Incidental Mutation 'R8773:Armc3'
ID 664518
Institutional Source Beutler Lab
Gene Symbol Armc3
Ensembl Gene ENSMUSG00000037683
Gene Name armadillo repeat containing 3
Synonyms 4921513G22Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_001081083.2, NM_001271563.1, NM_001271564.1, NM_001271565.1; MGI:1918132

Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock # R8773 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 19199302-19310241 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 19288856 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 486 (V486A)
Ref Sequence ENSEMBL: ENSMUSP00000110287 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049255] [ENSMUST00000114640]
AlphaFold A2AU72
Predicted Effect probably benign
Transcript: ENSMUST00000049255
AA Change: V486A

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000048784
Gene: ENSMUSG00000037683
AA Change: V486A

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
ARM 56 96 2.07e-2 SMART
ARM 97 138 9.84e1 SMART
ARM 139 179 7.86e-3 SMART
ARM 180 220 7.63e0 SMART
ARM 221 262 7.76e1 SMART
low complexity region 293 303 N/A INTRINSIC
ARM 305 345 3.91e1 SMART
ARM 346 385 2.93e-2 SMART
ARM 387 427 7.74e-2 SMART
Blast:ARM 428 468 3e-11 BLAST
ARM 469 509 1.45e-1 SMART
low complexity region 544 557 N/A INTRINSIC
low complexity region 583 595 N/A INTRINSIC
low complexity region 620 639 N/A INTRINSIC
low complexity region 675 696 N/A INTRINSIC
Pfam:EDR1 723 857 3.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114640
AA Change: V486A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000110287
Gene: ENSMUSG00000037683
AA Change: V486A

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
ARM 56 96 2.07e-2 SMART
ARM 97 138 9.84e1 SMART
ARM 139 179 7.86e-3 SMART
ARM 180 220 7.63e0 SMART
ARM 221 262 7.76e1 SMART
low complexity region 293 303 N/A INTRINSIC
ARM 305 345 3.91e1 SMART
ARM 346 385 2.93e-2 SMART
ARM 387 427 7.74e-2 SMART
Blast:ARM 428 468 3e-11 BLAST
ARM 469 509 1.45e-1 SMART
Pfam:EDR1 549 868 1.4e-41 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Armadillo/beta-catenin (CTNNB1; MIM 116806)-like (ARM) domains are imperfect 45-amino acid repeats involved in protein-protein interactions. ARM domain-containing proteins, such as ARMC3, function in signal transduction, development, cell adhesion and mobility, and tumor initiation and metastasis (Li et al., 2006 [PubMed 16915934]).[supplied by OMIM, Mar 2008]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A T 2: 151,472,142 S539T possibly damaging Het
Abcc6 C T 7: 45,985,145 R1136Q probably benign Het
Abhd12b A C 12: 70,166,934 probably null Het
Agk T G 6: 40,357,116 V98G possibly damaging Het
Apbb2 A G 5: 66,451,909 S132P probably damaging Het
Apc2 T C 10: 80,306,212 S322P probably damaging Het
Asxl2 A G 12: 3,457,200 K131E probably damaging Het
Atp13a4 A G 16: 29,441,580 V560A Het
Bnc1 C T 7: 81,973,971 G503S probably damaging Het
Bsn C A 9: 108,110,505 V2683F unknown Het
Btbd7 A T 12: 102,837,982 N266K probably benign Het
Cdca7l G A 12: 117,875,611 D350N possibly damaging Het
Col6a3 T A 1: 90,768,449 D3239V unknown Het
Col9a1 T A 1: 24,185,127 I130N unknown Het
Cr2 A G 1: 195,158,605 W460R probably damaging Het
Cyb561d2 A G 9: 107,540,384 F56S probably damaging Het
Dnaaf1 A G 8: 119,575,455 I32V probably benign Het
Dnah11 T A 12: 117,995,215 T2978S possibly damaging Het
Dsg2 T A 18: 20,582,999 D302E probably damaging Het
Faf1 T A 4: 109,842,310 F351I possibly damaging Het
Fam96a A T 9: 66,138,385 N145I probably damaging Het
Gimap8 C A 6: 48,656,611 Q455K probably benign Het
Gm6588 T C 5: 112,449,815 V76A probably benign Het
Hps6 C G 19: 46,005,702 R693G possibly damaging Het
Irx1 C T 13: 71,959,516 G349D probably damaging Het
Itga8 C G 2: 12,182,684 G728A probably damaging Het
Lcat T C 8: 105,940,078 T271A possibly damaging Het
Mapkapk2 T C 1: 131,055,942 H308R probably damaging Het
Mast1 A T 8: 84,916,324 N947K probably damaging Het
Mkl1 T C 15: 81,018,073 S349G possibly damaging Het
Mpeg1 A T 19: 12,463,055 I626F probably damaging Het
Myh15 T C 16: 49,195,537 S1859P possibly damaging Het
Nlrx1 A T 9: 44,256,415 D728E probably benign Het
Olfr335-ps A G 2: 36,302,375 T279A probably benign Het
Olfr897-ps1 G T 9: 38,309,220 V142F probably benign Het
Pcdhb18 A T 18: 37,491,509 S631C probably damaging Het
Pcdhga11 C A 18: 37,757,311 Y457* probably null Het
Pcdhga5 T C 18: 37,696,770 I757T probably benign Het
Pcgf5 G A 19: 36,411,948 probably benign Het
Pdf A G 8: 107,048,468 V44A possibly damaging Het
Prtg A T 9: 72,912,301 *1192L probably null Het
Ptk7 A G 17: 46,566,267 F955S possibly damaging Het
Rbp3 C A 14: 33,962,535 Q1174K possibly damaging Het
Rufy1 T C 11: 50,430,969 D46G possibly damaging Het
Sbf2 A G 7: 110,348,995 V1216A probably benign Het
Serpina11 A G 12: 103,986,463 V18A unknown Het
Serpinb6a T A 13: 33,931,560 N47I probably damaging Het
Shc2 T C 10: 79,621,090 H564R probably damaging Het
Sirt7 T A 11: 120,624,062 R115* probably null Het
Slc22a14 A T 9: 119,230,224 probably benign Het
Stra8 T A 6: 34,935,646 S331T probably damaging Het
Tm9sf2 A G 14: 122,143,471 T324A probably benign Het
Tmem268 T C 4: 63,580,293 S224P probably benign Het
Tmem55b T C 14: 50,929,046 T194A possibly damaging Het
Tns1 T C 1: 73,937,248 D1147G probably damaging Het
Tomm22 C T 15: 79,671,110 probably benign Het
Top1 A G 2: 160,714,238 Y539C probably damaging Het
Tpp2 T A 1: 43,970,392 probably benign Het
Trav3-1 T C 14: 52,580,971 V34A probably damaging Het
Tspyl5 T C 15: 33,687,092 N236D possibly damaging Het
Ttc41 A G 10: 86,729,815 D411G probably benign Het
Vmn1r128 A T 7: 21,349,997 M209L probably benign Het
Wdr66 A G 5: 123,273,850 D515G probably benign Het
Xirp2 T A 2: 67,525,183 D3429E probably benign Het
Zfp418 A T 7: 7,182,798 T587S probably benign Het
Other mutations in Armc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00535:Armc3 APN 2 19303858 missense possibly damaging 0.48
IGL01123:Armc3 APN 2 19201805 missense possibly damaging 0.87
IGL01142:Armc3 APN 2 19297898 splice site probably benign
IGL01556:Armc3 APN 2 19269146 missense probably damaging 1.00
IGL02145:Armc3 APN 2 19296860 missense possibly damaging 0.81
IGL02145:Armc3 APN 2 19286137 critical splice donor site probably null
IGL02152:Armc3 APN 2 19286137 critical splice donor site probably null
IGL02154:Armc3 APN 2 19286137 critical splice donor site probably null
IGL02243:Armc3 APN 2 19286137 critical splice donor site probably null
IGL02244:Armc3 APN 2 19286137 critical splice donor site probably null
IGL02516:Armc3 APN 2 19300506 missense possibly damaging 0.94
IGL02691:Armc3 APN 2 19235484 missense probably damaging 1.00
IGL03151:Armc3 APN 2 19238698 missense probably damaging 1.00
IGL03190:Armc3 APN 2 19288950 missense probably damaging 0.99
IGL03288:Armc3 APN 2 19235482 missense probably damaging 1.00
IGL03338:Armc3 APN 2 19248701 missense possibly damaging 0.88
R0015:Armc3 UTSW 2 19296321 critical splice acceptor site probably null
R0015:Armc3 UTSW 2 19296321 critical splice acceptor site probably null
R0256:Armc3 UTSW 2 19269216 missense probably damaging 1.00
R0621:Armc3 UTSW 2 19295393 missense probably damaging 0.96
R1326:Armc3 UTSW 2 19310124 makesense probably null
R1470:Armc3 UTSW 2 19238736 missense probably benign
R1470:Armc3 UTSW 2 19238736 missense probably benign
R1489:Armc3 UTSW 2 19310047 missense probably benign 0.01
R1990:Armc3 UTSW 2 19293142 missense probably damaging 0.97
R1991:Armc3 UTSW 2 19293142 missense probably damaging 0.97
R1992:Armc3 UTSW 2 19293142 missense probably damaging 0.97
R2002:Armc3 UTSW 2 19288936 missense probably benign 0.01
R2095:Armc3 UTSW 2 19288929 missense possibly damaging 0.65
R2127:Armc3 UTSW 2 19201811 missense probably damaging 1.00
R2158:Armc3 UTSW 2 19248633 missense probably damaging 0.99
R2697:Armc3 UTSW 2 19303935 missense probably damaging 1.00
R3809:Armc3 UTSW 2 19300665 missense probably damaging 1.00
R3897:Armc3 UTSW 2 19269177 missense probably damaging 1.00
R4107:Armc3 UTSW 2 19288909 missense probably benign 0.13
R4326:Armc3 UTSW 2 19300473 missense probably damaging 0.97
R4464:Armc3 UTSW 2 19248659 missense probably damaging 0.99
R4702:Armc3 UTSW 2 19309981 missense probably damaging 1.00
R4923:Armc3 UTSW 2 19292980 critical splice acceptor site probably null
R5370:Armc3 UTSW 2 19286062 missense probably benign 0.00
R5518:Armc3 UTSW 2 19297928 missense probably benign 0.28
R5718:Armc3 UTSW 2 19303799 nonsense probably null
R5739:Armc3 UTSW 2 19253917 missense possibly damaging 0.67
R5913:Armc3 UTSW 2 19310047 missense possibly damaging 0.65
R6211:Armc3 UTSW 2 19296803 critical splice acceptor site probably null
R6245:Armc3 UTSW 2 19248705 missense probably damaging 1.00
R6841:Armc3 UTSW 2 19201819 splice site probably null
R7003:Armc3 UTSW 2 19270028 missense probably damaging 1.00
R7190:Armc3 UTSW 2 19293136 missense probably damaging 1.00
R7499:Armc3 UTSW 2 19285979 missense probably benign 0.03
R7738:Armc3 UTSW 2 19288950 missense probably damaging 0.99
R7844:Armc3 UTSW 2 19254018 missense possibly damaging 0.90
R7919:Armc3 UTSW 2 19286095 missense probably benign 0.00
R8060:Armc3 UTSW 2 19288909 missense probably benign 0.08
R8111:Armc3 UTSW 2 19296863 missense probably benign
R8406:Armc3 UTSW 2 19235554 missense probably damaging 0.98
R8485:Armc3 UTSW 2 19293134 missense probably damaging 1.00
R8940:Armc3 UTSW 2 19235582 missense probably damaging 1.00
R9441:Armc3 UTSW 2 19248615 missense possibly damaging 0.89
Z1177:Armc3 UTSW 2 19285991 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTGGCACATTCGAAAACAGTTG -3'
(R):5'- GTGCTCCTTCGACCTAAAAGG -3'

Sequencing Primer
(F):5'- ACCCAGGATTCTATGTATGTCAGGC -3'
(R):5'- TAACTCAACTGCCATCGG -3'
Posted On 2021-03-08