Incidental Mutation 'R8773:Itga8'
ID 664517
Institutional Source Beutler Lab
Gene Symbol Itga8
Ensembl Gene ENSMUSG00000026768
Gene Name integrin alpha 8
Synonyms
MMRRC Submission 068627-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.870) question?
Stock # R8773 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 12111443-12306733 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to G at 12187495 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Alanine at position 728 (G728A)
Ref Sequence ENSEMBL: ENSMUSP00000028106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028106] [ENSMUST00000172791]
AlphaFold A2ARA8
Predicted Effect probably damaging
Transcript: ENSMUST00000028106
AA Change: G728A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028106
Gene: ENSMUSG00000026768
AA Change: G728A

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
Int_alpha 52 112 8.48e-8 SMART
Int_alpha 197 244 4.8e1 SMART
Int_alpha 262 312 5.91e-7 SMART
Int_alpha 316 377 6.94e-13 SMART
Int_alpha 381 437 1.92e-15 SMART
Int_alpha 445 494 8.23e-6 SMART
SCOP:d1m1xa2 643 780 2e-46 SMART
SCOP:d1m1xa3 784 1000 2e-80 SMART
transmembrane domain 1011 1033 N/A INTRINSIC
Pfam:Integrin_alpha 1034 1048 2.5e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172791
SMART Domains Protein: ENSMUSP00000134154
Gene: ENSMUSG00000026768

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
Int_alpha 52 112 8.48e-8 SMART
Int_alpha 197 244 4.8e1 SMART
Int_alpha 262 312 5.91e-7 SMART
Int_alpha 316 377 6.94e-13 SMART
Int_alpha 381 437 1.92e-15 SMART
Int_alpha 445 494 8.23e-6 SMART
Meta Mutation Damage Score 0.8466 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: This gene encodes a member of the integrin family of cell surface proteins that mediate cellular interactions with the extracellular matrix and other cells. The encoded protein undergoes proteolytic processing to generate the disulfide-linked heterodimeric alpha subunit which, in turn associates with a beta subunit to form the functional integrin receptor. Mice lacking the encoded protein mostly die after birth due to kidney defects, but some of animals that survive exhibit defects in the sensory hair cells of the inner ear. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die by the end of the second day after birth. Those that do survive have reduced kidneys and abnormal steriocilia in the inner ear. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A T 2: 151,314,062 (GRCm39) S539T possibly damaging Het
Abcc6 C T 7: 45,634,569 (GRCm39) R1136Q probably benign Het
Abhd12b A C 12: 70,213,708 (GRCm39) probably null Het
Agk T G 6: 40,334,050 (GRCm39) V98G possibly damaging Het
Apbb2 A G 5: 66,609,252 (GRCm39) S132P probably damaging Het
Apc2 T C 10: 80,142,046 (GRCm39) S322P probably damaging Het
Armc3 T C 2: 19,293,667 (GRCm39) V486A probably benign Het
Asxl2 A G 12: 3,507,200 (GRCm39) K131E probably damaging Het
Atp13a4 A G 16: 29,260,398 (GRCm39) V560A Het
Bnc1 C T 7: 81,623,719 (GRCm39) G503S probably damaging Het
Bsn C A 9: 107,987,704 (GRCm39) V2683F unknown Het
Btbd7 A T 12: 102,804,241 (GRCm39) N266K probably benign Het
Ccdc121rt2 T C 5: 112,597,681 (GRCm39) V76A probably benign Het
Cdca7l G A 12: 117,839,346 (GRCm39) D350N possibly damaging Het
Cfap251 A G 5: 123,411,913 (GRCm39) D515G probably benign Het
Ciao2a A T 9: 66,045,667 (GRCm39) N145I probably damaging Het
Col6a3 T A 1: 90,696,171 (GRCm39) D3239V unknown Het
Col9a1 T A 1: 24,224,208 (GRCm39) I130N unknown Het
Cr2 A G 1: 194,840,913 (GRCm39) W460R probably damaging Het
Cyb561d2 A G 9: 107,417,583 (GRCm39) F56S probably damaging Het
Dnaaf1 A G 8: 120,302,194 (GRCm39) I32V probably benign Het
Dnah11 T A 12: 117,958,950 (GRCm39) T2978S possibly damaging Het
Dsg2 T A 18: 20,716,056 (GRCm39) D302E probably damaging Het
Faf1 T A 4: 109,699,507 (GRCm39) F351I possibly damaging Het
Gimap8 C A 6: 48,633,545 (GRCm39) Q455K probably benign Het
Hps6 C G 19: 45,994,141 (GRCm39) R693G possibly damaging Het
Irx1 C T 13: 72,107,635 (GRCm39) G349D probably damaging Het
Lcat T C 8: 106,666,710 (GRCm39) T271A possibly damaging Het
Mapkapk2 T C 1: 130,983,679 (GRCm39) H308R probably damaging Het
Mast1 A T 8: 85,642,953 (GRCm39) N947K probably damaging Het
Mpeg1 A T 19: 12,440,419 (GRCm39) I626F probably damaging Het
Mrtfa T C 15: 80,902,274 (GRCm39) S349G possibly damaging Het
Myh15 T C 16: 49,015,900 (GRCm39) S1859P possibly damaging Het
Nlrx1 A T 9: 44,167,712 (GRCm39) D728E probably benign Het
Or1j8 A G 2: 36,192,387 (GRCm39) T279A probably benign Het
Or8c19-ps1 G T 9: 38,220,516 (GRCm39) V142F probably benign Het
Pcdhb18 A T 18: 37,624,562 (GRCm39) S631C probably damaging Het
Pcdhga11 C A 18: 37,890,364 (GRCm39) Y457* probably null Het
Pcdhga5 T C 18: 37,829,823 (GRCm39) I757T probably benign Het
Pcgf5 G A 19: 36,389,348 (GRCm39) probably benign Het
Pdf A G 8: 107,775,100 (GRCm39) V44A possibly damaging Het
Pip4p1 T C 14: 51,166,503 (GRCm39) T194A possibly damaging Het
Prtg A T 9: 72,819,583 (GRCm39) *1192L probably null Het
Ptk7 A G 17: 46,877,193 (GRCm39) F955S possibly damaging Het
Rbp3 C A 14: 33,684,492 (GRCm39) Q1174K possibly damaging Het
Rufy1 T C 11: 50,321,796 (GRCm39) D46G possibly damaging Het
Sbf2 A G 7: 109,948,202 (GRCm39) V1216A probably benign Het
Serpina11 A G 12: 103,952,722 (GRCm39) V18A unknown Het
Serpinb6a T A 13: 34,115,543 (GRCm39) N47I probably damaging Het
Shc2 T C 10: 79,456,924 (GRCm39) H564R probably damaging Het
Sirt7 T A 11: 120,514,888 (GRCm39) R115* probably null Het
Slc22a14 A T 9: 119,059,290 (GRCm39) probably benign Het
Stra8 T A 6: 34,912,581 (GRCm39) S331T probably damaging Het
Tm9sf2 A G 14: 122,380,883 (GRCm39) T324A probably benign Het
Tmem268 T C 4: 63,498,530 (GRCm39) S224P probably benign Het
Tns1 T C 1: 73,976,407 (GRCm39) D1147G probably damaging Het
Tomm22 C T 15: 79,555,311 (GRCm39) probably benign Het
Top1 A G 2: 160,556,158 (GRCm39) Y539C probably damaging Het
Tpp2 T A 1: 44,009,552 (GRCm39) probably benign Het
Trav3-1 T C 14: 52,818,428 (GRCm39) V34A probably damaging Het
Tspyl5 T C 15: 33,687,238 (GRCm39) N236D possibly damaging Het
Ttc41 A G 10: 86,565,679 (GRCm39) D411G probably benign Het
Vmn1r128 A T 7: 21,083,922 (GRCm39) M209L probably benign Het
Xirp2 T A 2: 67,355,527 (GRCm39) D3429E probably benign Het
Zfp418 A T 7: 7,185,797 (GRCm39) T587S probably benign Het
Other mutations in Itga8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00806:Itga8 APN 2 12,260,777 (GRCm39) nonsense probably null
IGL00820:Itga8 APN 2 12,237,703 (GRCm39) missense possibly damaging 0.85
IGL01409:Itga8 APN 2 12,196,525 (GRCm39) missense probably benign
IGL01508:Itga8 APN 2 12,237,613 (GRCm39) missense possibly damaging 0.67
IGL01585:Itga8 APN 2 12,165,123 (GRCm39) splice site probably benign
IGL01590:Itga8 APN 2 12,165,144 (GRCm39) missense probably damaging 1.00
IGL01743:Itga8 APN 2 12,270,144 (GRCm39) missense probably benign 0.04
IGL02634:Itga8 APN 2 12,145,289 (GRCm39) missense possibly damaging 0.55
IGL02805:Itga8 APN 2 12,194,291 (GRCm39) missense possibly damaging 0.83
IGL03200:Itga8 APN 2 12,196,010 (GRCm39) missense probably benign 0.00
IGL03218:Itga8 APN 2 12,115,836 (GRCm39) missense possibly damaging 0.77
IGL03248:Itga8 APN 2 12,137,327 (GRCm39) missense probably benign 0.20
PIT4576001:Itga8 UTSW 2 12,234,903 (GRCm39) missense probably benign 0.19
R0196:Itga8 UTSW 2 12,209,540 (GRCm39) critical splice donor site probably null
R0356:Itga8 UTSW 2 12,187,532 (GRCm39) missense possibly damaging 0.73
R0466:Itga8 UTSW 2 12,237,697 (GRCm39) missense probably damaging 1.00
R0530:Itga8 UTSW 2 12,196,627 (GRCm39) missense probably damaging 0.99
R0715:Itga8 UTSW 2 12,196,053 (GRCm39) splice site probably benign
R0800:Itga8 UTSW 2 12,198,362 (GRCm39) missense possibly damaging 0.95
R0881:Itga8 UTSW 2 12,267,003 (GRCm39) splice site probably null
R1675:Itga8 UTSW 2 12,204,974 (GRCm39) missense probably damaging 0.99
R1758:Itga8 UTSW 2 12,270,144 (GRCm39) missense possibly damaging 0.83
R1939:Itga8 UTSW 2 12,305,657 (GRCm39) missense probably damaging 1.00
R2187:Itga8 UTSW 2 12,199,231 (GRCm39) missense possibly damaging 0.60
R2295:Itga8 UTSW 2 12,187,520 (GRCm39) missense probably benign 0.38
R2356:Itga8 UTSW 2 12,204,952 (GRCm39) missense probably benign
R2371:Itga8 UTSW 2 12,258,277 (GRCm39) missense probably damaging 1.00
R2412:Itga8 UTSW 2 12,306,526 (GRCm39) missense probably benign
R2440:Itga8 UTSW 2 12,183,491 (GRCm39) missense possibly damaging 0.70
R2848:Itga8 UTSW 2 12,165,215 (GRCm39) missense probably damaging 0.98
R3730:Itga8 UTSW 2 12,198,321 (GRCm39) missense possibly damaging 0.92
R3933:Itga8 UTSW 2 12,194,330 (GRCm39) missense probably benign
R3982:Itga8 UTSW 2 12,305,774 (GRCm39) missense possibly damaging 0.92
R4513:Itga8 UTSW 2 12,187,547 (GRCm39) missense probably benign 0.01
R4514:Itga8 UTSW 2 12,187,547 (GRCm39) missense probably benign 0.01
R4660:Itga8 UTSW 2 12,270,069 (GRCm39) missense probably damaging 1.00
R4890:Itga8 UTSW 2 12,198,102 (GRCm39) splice site probably benign
R5533:Itga8 UTSW 2 12,165,161 (GRCm39) missense possibly damaging 0.90
R5619:Itga8 UTSW 2 12,270,139 (GRCm39) missense probably damaging 1.00
R5720:Itga8 UTSW 2 12,115,898 (GRCm39) missense probably damaging 0.99
R5749:Itga8 UTSW 2 12,266,889 (GRCm39) missense probably damaging 1.00
R5930:Itga8 UTSW 2 12,235,019 (GRCm39) missense possibly damaging 0.84
R5954:Itga8 UTSW 2 12,137,297 (GRCm39) missense probably damaging 0.99
R6035:Itga8 UTSW 2 12,196,525 (GRCm39) missense probably benign
R6035:Itga8 UTSW 2 12,196,525 (GRCm39) missense probably benign
R6211:Itga8 UTSW 2 12,198,320 (GRCm39) missense probably damaging 1.00
R6337:Itga8 UTSW 2 12,258,280 (GRCm39) nonsense probably null
R6442:Itga8 UTSW 2 12,234,954 (GRCm39) missense probably benign 0.00
R6491:Itga8 UTSW 2 12,209,587 (GRCm39) missense probably damaging 1.00
R6543:Itga8 UTSW 2 12,306,455 (GRCm39) missense probably damaging 0.99
R6574:Itga8 UTSW 2 12,234,972 (GRCm39) missense probably benign 0.17
R6760:Itga8 UTSW 2 12,306,451 (GRCm39) missense probably damaging 1.00
R6858:Itga8 UTSW 2 12,204,892 (GRCm39) missense probably benign 0.00
R6943:Itga8 UTSW 2 12,160,182 (GRCm39) critical splice donor site probably null
R7048:Itga8 UTSW 2 12,115,895 (GRCm39) missense probably damaging 0.99
R7203:Itga8 UTSW 2 12,234,906 (GRCm39) missense possibly damaging 0.77
R7266:Itga8 UTSW 2 12,237,712 (GRCm39) missense probably damaging 1.00
R7323:Itga8 UTSW 2 12,266,940 (GRCm39) missense probably damaging 1.00
R7540:Itga8 UTSW 2 12,115,848 (GRCm39) missense possibly damaging 0.82
R7637:Itga8 UTSW 2 12,113,998 (GRCm39) missense probably damaging 1.00
R7748:Itga8 UTSW 2 12,235,050 (GRCm39) missense possibly damaging 0.80
R7848:Itga8 UTSW 2 12,196,548 (GRCm39) missense probably damaging 0.99
R8031:Itga8 UTSW 2 12,160,297 (GRCm39) missense probably benign
R8077:Itga8 UTSW 2 12,247,244 (GRCm39) missense probably benign 0.09
R8757:Itga8 UTSW 2 12,266,940 (GRCm39) missense probably damaging 1.00
R8759:Itga8 UTSW 2 12,266,940 (GRCm39) missense probably damaging 1.00
R8772:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8774:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8774-TAIL:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8775:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8775-TAIL:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8808:Itga8 UTSW 2 12,137,328 (GRCm39) nonsense probably null
R8898:Itga8 UTSW 2 12,145,206 (GRCm39) missense probably benign 0.05
R8962:Itga8 UTSW 2 12,196,045 (GRCm39) missense possibly damaging 0.94
R9056:Itga8 UTSW 2 12,235,019 (GRCm39) missense possibly damaging 0.84
R9155:Itga8 UTSW 2 12,194,330 (GRCm39) missense probably benign
R9354:Itga8 UTSW 2 12,237,668 (GRCm39) missense possibly damaging 0.94
R9563:Itga8 UTSW 2 12,165,219 (GRCm39) missense possibly damaging 0.83
R9589:Itga8 UTSW 2 12,237,701 (GRCm39) missense probably damaging 1.00
R9663:Itga8 UTSW 2 12,196,580 (GRCm39) missense probably benign 0.00
Z1176:Itga8 UTSW 2 12,306,643 (GRCm39) start gained probably benign
Z1176:Itga8 UTSW 2 12,266,947 (GRCm39) missense probably benign 0.01
Z1176:Itga8 UTSW 2 12,252,329 (GRCm39) missense probably damaging 1.00
Z1177:Itga8 UTSW 2 12,305,744 (GRCm39) missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GCCAAGATCAGTTTGTGTATCTG -3'
(R):5'- CCCGCACAGGTGTTTGAAATC -3'

Sequencing Primer
(F):5'- TCACCCCATGGAGGTTAAAATG -3'
(R):5'- TTTGAAATCAAGGGGAGCGCTC -3'
Posted On 2021-03-08