Incidental Mutation 'R8773:Ttc41'
ID 664548
Institutional Source Beutler Lab
Gene Symbol Ttc41
Ensembl Gene ENSMUSG00000044937
Gene Name tetratricopeptide repeat domain 41
Synonyms Gnn, BC030307
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock # R8773 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 86705811-86776844 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 86729815 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 411 (D411G)
Ref Sequence ENSEMBL: ENSMUSP00000075059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075632] [ENSMUST00000219108]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000075632
AA Change: D411G

PolyPhen 2 Score 0.349 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000075059
Gene: ENSMUSG00000044937
AA Change: D411G

DomainStartEndE-ValueType
low complexity region 216 229 N/A INTRINSIC
low complexity region 307 315 N/A INTRINSIC
Pfam:NACHT 337 515 5.4e-10 PFAM
SCOP:d1qqea_ 805 1028 2e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000219108
AA Change: D411G

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (63/64)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A T 2: 151,472,142 S539T possibly damaging Het
Abcc6 C T 7: 45,985,145 R1136Q probably benign Het
Abhd12b A C 12: 70,166,934 probably null Het
Agk T G 6: 40,357,116 V98G possibly damaging Het
Apbb2 A G 5: 66,451,909 S132P probably damaging Het
Apc2 T C 10: 80,306,212 S322P probably damaging Het
Armc3 T C 2: 19,288,856 V486A probably benign Het
Asxl2 A G 12: 3,457,200 K131E probably damaging Het
Atp13a4 A G 16: 29,441,580 V560A Het
Bnc1 C T 7: 81,973,971 G503S probably damaging Het
Bsn C A 9: 108,110,505 V2683F unknown Het
Btbd7 A T 12: 102,837,982 N266K probably benign Het
Cdca7l G A 12: 117,875,611 D350N possibly damaging Het
Col6a3 T A 1: 90,768,449 D3239V unknown Het
Col9a1 T A 1: 24,185,127 I130N unknown Het
Cr2 A G 1: 195,158,605 W460R probably damaging Het
Cyb561d2 A G 9: 107,540,384 F56S probably damaging Het
Dnaaf1 A G 8: 119,575,455 I32V probably benign Het
Dnah11 T A 12: 117,995,215 T2978S possibly damaging Het
Dsg2 T A 18: 20,582,999 D302E probably damaging Het
Faf1 T A 4: 109,842,310 F351I possibly damaging Het
Fam96a A T 9: 66,138,385 N145I probably damaging Het
Gimap8 C A 6: 48,656,611 Q455K probably benign Het
Gm6588 T C 5: 112,449,815 V76A probably benign Het
Hps6 C G 19: 46,005,702 R693G possibly damaging Het
Irx1 C T 13: 71,959,516 G349D probably damaging Het
Itga8 C G 2: 12,182,684 G728A probably damaging Het
Lcat T C 8: 105,940,078 T271A possibly damaging Het
Mapkapk2 T C 1: 131,055,942 H308R probably damaging Het
Mast1 A T 8: 84,916,324 N947K probably damaging Het
Mkl1 T C 15: 81,018,073 S349G possibly damaging Het
Mpeg1 A T 19: 12,463,055 I626F probably damaging Het
Myh15 T C 16: 49,195,537 S1859P possibly damaging Het
Nlrx1 A T 9: 44,256,415 D728E probably benign Het
Olfr335-ps A G 2: 36,302,375 T279A probably benign Het
Olfr897-ps1 G T 9: 38,309,220 V142F probably benign Het
Pcdhb18 A T 18: 37,491,509 S631C probably damaging Het
Pcdhga11 C A 18: 37,757,311 Y457* probably null Het
Pcdhga5 T C 18: 37,696,770 I757T probably benign Het
Pcgf5 G A 19: 36,411,948 probably benign Het
Pdf A G 8: 107,048,468 V44A possibly damaging Het
Prtg A T 9: 72,912,301 *1192L probably null Het
Ptk7 A G 17: 46,566,267 F955S possibly damaging Het
Rbp3 C A 14: 33,962,535 Q1174K possibly damaging Het
Rufy1 T C 11: 50,430,969 D46G possibly damaging Het
Sbf2 A G 7: 110,348,995 V1216A probably benign Het
Serpina11 A G 12: 103,986,463 V18A unknown Het
Serpinb6a T A 13: 33,931,560 N47I probably damaging Het
Shc2 T C 10: 79,621,090 H564R probably damaging Het
Sirt7 T A 11: 120,624,062 R115* probably null Het
Slc22a14 A T 9: 119,230,224 probably benign Het
Stra8 T A 6: 34,935,646 S331T probably damaging Het
Tm9sf2 A G 14: 122,143,471 T324A probably benign Het
Tmem268 T C 4: 63,580,293 S224P probably benign Het
Tmem55b T C 14: 50,929,046 T194A possibly damaging Het
Tns1 T C 1: 73,937,248 D1147G probably damaging Het
Tomm22 C T 15: 79,671,110 probably benign Het
Top1 A G 2: 160,714,238 Y539C probably damaging Het
Tpp2 T A 1: 43,970,392 probably benign Het
Trav3-1 T C 14: 52,580,971 V34A probably damaging Het
Tspyl5 T C 15: 33,687,092 N236D possibly damaging Het
Vmn1r128 A T 7: 21,349,997 M209L probably benign Het
Wdr66 A G 5: 123,273,850 D515G probably benign Het
Xirp2 T A 2: 67,525,183 D3429E probably benign Het
Zfp418 A T 7: 7,182,798 T587S probably benign Het
Other mutations in Ttc41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Ttc41 APN 10 86736933 missense possibly damaging 0.71
IGL01373:Ttc41 APN 10 86775957 missense possibly damaging 0.61
IGL01636:Ttc41 APN 10 86776678 missense probably benign
IGL01707:Ttc41 APN 10 86776767 missense probably damaging 1.00
IGL01814:Ttc41 APN 10 86731026 missense probably damaging 0.98
IGL01845:Ttc41 APN 10 86776624 missense probably benign 0.03
IGL01918:Ttc41 APN 10 86713190 missense probably damaging 1.00
IGL02374:Ttc41 APN 10 86775951 missense probably damaging 1.00
IGL02489:Ttc41 APN 10 86760914 nonsense probably null
IGL02887:Ttc41 APN 10 86733654 missense probably damaging 1.00
IGL03061:Ttc41 APN 10 86736857 missense possibly damaging 0.65
IGL03077:Ttc41 APN 10 86758348 missense probably damaging 1.00
IGL03210:Ttc41 APN 10 86724414 critical splice donor site probably null
IGL03242:Ttc41 APN 10 86776819 makesense probably null
IGL03307:Ttc41 APN 10 86744440 missense possibly damaging 0.76
BB003:Ttc41 UTSW 10 86776047 missense probably benign 0.10
BB013:Ttc41 UTSW 10 86776047 missense probably benign 0.10
R0071:Ttc41 UTSW 10 86736846 missense probably benign 0.01
R0071:Ttc41 UTSW 10 86736846 missense probably benign 0.01
R0379:Ttc41 UTSW 10 86712977 missense possibly damaging 0.65
R0384:Ttc41 UTSW 10 86763947 missense probably damaging 1.00
R0545:Ttc41 UTSW 10 86759097 missense probably benign 0.00
R1589:Ttc41 UTSW 10 86776390 missense probably benign 0.01
R1599:Ttc41 UTSW 10 86776573 missense probably benign 0.04
R1608:Ttc41 UTSW 10 86775993 missense probably damaging 1.00
R1670:Ttc41 UTSW 10 86776252 missense possibly damaging 0.93
R1938:Ttc41 UTSW 10 86776214 missense probably benign
R2398:Ttc41 UTSW 10 86713386 missense possibly damaging 0.91
R2401:Ttc41 UTSW 10 86724374 missense probably benign 0.42
R3117:Ttc41 UTSW 10 86724320 missense possibly damaging 0.62
R3119:Ttc41 UTSW 10 86724320 missense possibly damaging 0.62
R4805:Ttc41 UTSW 10 86729798 missense possibly damaging 0.62
R4840:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4841:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4842:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4884:Ttc41 UTSW 10 86731018 missense probably benign 0.00
R4885:Ttc41 UTSW 10 86759102 missense possibly damaging 0.76
R4898:Ttc41 UTSW 10 86776192 missense possibly damaging 0.80
R5067:Ttc41 UTSW 10 86744544 missense probably damaging 0.96
R5253:Ttc41 UTSW 10 86730942 missense probably benign 0.13
R5268:Ttc41 UTSW 10 86744478 missense possibly damaging 0.76
R5297:Ttc41 UTSW 10 86776579 missense probably benign 0.04
R5301:Ttc41 UTSW 10 86719520 missense probably benign 0.00
R5425:Ttc41 UTSW 10 86776630 missense probably damaging 0.96
R5567:Ttc41 UTSW 10 86760920 critical splice donor site probably null
R5635:Ttc41 UTSW 10 86736977 missense probably benign 0.09
R5752:Ttc41 UTSW 10 86758346 missense probably benign 0.33
R5868:Ttc41 UTSW 10 86750264 missense possibly damaging 0.70
R5948:Ttc41 UTSW 10 86713224 missense probably damaging 1.00
R6116:Ttc41 UTSW 10 86759088 critical splice acceptor site probably null
R6247:Ttc41 UTSW 10 86776663 missense probably benign 0.00
R6260:Ttc41 UTSW 10 86731159 missense probably benign 0.20
R6260:Ttc41 UTSW 10 86733707 missense probably benign 0.32
R6276:Ttc41 UTSW 10 86744449 missense probably benign 0.01
R6458:Ttc41 UTSW 10 86758270 missense possibly damaging 0.45
R7170:Ttc41 UTSW 10 86713503 missense probably benign 0.17
R7348:Ttc41 UTSW 10 86750348 nonsense probably null
R7382:Ttc41 UTSW 10 86776510 missense probably damaging 0.97
R7509:Ttc41 UTSW 10 86713432 missense probably damaging 1.00
R7689:Ttc41 UTSW 10 86759224 missense probably damaging 1.00
R7807:Ttc41 UTSW 10 86776631 missense probably benign 0.02
R7926:Ttc41 UTSW 10 86776047 missense probably benign 0.10
R7998:Ttc41 UTSW 10 86736847 missense probably benign 0.01
R8021:Ttc41 UTSW 10 86733714 missense probably benign
R8059:Ttc41 UTSW 10 86712978 missense probably benign 0.01
R8170:Ttc41 UTSW 10 86776166 missense probably damaging 1.00
R8303:Ttc41 UTSW 10 86719630 missense probably benign 0.06
R8375:Ttc41 UTSW 10 86763980 missense probably damaging 0.97
R8383:Ttc41 UTSW 10 86719526 missense probably benign 0.00
R8698:Ttc41 UTSW 10 86712977 missense probably benign 0.00
R8902:Ttc41 UTSW 10 86713001 missense probably benign 0.06
R8985:Ttc41 UTSW 10 86731092 missense possibly damaging 0.80
R8988:Ttc41 UTSW 10 86713735 missense possibly damaging 0.88
R9007:Ttc41 UTSW 10 86733761 missense probably damaging 1.00
R9137:Ttc41 UTSW 10 86776622 missense probably benign 0.22
R9236:Ttc41 UTSW 10 86776730 missense probably damaging 1.00
R9248:Ttc41 UTSW 10 86731249 missense probably benign 0.00
R9287:Ttc41 UTSW 10 86763966 missense probably benign 0.43
R9345:Ttc41 UTSW 10 86759225 missense probably damaging 0.99
R9386:Ttc41 UTSW 10 86713026 missense probably damaging 0.99
X0024:Ttc41 UTSW 10 86724250 missense probably damaging 1.00
X0064:Ttc41 UTSW 10 86729797 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATAGCACCACTACTTTGGGCC -3'
(R):5'- CCCTAAGTAATGGGGTCTTCTCC -3'

Sequencing Primer
(F):5'- CCTGAATGTCTTGAGGAAGCC -3'
(R):5'- GTCTAGTACCAGGATGCA -3'
Posted On 2021-03-08