Incidental Mutation 'R8773:4921509C19Rik'
ID 664521
Institutional Source Beutler Lab
Gene Symbol 4921509C19Rik
Ensembl Gene ENSMUSG00000061525
Gene Name RIKEN cDNA 4921509C19 gene
Synonyms LOC381389
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8773 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 151470542-151476153 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 151472142 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 539 (S539T)
Ref Sequence ENSEMBL: ENSMUSP00000079030 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080132]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000080132
AA Change: S539T

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000079030
Gene: ENSMUSG00000061525
AA Change: S539T

DomainStartEndE-ValueType
S_TKc 24 271 2.18e-97 SMART
low complexity region 430 447 N/A INTRINSIC
low complexity region 470 481 N/A INTRINSIC
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (63/64)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 C T 7: 45,985,145 R1136Q probably benign Het
Abhd12b A C 12: 70,166,934 probably null Het
Agk T G 6: 40,357,116 V98G possibly damaging Het
Apbb2 A G 5: 66,451,909 S132P probably damaging Het
Apc2 T C 10: 80,306,212 S322P probably damaging Het
Armc3 T C 2: 19,288,856 V486A probably benign Het
Asxl2 A G 12: 3,457,200 K131E probably damaging Het
Atp13a4 A G 16: 29,441,580 V560A Het
Bnc1 C T 7: 81,973,971 G503S probably damaging Het
Bsn C A 9: 108,110,505 V2683F unknown Het
Btbd7 A T 12: 102,837,982 N266K probably benign Het
Cdca7l G A 12: 117,875,611 D350N possibly damaging Het
Col6a3 T A 1: 90,768,449 D3239V unknown Het
Col9a1 T A 1: 24,185,127 I130N unknown Het
Cr2 A G 1: 195,158,605 W460R probably damaging Het
Cyb561d2 A G 9: 107,540,384 F56S probably damaging Het
Dnaaf1 A G 8: 119,575,455 I32V probably benign Het
Dnah11 T A 12: 117,995,215 T2978S possibly damaging Het
Dsg2 T A 18: 20,582,999 D302E probably damaging Het
Faf1 T A 4: 109,842,310 F351I possibly damaging Het
Fam96a A T 9: 66,138,385 N145I probably damaging Het
Gimap8 C A 6: 48,656,611 Q455K probably benign Het
Gm6588 T C 5: 112,449,815 V76A probably benign Het
Hps6 C G 19: 46,005,702 R693G possibly damaging Het
Irx1 C T 13: 71,959,516 G349D probably damaging Het
Itga8 C G 2: 12,182,684 G728A probably damaging Het
Lcat T C 8: 105,940,078 T271A possibly damaging Het
Mapkapk2 T C 1: 131,055,942 H308R probably damaging Het
Mast1 A T 8: 84,916,324 N947K probably damaging Het
Mkl1 T C 15: 81,018,073 S349G possibly damaging Het
Mpeg1 A T 19: 12,463,055 I626F probably damaging Het
Myh15 T C 16: 49,195,537 S1859P possibly damaging Het
Nlrx1 A T 9: 44,256,415 D728E probably benign Het
Olfr335-ps A G 2: 36,302,375 T279A probably benign Het
Olfr897-ps1 G T 9: 38,309,220 V142F probably benign Het
Pcdhb18 A T 18: 37,491,509 S631C probably damaging Het
Pcdhga11 C A 18: 37,757,311 Y457* probably null Het
Pcdhga5 T C 18: 37,696,770 I757T probably benign Het
Pcgf5 G A 19: 36,411,948 probably benign Het
Pdf A G 8: 107,048,468 V44A possibly damaging Het
Prtg A T 9: 72,912,301 *1192L probably null Het
Ptk7 A G 17: 46,566,267 F955S possibly damaging Het
Rbp3 C A 14: 33,962,535 Q1174K possibly damaging Het
Rufy1 T C 11: 50,430,969 D46G possibly damaging Het
Sbf2 A G 7: 110,348,995 V1216A probably benign Het
Serpina11 A G 12: 103,986,463 V18A unknown Het
Serpinb6a T A 13: 33,931,560 N47I probably damaging Het
Shc2 T C 10: 79,621,090 H564R probably damaging Het
Sirt7 T A 11: 120,624,062 R115* probably null Het
Slc22a14 A T 9: 119,230,224 probably benign Het
Stra8 T A 6: 34,935,646 S331T probably damaging Het
Tm9sf2 A G 14: 122,143,471 T324A probably benign Het
Tmem268 T C 4: 63,580,293 S224P probably benign Het
Tmem55b T C 14: 50,929,046 T194A possibly damaging Het
Tns1 T C 1: 73,937,248 D1147G probably damaging Het
Tomm22 C T 15: 79,671,110 probably benign Het
Top1 A G 2: 160,714,238 Y539C probably damaging Het
Tpp2 T A 1: 43,970,392 probably benign Het
Trav3-1 T C 14: 52,580,971 V34A probably damaging Het
Tspyl5 T C 15: 33,687,092 N236D possibly damaging Het
Ttc41 A G 10: 86,729,815 D411G probably benign Het
Vmn1r128 A T 7: 21,349,997 M209L probably benign Het
Wdr66 A G 5: 123,273,850 D515G probably benign Het
Xirp2 T A 2: 67,525,183 D3429E probably benign Het
Zfp418 A T 7: 7,182,798 T587S probably benign Het
Other mutations in 4921509C19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:4921509C19Rik APN 2 151473533 missense possibly damaging 0.46
IGL02117:4921509C19Rik APN 2 151473546 missense probably benign 0.10
IGL02432:4921509C19Rik APN 2 151472561 missense probably benign 0.18
IGL03025:4921509C19Rik APN 2 151473485 missense possibly damaging 0.82
R0321:4921509C19Rik UTSW 2 151472700 missense probably benign 0.01
R0961:4921509C19Rik UTSW 2 151472766 missense probably benign 0.01
R1272:4921509C19Rik UTSW 2 151472057 missense probably damaging 0.98
R1455:4921509C19Rik UTSW 2 151472904 missense possibly damaging 0.46
R3177:4921509C19Rik UTSW 2 151472100 missense possibly damaging 0.65
R3277:4921509C19Rik UTSW 2 151472100 missense possibly damaging 0.65
R4206:4921509C19Rik UTSW 2 151473515 missense probably benign 0.44
R4655:4921509C19Rik UTSW 2 151472858 missense probably benign 0.03
R4680:4921509C19Rik UTSW 2 151473470 missense probably damaging 1.00
R4684:4921509C19Rik UTSW 2 151471871 missense unknown
R4702:4921509C19Rik UTSW 2 151472589 missense probably benign 0.00
R4867:4921509C19Rik UTSW 2 151472822 nonsense probably null
R4962:4921509C19Rik UTSW 2 151472808 missense possibly damaging 0.78
R5117:4921509C19Rik UTSW 2 151472540 missense probably benign 0.00
R5484:4921509C19Rik UTSW 2 151471931 missense probably benign
R5602:4921509C19Rik UTSW 2 151473539 missense possibly damaging 0.83
R6374:4921509C19Rik UTSW 2 151472880 missense possibly damaging 0.47
R6894:4921509C19Rik UTSW 2 151473307 missense probably damaging 1.00
R7079:4921509C19Rik UTSW 2 151473278 missense probably damaging 1.00
R7109:4921509C19Rik UTSW 2 151473753 missense probably damaging 1.00
R7155:4921509C19Rik UTSW 2 151473569 missense possibly damaging 0.69
R7441:4921509C19Rik UTSW 2 151472925 missense possibly damaging 0.51
R7845:4921509C19Rik UTSW 2 151472309 missense probably damaging 0.96
R7853:4921509C19Rik UTSW 2 151473680 missense probably damaging 1.00
R8805:4921509C19Rik UTSW 2 151471365 splice site probably benign
R8983:4921509C19Rik UTSW 2 151471352 missense unknown
R9257:4921509C19Rik UTSW 2 151473707 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ACTCTCCTTTCGATTGGCAGG -3'
(R):5'- CAAGGGGTCTTCACAGTGTG -3'

Sequencing Primer
(F):5'- CATAAAGTTCGCAGGCCTCTG -3'
(R):5'- GGGTCTTCACAGTGTGTTTCTTCTC -3'
Posted On 2021-03-08