37,757,311	Y457*	probably null	Het
Pcdhga5	T	C	18: 37,696,770	I757T	probably benign	Het
Pcgf5	G	A	19: 36,411,948		probably benign	Het
Pdf	A	G	8: 107,048,468	V44A	possibly damaging	Het
Prtg	A	T	9: 72,912,301	*1192L	probably null	Het
Ptk7	A	G	17: 46,566,267	F955S	possibly damaging	Het
Rbp3	C	A	14: 33,962,535	Q1174K	possibly damaging	Het
Rufy1	T	C	11: 50,430,969	D46G	possibly damaging	Het
Sbf2	A	G	7: 110,348,995	V1216A	probably benign	Het
Serpina11	A	G	12: 103,986,463	V18A	unknown	Het
Serpinb6a	T	A	13: 33,931,560	N47I	probably damaging	Het
Shc2	T	C	10: 79,621,090	H564R	probably damaging	Het
Sirt7	T	A	11: 120,624,062	R115*	probably null	Het
Slc22a14	A	T	9: 119,230,224		probably benign	Het
Stra8	T	A	6: 34,935,646	S331T	probably damaging	Het
Tm9sf2	A	G	14: 122,143,471	T324A	probably benign	Het
Tmem268	T	C	4: 63,580,293	S224P	probably benign	Het
Tmem55b	T	C	14: 50,929,046	T194A	possibly damaging	Het
Tns1	T	C	1: 73,937,248	D1147G	probably damaging	Het
Tomm22	C	T	15: 79,671,110		probably benign	Het
Top1	A	G	2: 160,714,238	Y539C	probably damaging	Het
Tpp2	T	A	1: 43,970,392		probably benign	Het
Trav3-1	T	C	14: 52,580,971	V34A	probably damaging	Het
Tspyl5	T	C	15: 33,687,092	N236D	possibly damaging	Het
Ttc41	A	G	10: 86,729,815	D411G	probably benign	Het
Vmn1r128	A	T	7: 21,349,997	M209L	probably benign	Het
Wdr66	A	G	5: 123,273,850	D515G	probably benign	Het
Xirp2	T	A	2: 67,525,183	D3429E	probably benign	Het
Zfp418	A	T	7: 7,182,798	T587S	probably benign	Het

Other mutations in Cr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00587:Cr2	APN	1	195154251	missense	possibly damaging	0.76
IGL01326:Cr2	APN	1	195141221	missense	probably null	1.00
IGL01358:Cr2	APN	1	195159820	missense	probably damaging	1.00
IGL01410:Cr2	APN	1	195163234	missense	possibly damaging	0.49
IGL01468:Cr2	APN	1	195168535	missense	probably damaging	1.00
IGL01608:Cr2	APN	1	195155220	missense	possibly damaging	0.50
IGL01810:Cr2	APN	1	195159595	missense	possibly damaging	0.49
IGL01843:Cr2	APN	1	195150914	splice site	probably benign
IGL02332:Cr2	APN	1	195160322	missense	probably benign	0.19
IGL02934:Cr2	APN	1	195154325	splice site	probably benign
IGL02938:Cr2	APN	1	195166388	missense	probably damaging	1.00
IGL03149:Cr2	APN	1	195166366	missense	probably damaging	1.00
IGL03327:Cr2	APN	1	195169759	missense	probably damaging	1.00
IGL03346:Cr2	APN	1	195169759	missense	probably damaging	1.00
Pillar	UTSW	1	195155888	nonsense	probably null
PIT4354001:Cr2	UTSW	1	195166309	missense	probably damaging	1.00
PIT4418001:Cr2	UTSW	1	195157452	missense	probably benign	0.08
R0128:Cr2	UTSW	1	195166231	missense	probably damaging	0.99
R0130:Cr2	UTSW	1	195166231	missense	probably damaging	0.99
R0380:Cr2	UTSW	1	195157407	missense	probably damaging	1.00
R0538:Cr2	UTSW	1	195160359	splice site	probably benign
R0605:Cr2	UTSW	1	195163596	splice site	probably benign
R0626:Cr2	UTSW	1	195171111	missense	possibly damaging	0.95
R1135:Cr2	UTSW	1	195157190	missense	probably damaging	1.00
R1396:Cr2	UTSW	1	195169253	splice site	probably null
R1422:Cr2	UTSW	1	195171125	missense	probably benign	0.01
R1467:Cr2	UTSW	1	195157509	missense	probably damaging	1.00
R1467:Cr2	UTSW	1	195157509	missense	probably damaging	1.00
R1511:Cr2	UTSW	1	195155272	missense	possibly damaging	0.92
R1572:Cr2	UTSW	1	195163314	missense	probably damaging	1.00
R1714:Cr2	UTSW	1	195151686	missense	possibly damaging	0.46
R1748:Cr2	UTSW	1	195155905	nonsense	probably null
R1761:Cr2	UTSW	1	195155123	critical splice donor site	probably null
R1824:Cr2	UTSW	1	195157316	missense	probably damaging	1.00
R1893:Cr2	UTSW	1	195155187	missense	probably benign	0.03
R1990:Cr2	UTSW	1	195154150	missense	possibly damaging	0.63
R1991:Cr2	UTSW	1	195154150	missense	possibly damaging	0.63
R1992:Cr2	UTSW	1	195154150	missense	possibly damaging	0.63
R2191:Cr2	UTSW	1	195163381	missense	possibly damaging	0.94
R2276:Cr2	UTSW	1	195157368	missense	possibly damaging	0.94
R2277:Cr2	UTSW	1	195157368	missense	possibly damaging	0.94
R3548:Cr2	UTSW	1	195155888	nonsense	probably null
R3743:Cr2	UTSW	1	195149966	splice site	probably benign
R3941:Cr2	UTSW	1	195165814	missense	probably damaging	0.97
R3963:Cr2	UTSW	1	195159739	missense	probably damaging	1.00
R4211:Cr2	UTSW	1	195156328	missense	probably damaging	0.96
R4484:Cr2	UTSW	1	195154174	missense	probably damaging	1.00
R4546:Cr2	UTSW	1	195171041	missense	possibly damaging	0.94
R4791:Cr2	UTSW	1	195155935	missense	probably damaging	1.00
R4801:Cr2	UTSW	1	195163311	missense	probably damaging	1.00
R4802:Cr2	UTSW	1	195163311	missense	probably damaging	1.00
R4874:Cr2	UTSW	1	195176570	missense	possibly damaging	0.82
R4885:Cr2	UTSW	1	195158731	missense	possibly damaging	0.92
R4889:Cr2	UTSW	1	195176585	missense	possibly damaging	0.70
R5154:Cr2	UTSW	1	195159446	missense	probably damaging	1.00
R5574:Cr2	UTSW	1	195141236	missense	probably damaging	1.00
R5594:Cr2	UTSW	1	195157190	missense	probably damaging	1.00
R5645:Cr2	UTSW	1	195154273	missense	probably damaging	1.00
R5700:Cr2	UTSW	1	195159757	missense	probably damaging	0.96
R5929:Cr2	UTSW	1	195171111	missense	possibly damaging	0.91
R6237:Cr2	UTSW	1	195157502	missense	probably damaging	1.00
R6299:Cr2	UTSW	1	195168646	missense	probably damaging	1.00
R6368:Cr2	UTSW	1	195168472	missense	probably damaging	1.00
R6406:Cr2	UTSW	1	195169771	missense	probably damaging	1.00
R6618:Cr2	UTSW	1	195157379	missense	probably damaging	0.98
R6684:Cr2	UTSW	1	195171021	nonsense	probably null
R6720:Cr2	UTSW	1	195155200	missense	probably damaging	0.97
R6866:Cr2	UTSW	1	195151691	missense	probably damaging	1.00
R6915:Cr2	UTSW	1	195171146	missense	probably benign	0.06
R7057:Cr2	UTSW	1	195151610	missense	possibly damaging	0.83
R7117:Cr2	UTSW	1	195160601	missense	possibly damaging	0.79
R7200:Cr2	UTSW	1	195163249	missense	probably damaging	1.00
R7209:Cr2	UTSW	1	195168724	missense	probably damaging	1.00
R7350:Cr2	UTSW	1	195155286	missense	probably benign	0.21
R7414:Cr2	UTSW	1	195150036	missense	probably benign
R7453:Cr2	UTSW	1	195165257	splice site	probably null
R7479:Cr2	UTSW	1	195158410	critical splice donor site	probably null
R7480:Cr2	UTSW	1	195154176	missense	probably damaging	1.00
R7570:Cr2	UTSW	1	195169340	nonsense	probably null
R7666:Cr2	UTSW	1	195154225	missense	probably damaging	1.00
R7921:Cr2	UTSW	1	195151667	missense	possibly damaging	0.94
R7923:Cr2	UTSW	1	195168687	missense	probably benign	0.03
R8396:Cr2	UTSW	1	195158068	missense	probably damaging	1.00
R8503:Cr2	UTSW	1	195163542	missense	probably benign
R8517:Cr2	UTSW	1	195155899	missense	probably benign	0.03
R8849:Cr2	UTSW	1	195157239	missense	probably damaging	1.00
R8896:Cr2	UTSW	1	195169273	missense	possibly damaging	0.58
R8938:Cr2	UTSW	1	195171116	missense	probably damaging	0.99
R9027:Cr2	UTSW	1	195151721	missense	probably benign	0.08
R9045:Cr2	UTSW	1	195155372	missense	possibly damaging	0.61
R9116:Cr2	UTSW	1	195158669	nonsense	probably null
R9137:Cr2	UTSW	1	195168332	critical splice donor site	probably null
R9476:Cr2	UTSW	1	195158108	missense	probably damaging	0.97
R9497:Cr2	UTSW	1	195168435	missense	probably damaging	0.99
R9510:Cr2	UTSW	1	195158108	missense	probably damaging	0.97
R9752:Cr2	UTSW	1	195141267	missense	probably benign	0.37
R9799:Cr2	UTSW	1	195160680	missense	probably benign	0.02
X0028:Cr2	UTSW	1	195149982	missense	probably benign	0.09
X0066:Cr2	UTSW	1	195166321	missense	probably damaging	0.99
Z1176:Cr2	UTSW	1	195154153	missense	probably benign	0.23

Predicted Primers

PCR Primer
(F):5'- CAGCTGTCCTAATAAACTGATTCTG -3'
(R):5'- GACAACTGCCATGCAAATGG -3'

Sequencing Primer
(F):5'- CTGATTCTGAGGCCTCTTAAAGAG -3'
(R):5'- CAACTGCCATGCAAATGGTATTATC -3'

Posted On

2021-03-08