Incidental Mutation 'R8773:Mkl1'
ID664565
Institutional Source Beutler Lab
Gene Symbol Mkl1
Ensembl Gene ENSMUSG00000042292
Gene NameMKL (megakaryoblastic leukemia)/myocardin-like 1
SynonymsMal, MRTF-A, Bsac
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.621) question?
Stock #R8773 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location81012281-81190757 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 81018073 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 349 (S349G)
Ref Sequence ENSEMBL: ENSMUSP00000105207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109579] [ENSMUST00000131235] [ENSMUST00000134469] [ENSMUST00000135047] [ENSMUST00000149582]
Predicted Effect possibly damaging
Transcript: ENSMUST00000109579
AA Change: S349G

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000105207
Gene: ENSMUSG00000042292
AA Change: S349G

DomainStartEndE-ValueType
RPEL 15 40 2.17e-7 SMART
RPEL 59 84 1.36e-8 SMART
RPEL 103 128 1.03e-8 SMART
low complexity region 146 159 N/A INTRINSIC
low complexity region 209 228 N/A INTRINSIC
low complexity region 259 272 N/A INTRINSIC
low complexity region 298 320 N/A INTRINSIC
low complexity region 340 365 N/A INTRINSIC
SAP 385 419 4.98e-10 SMART
low complexity region 424 433 N/A INTRINSIC
low complexity region 483 496 N/A INTRINSIC
coiled coil region 558 600 N/A INTRINSIC
low complexity region 670 679 N/A INTRINSIC
low complexity region 714 735 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131235
AA Change: S264G

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000120116
Gene: ENSMUSG00000042292
AA Change: S264G

DomainStartEndE-ValueType
RPEL 24 49 1.36e-8 SMART
RPEL 68 93 1.03e-8 SMART
low complexity region 111 124 N/A INTRINSIC
low complexity region 174 187 N/A INTRINSIC
low complexity region 213 235 N/A INTRINSIC
low complexity region 255 280 N/A INTRINSIC
SAP 300 334 4.98e-10 SMART
low complexity region 339 348 N/A INTRINSIC
low complexity region 398 411 N/A INTRINSIC
coiled coil region 473 515 N/A INTRINSIC
low complexity region 585 594 N/A INTRINSIC
low complexity region 629 650 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000134469
AA Change: S314G

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000119530
Gene: ENSMUSG00000042292
AA Change: S314G

DomainStartEndE-ValueType
RPEL 24 49 1.36e-8 SMART
RPEL 68 93 1.03e-8 SMART
low complexity region 111 124 N/A INTRINSIC
low complexity region 174 193 N/A INTRINSIC
low complexity region 224 237 N/A INTRINSIC
low complexity region 263 285 N/A INTRINSIC
low complexity region 305 330 N/A INTRINSIC
SAP 350 384 4.98e-10 SMART
low complexity region 389 398 N/A INTRINSIC
low complexity region 448 461 N/A INTRINSIC
coiled coil region 523 565 N/A INTRINSIC
low complexity region 635 644 N/A INTRINSIC
low complexity region 679 700 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000135047
AA Change: S314G

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000118451
Gene: ENSMUSG00000042292
AA Change: S314G

DomainStartEndE-ValueType
RPEL 24 49 1.36e-8 SMART
RPEL 68 93 1.03e-8 SMART
low complexity region 111 124 N/A INTRINSIC
low complexity region 174 193 N/A INTRINSIC
low complexity region 224 237 N/A INTRINSIC
low complexity region 263 285 N/A INTRINSIC
low complexity region 305 330 N/A INTRINSIC
SAP 350 384 4.98e-10 SMART
low complexity region 389 398 N/A INTRINSIC
low complexity region 448 461 N/A INTRINSIC
coiled coil region 523 565 N/A INTRINSIC
low complexity region 635 644 N/A INTRINSIC
low complexity region 679 700 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000149582
AA Change: S314G

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000117745
Gene: ENSMUSG00000042292
AA Change: S314G

DomainStartEndE-ValueType
RPEL 24 49 1.36e-8 SMART
RPEL 68 93 1.03e-8 SMART
low complexity region 111 124 N/A INTRINSIC
low complexity region 174 193 N/A INTRINSIC
low complexity region 224 237 N/A INTRINSIC
low complexity region 263 285 N/A INTRINSIC
low complexity region 305 330 N/A INTRINSIC
SAP 350 384 4.98e-10 SMART
low complexity region 389 398 N/A INTRINSIC
low complexity region 448 461 N/A INTRINSIC
coiled coil region 523 565 N/A INTRINSIC
low complexity region 635 644 N/A INTRINSIC
low complexity region 679 700 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with the transcription factor myocardin, a key regulator of smooth muscle cell differentiation. The encoded protein is predominantly nuclear and may help transduce signals from the cytoskeleton to the nucleus. This gene is involved in a specific translocation event that creates a fusion of this gene and the RNA-binding motif protein-15 gene. This translocation has been associated with acute megakaryocytic leukemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit impaired mammary myoepithelial cell differentiation and fail to eject milk and productively nurse their offspring. Mice homozygous for another null allele show partial embryonic lethality caused by myocardial necrosis as well as mammary gland dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A T 2: 151,472,142 S539T possibly damaging Het
Abcc6 C T 7: 45,985,145 R1136Q probably benign Het
Abhd12b A C 12: 70,166,934 probably null Het
Agk T G 6: 40,357,116 V98G possibly damaging Het
Apbb2 A G 5: 66,451,909 S132P probably damaging Het
Apc2 T C 10: 80,306,212 S322P probably damaging Het
Armc3 T C 2: 19,288,856 V486A probably benign Het
Asxl2 A G 12: 3,457,200 K131E probably damaging Het
Atp13a4 A G 16: 29,441,580 V560A Het
Bnc1 C T 7: 81,973,971 G503S probably damaging Het
Bsn C A 9: 108,110,505 V2683F unknown Het
Btbd7 A T 12: 102,837,982 N266K probably benign Het
Cdca7l G A 12: 117,875,611 D350N possibly damaging Het
Col6a3 T A 1: 90,768,449 D3239V unknown Het
Col9a1 T A 1: 24,185,127 I130N unknown Het
Cr2 A G 1: 195,158,605 W460R probably damaging Het
Cyb561d2 A G 9: 107,540,384 F56S probably damaging Het
Dnaaf1 A G 8: 119,575,455 I32V probably benign Het
Dnah11 T A 12: 117,995,215 T2978S possibly damaging Het
Dsg2 T A 18: 20,582,999 D302E probably damaging Het
Faf1 T A 4: 109,842,310 F351I possibly damaging Het
Fam96a A T 9: 66,138,385 N145I probably damaging Het
Gimap8 C A 6: 48,656,611 Q455K probably benign Het
Gm6588 T C 5: 112,449,815 V76A probably benign Het
Hps6 C G 19: 46,005,702 R693G possibly damaging Het
Irx1 C T 13: 71,959,516 G349D probably damaging Het
Itga8 C G 2: 12,182,684 G728A probably damaging Het
Lcat T C 8: 105,940,078 T271A possibly damaging Het
Mapkapk2 T C 1: 131,055,942 H308R probably damaging Het
Mast1 A T 8: 84,916,324 N947K probably damaging Het
Mpeg1 A T 19: 12,463,055 I626F probably damaging Het
Myh15 T C 16: 49,195,537 S1859P possibly damaging Het
Nlrx1 A T 9: 44,256,415 D728E probably benign Het
Olfr335-ps A G 2: 36,302,375 T279A probably benign Het
Olfr897-ps1 G T 9: 38,309,220 V142F probably benign Het
Pcdhb18 A T 18: 37,491,509 S631C probably damaging Het
Pcdhga11 C A 18: 37,757,311 Y457* probably null Het
Pcdhga5 T C 18: 37,696,770 I757T probably benign Het
Pdf A G 8: 107,048,468 V44A possibly damaging Het
Prtg A T 9: 72,912,301 *1192L probably null Het
Ptk7 A G 17: 46,566,267 F955S possibly damaging Het
Rbp3 C A 14: 33,962,535 Q1174K possibly damaging Het
Rufy1 T C 11: 50,430,969 D46G possibly damaging Het
Sbf2 A G 7: 110,348,995 V1216A probably benign Het
Serpina11 A G 12: 103,986,463 V18A unknown Het
Serpinb6a T A 13: 33,931,560 N47I probably damaging Het
Shc2 T C 10: 79,621,090 H564R probably damaging Het
Sirt7 T A 11: 120,624,062 R115* probably null Het
Stra8 T A 6: 34,935,646 S331T probably damaging Het
Tm9sf2 A G 14: 122,143,471 T324A probably benign Het
Tmem268 T C 4: 63,580,293 S224P probably benign Het
Tmem55b T C 14: 50,929,046 T194A possibly damaging Het
Tns1 T C 1: 73,937,248 D1147G probably damaging Het
Tomm22 C T 15: 79,671,110 probably benign Het
Top1 A G 2: 160,714,238 Y539C probably damaging Het
Trav3-1 T C 14: 52,580,971 V34A probably damaging Het
Tspyl5 T C 15: 33,687,092 N236D possibly damaging Het
Ttc41 A G 10: 86,729,815 D411G probably benign Het
Vmn1r128 A T 7: 21,349,997 M209L probably benign Het
Wdr66 A G 5: 123,273,850 D515G probably benign Het
Xirp2 T A 2: 67,525,183 D3429E probably benign Het
Zfp418 A T 7: 7,182,798 T587S probably benign Het
Other mutations in Mkl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01344:Mkl1 APN 15 81016302 missense probably damaging 1.00
IGL02831:Mkl1 APN 15 81104793 missense probably benign 0.14
IGL03060:Mkl1 APN 15 81045322 missense probably damaging 1.00
Betcha UTSW 15 81018448 nonsense probably null
R0594:Mkl1 UTSW 15 81017174 missense probably damaging 1.00
R0648:Mkl1 UTSW 15 81016920 missense probably damaging 1.00
R1085:Mkl1 UTSW 15 81020883 missense probably damaging 1.00
R1476:Mkl1 UTSW 15 81018208 splice site probably benign
R4030:Mkl1 UTSW 15 81015784 missense probably benign 0.01
R4232:Mkl1 UTSW 15 81023595 missense probably damaging 1.00
R4307:Mkl1 UTSW 15 81016347 missense possibly damaging 0.88
R4400:Mkl1 UTSW 15 81020923 nonsense probably null
R4795:Mkl1 UTSW 15 81017033 missense probably damaging 0.97
R4796:Mkl1 UTSW 15 81017033 missense probably damaging 0.97
R4801:Mkl1 UTSW 15 81104799 missense probably benign 0.15
R4802:Mkl1 UTSW 15 81104799 missense probably benign 0.15
R4899:Mkl1 UTSW 15 81018386 missense probably damaging 1.00
R4967:Mkl1 UTSW 15 81045275 splice site probably benign
R5071:Mkl1 UTSW 15 81022426 missense probably damaging 1.00
R5072:Mkl1 UTSW 15 81022426 missense probably damaging 1.00
R5073:Mkl1 UTSW 15 81022426 missense probably damaging 1.00
R5074:Mkl1 UTSW 15 81022426 missense probably damaging 1.00
R6186:Mkl1 UTSW 15 81016652 missense probably damaging 1.00
R6512:Mkl1 UTSW 15 81013716 missense probably benign
R6581:Mkl1 UTSW 15 81016373 missense probably damaging 1.00
R6997:Mkl1 UTSW 15 81018448 nonsense probably null
R8834:Mkl1 UTSW 15 81020310 missense probably benign 0.00
RF023:Mkl1 UTSW 15 81015856 missense probably damaging 1.00
RF024:Mkl1 UTSW 15 81018255 small deletion probably benign
X0013:Mkl1 UTSW 15 81022436 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATGGGAGAGGCCTAGTCTTC -3'
(R):5'- GACTCCTCCTATGCCAAGATCC -3'

Sequencing Primer
(F):5'- AGAGGCCTAGTCTTCAGTGAG -3'
(R):5'- TCCTATGCCAAGATCCTGCAG -3'
Posted On2021-03-08