Incidental Mutation 'R8773:Btbd7'
ID 664553
Institutional Source Beutler Lab
Gene Symbol Btbd7
Ensembl Gene ENSMUSG00000041702
Gene Name BTB (POZ) domain containing 7
Synonyms FUP1, E130118E17Rik, 5730507E09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.429) question?
Stock # R8773 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 102780797-102878471 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 102837982 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 266 (N266K)
Ref Sequence ENSEMBL: ENSMUSP00000046951 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045652] [ENSMUST00000223554]
AlphaFold Q8CFE5
Predicted Effect probably benign
Transcript: ENSMUST00000045652
AA Change: N266K

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000046951
Gene: ENSMUSG00000041702
AA Change: N266K

DomainStartEndE-ValueType
BTB 142 244 1.57e-13 SMART
BTB 247 397 2.23e-4 SMART
BACK 402 538 1.49e-4 SMART
low complexity region 626 640 N/A INTRINSIC
low complexity region 756 771 N/A INTRINSIC
low complexity region 783 792 N/A INTRINSIC
low complexity region 808 822 N/A INTRINSIC
low complexity region 839 850 N/A INTRINSIC
low complexity region 1076 1088 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223554
AA Change: N266K

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (63/64)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A T 2: 151,472,142 S539T possibly damaging Het
Abcc6 C T 7: 45,985,145 R1136Q probably benign Het
Abhd12b A C 12: 70,166,934 probably null Het
Agk T G 6: 40,357,116 V98G possibly damaging Het
Apbb2 A G 5: 66,451,909 S132P probably damaging Het
Apc2 T C 10: 80,306,212 S322P probably damaging Het
Armc3 T C 2: 19,288,856 V486A probably benign Het
Asxl2 A G 12: 3,457,200 K131E probably damaging Het
Atp13a4 A G 16: 29,441,580 V560A Het
Bnc1 C T 7: 81,973,971 G503S probably damaging Het
Bsn C A 9: 108,110,505 V2683F unknown Het
Cdca7l G A 12: 117,875,611 D350N possibly damaging Het
Col6a3 T A 1: 90,768,449 D3239V unknown Het
Col9a1 T A 1: 24,185,127 I130N unknown Het
Cr2 A G 1: 195,158,605 W460R probably damaging Het
Cyb561d2 A G 9: 107,540,384 F56S probably damaging Het
Dnaaf1 A G 8: 119,575,455 I32V probably benign Het
Dnah11 T A 12: 117,995,215 T2978S possibly damaging Het
Dsg2 T A 18: 20,582,999 D302E probably damaging Het
Faf1 T A 4: 109,842,310 F351I possibly damaging Het
Fam96a A T 9: 66,138,385 N145I probably damaging Het
Gimap8 C A 6: 48,656,611 Q455K probably benign Het
Gm6588 T C 5: 112,449,815 V76A probably benign Het
Hps6 C G 19: 46,005,702 R693G possibly damaging Het
Irx1 C T 13: 71,959,516 G349D probably damaging Het
Itga8 C G 2: 12,182,684 G728A probably damaging Het
Lcat T C 8: 105,940,078 T271A possibly damaging Het
Mapkapk2 T C 1: 131,055,942 H308R probably damaging Het
Mast1 A T 8: 84,916,324 N947K probably damaging Het
Mkl1 T C 15: 81,018,073 S349G possibly damaging Het
Mpeg1 A T 19: 12,463,055 I626F probably damaging Het
Myh15 T C 16: 49,195,537 S1859P possibly damaging Het
Nlrx1 A T 9: 44,256,415 D728E probably benign Het
Olfr335-ps A G 2: 36,302,375 T279A probably benign Het
Olfr897-ps1 G T 9: 38,309,220 V142F probably benign Het
Pcdhb18 A T 18: 37,491,509 S631C probably damaging Het
Pcdhga11 C A 18: 37,757,311 Y457* probably null Het
Pcdhga5 T C 18: 37,696,770 I757T probably benign Het
Pcgf5 G A 19: 36,411,948 probably benign Het
Pdf A G 8: 107,048,468 V44A possibly damaging Het
Prtg A T 9: 72,912,301 *1192L probably null Het
Ptk7 A G 17: 46,566,267 F955S possibly damaging Het
Rbp3 C A 14: 33,962,535 Q1174K possibly damaging Het
Rufy1 T C 11: 50,430,969 D46G possibly damaging Het
Sbf2 A G 7: 110,348,995 V1216A probably benign Het
Serpina11 A G 12: 103,986,463 V18A unknown Het
Serpinb6a T A 13: 33,931,560 N47I probably damaging Het
Shc2 T C 10: 79,621,090 H564R probably damaging Het
Sirt7 T A 11: 120,624,062 R115* probably null Het
Slc22a14 A T 9: 119,230,224 probably benign Het
Stra8 T A 6: 34,935,646 S331T probably damaging Het
Tm9sf2 A G 14: 122,143,471 T324A probably benign Het
Tmem268 T C 4: 63,580,293 S224P probably benign Het
Tmem55b T C 14: 50,929,046 T194A possibly damaging Het
Tns1 T C 1: 73,937,248 D1147G probably damaging Het
Tomm22 C T 15: 79,671,110 probably benign Het
Top1 A G 2: 160,714,238 Y539C probably damaging Het
Tpp2 T A 1: 43,970,392 probably benign Het
Trav3-1 T C 14: 52,580,971 V34A probably damaging Het
Tspyl5 T C 15: 33,687,092 N236D possibly damaging Het
Ttc41 A G 10: 86,729,815 D411G probably benign Het
Vmn1r128 A T 7: 21,349,997 M209L probably benign Het
Wdr66 A G 5: 123,273,850 D515G probably benign Het
Xirp2 T A 2: 67,525,183 D3429E probably benign Het
Zfp418 A T 7: 7,182,798 T587S probably benign Het
Other mutations in Btbd7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02047:Btbd7 APN 12 102793779 missense probably benign 0.10
IGL02899:Btbd7 APN 12 102837662 missense probably damaging 1.00
IGL03204:Btbd7 APN 12 102807980 nonsense probably null
H8562:Btbd7 UTSW 12 102788302 missense probably benign 0.26
IGL03050:Btbd7 UTSW 12 102812806 missense probably benign 0.03
R1262:Btbd7 UTSW 12 102787951 missense probably benign
R1423:Btbd7 UTSW 12 102785475 missense possibly damaging 0.49
R1437:Btbd7 UTSW 12 102788090 missense possibly damaging 0.59
R1636:Btbd7 UTSW 12 102793851 missense probably damaging 1.00
R1641:Btbd7 UTSW 12 102790775 missense probably damaging 1.00
R1722:Btbd7 UTSW 12 102812654 missense possibly damaging 0.96
R1921:Btbd7 UTSW 12 102793796 missense probably benign 0.01
R2021:Btbd7 UTSW 12 102790709 missense probably damaging 1.00
R2180:Btbd7 UTSW 12 102785897 missense probably damaging 1.00
R3768:Btbd7 UTSW 12 102795192 missense probably damaging 1.00
R3770:Btbd7 UTSW 12 102795192 missense probably damaging 1.00
R3786:Btbd7 UTSW 12 102838152 missense probably benign 0.22
R4396:Btbd7 UTSW 12 102785293 missense probably benign 0.00
R4809:Btbd7 UTSW 12 102793744 critical splice donor site probably null
R4910:Btbd7 UTSW 12 102808048 missense probably damaging 0.98
R4915:Btbd7 UTSW 12 102837787 nonsense probably null
R5054:Btbd7 UTSW 12 102838212 missense probably benign 0.02
R5276:Btbd7 UTSW 12 102838392 missense probably benign 0.00
R5387:Btbd7 UTSW 12 102837785 missense probably damaging 0.99
R5665:Btbd7 UTSW 12 102785197 missense probably benign
R7083:Btbd7 UTSW 12 102788335 missense probably damaging 0.99
R7354:Btbd7 UTSW 12 102838205 missense probably benign 0.05
R7429:Btbd7 UTSW 12 102837780 missense probably damaging 1.00
R7462:Btbd7 UTSW 12 102837722 missense possibly damaging 0.88
R7469:Btbd7 UTSW 12 102812768 missense probably damaging 0.99
R7998:Btbd7 UTSW 12 102795240 missense probably damaging 1.00
R8499:Btbd7 UTSW 12 102788372 missense probably damaging 1.00
R8783:Btbd7 UTSW 12 102788242 missense probably benign 0.45
R8968:Btbd7 UTSW 12 102812766 missense probably damaging 1.00
R9016:Btbd7 UTSW 12 102785158 missense probably damaging 1.00
R9027:Btbd7 UTSW 12 102838579 missense probably damaging 1.00
R9216:Btbd7 UTSW 12 102795304 missense probably damaging 1.00
R9221:Btbd7 UTSW 12 102811171 missense probably damaging 1.00
R9471:Btbd7 UTSW 12 102793886 missense probably damaging 1.00
X0024:Btbd7 UTSW 12 102812686 nonsense probably null
X0025:Btbd7 UTSW 12 102811164 missense probably benign 0.06
Z1177:Btbd7 UTSW 12 102811120 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTAAAACAGAGAGGTCCACC -3'
(R):5'- TGGAATGGAGGACTCAAGATTTC -3'

Sequencing Primer
(F):5'- AGAGAGGTCCACCACATCGG -3'
(R):5'- CAGAATGTCGACATCCTTGTTCAG -3'
Posted On 2021-03-08