Mutagenetix > Incidental Mutations

Incidental Mutation 'R8773:Ptk7'

664568

Institutional Source

Beutler Lab

Gene Symbol

Ptk7

Ensembl Gene

ENSMUSG00000023972

Gene Name

PTK7 protein tyrosine kinase 7

Synonyms

8430404F20Rik, mPTK7/CCK4, chz

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8773 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

46564451-46629504 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 46566267 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 955 (F955S)

Ref Sequence

ENSEMBL: ENSMUSP00000043703 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044442]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000044442
AA Change: F955S

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000043703
Gene: ENSMUSG00000023972
AA Change: F955S

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
IGc2	36	100	1.48e-6	SMART
IGc2	133	199	8.12e-13	SMART
IGc2	229	300	5.01e-4	SMART
IGc2	326	390	1.96e-6	SMART
IG	410	491	6.02e-7	SMART
IGc2	507	569	1.19e-10	SMART
IGc2	596	663	2.6e-11	SMART
transmembrane domain	696	718	N/A	INTRINSIC
TyrKc	788	1053	4.34e-115	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the receptor protein tyrosine kinase family of proteins that transduce extracellular signals across the cell membrane. The encoded protein lacks detectable catalytic tyrosine kinase activity, is involved in the Wnt signaling pathway and plays a role in multiple cellular processes including polarity and adhesion. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trapped allele die perinatally with defects in neural tube closure and planar cell polarity in the ear. ENU-induced mutant mice show omphalocele, impaired neural tube, heart and lung development, rib defects, polydactyly, failed eyelid closure and altered cell polarity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921509C19Rik	A	T	2: 151,472,142	S539T	possibly damaging	Het
Abcc6	C	T	7: 45,985,145	R1136Q	probably benign	Het
Abhd12b	A	C	12: 70,166,934		probably null	Het
Agk	T	G	6: 40,357,116	V98G	possibly damaging	Het
Apbb2	A	G	5: 66,451,909	S132P	probably damaging	Het
Apc2	T	C	10: 80,306,212	S322P	probably damaging	Het
Armc3	T	C	2: 19,288,856	V486A	probably benign	Het
Asxl2	A	G	12: 3,457,200	K131E	probably damaging	Het
Atp13a4	A	G	16: 29,441,580	V560A		Het
Bnc1	C	T	7: 81,973,971	G503S	probably damaging	Het
Bsn	C	A	9: 108,110,505	V2683F	unknown	Het
Btbd7	A	T	12: 102,837,982	N266K	probably benign	Het
Cdca7l	G	A	12: 117,875,611	D350N	possibly damaging	Het
Col6a3	T	A	1: 90,768,449	D3239V	unknown	Het
Col9a1	T	A	1: 24,185,127	I130N	unknown	Het
Cr2	A	G	1: 195,158,605	W460R	probably damaging	Het
Cyb561d2	A	G	9: 107,540,384	F56S	probably damaging	Het
Dnaaf1	A	G	8: 119,575,455	I32V	probably benign	Het
Dnah11	T	A	12: 117,995,215	T2978S	possibly damaging	Het
Dsg2	T	A	18: 20,582,999	D302E	probably damaging	Het
Faf1	T	A	4: 109,842,310	F351I	possibly damaging	Het
Fam96a	A	T	9: 66,138,385	N145I	probably damaging	Het
Gimap8	C	A	6: 48,656,611	Q455K	probably benign	Het
Gm6588	T	C	5: 112,449,815	V76A	probably benign	Het
Hps6	C	G	19: 46,005,702	R693G	possibly damaging	Het
Irx1	C	T	13: 71,959,516	G349D	probably damaging	Het
Itga8	C	G	2: 12,182,684	G728A	probably damaging	Het
Lcat	T	C	8: 105,940,078	T271A	possibly damaging	Het
Mapkapk2	T	C	1: 131,055,942	H308R	probably damaging	Het
Mast1	A	T	8: 84,916,324	N947K	probably damaging	Het
Mkl1	T	C	15: 81,018,073	S349G	possibly damaging	Het
Mpeg1	A	T	19: 12,463,055	I626F	probably damaging	Het
Myh15	T	C	16: 49,195,537	S1859P	possibly damaging	Het
Nlrx1	A	T	9: 44,256,415	D728E	probably benign	Het
Olfr335-ps	A	G	2: 36,302,375	T279A	probably benign	Het
Olfr897-ps1	G	T	9: 38,309,220	V142F	probably benign	Het
Pcdhb18	A	T	18: 37,491,509	S631C	probably damaging	Het
Pcdhga11	C	A	18: 37,757,311	Y457*	probably null	Het
Pcdhga5	T	C	18: 37,696,770	I757T	probably benign	Het
Pdf	A	G	8: 107,048,468	V44A	possibly damaging	Het
Prtg	A	T	9: 72,912,301	*1192L	probably null	Het
Rbp3	C	A	14: 33,962,535	Q1174K	possibly damaging	Het
Rufy1	T	C	11: 50,430,969	D46G	possibly damaging	Het
Sbf2	A	G	7: 110,348,995	V1216A	probably benign	Het
Serpina11	A	G	12: 103,986,463	V18A	unknown	Het
Serpinb6a	T	A	13: 33,931,560	N47I	probably damaging	Het
Shc2	T	C	10: 79,621,090	H564R	probably damaging	Het
Sirt7	T	A	11: 120,624,062	R115*	probably null	Het
Stra8	T	A	6: 34,935,646	S331T	probably damaging	Het
Tm9sf2	A	G	14: 122,143,471	T324A	probably benign	Het
Tmem268	T	C	4: 63,580,293	S224P	probably benign	Het
Tmem55b	T	C	14: 50,929,046	T194A	possibly damaging	Het
Tns1	T	C	1: 73,937,248	D1147G	probably damaging	Het
Tomm22	C	T	15: 79,671,110		probably benign	Het
Top1	A	G	2: 160,714,238	Y539C	probably damaging	Het
Trav3-1	T	C	14: 52,580,971	V34A	probably damaging	Het
Tspyl5	T	C	15: 33,687,092	N236D	possibly damaging	Het
Ttc41	A	G	10: 86,729,815	D411G	probably benign	Het
Vmn1r128	A	T	7: 21,349,997	M209L	probably benign	Het
Wdr66	A	G	5: 123,273,850	D515G	probably benign	Het
Xirp2	T	A	2: 67,525,183	D3429E	probably benign	Het
Zfp418	A	T	7: 7,182,798	T587S	probably benign	Het

Other mutations in Ptk7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Ptk7	APN	17	46574427	missense	probably damaging	1.00
IGL01064:Ptk7	APN	17	46573566	nonsense	probably null
IGL01444:Ptk7	APN	17	46565387	missense	probably damaging	1.00
IGL01477:Ptk7	APN	17	46576880	missense	possibly damaging	0.61
IGL01727:Ptk7	APN	17	46572548	missense	probably damaging	1.00
IGL01958:Ptk7	APN	17	46579427	missense	probably benign	0.37
IGL02496:Ptk7	APN	17	46590144	missense	probably benign	0.04
IGL02864:Ptk7	APN	17	46572733	missense	probably damaging	1.00
R0008:Ptk7	UTSW	17	46572762	splice site	probably benign
R0671:Ptk7	UTSW	17	46590312	missense	possibly damaging	0.94
R1464:Ptk7	UTSW	17	46572591	missense	probably damaging	1.00
R1464:Ptk7	UTSW	17	46572591	missense	probably damaging	1.00
R1549:Ptk7	UTSW	17	46572652	missense	probably damaging	1.00
R1635:Ptk7	UTSW	17	46573534	missense	possibly damaging	0.81
R1646:Ptk7	UTSW	17	46586297	missense	probably benign	0.44
R1846:Ptk7	UTSW	17	46576490	critical splice donor site	probably null
R1973:Ptk7	UTSW	17	46586807	nonsense	probably null
R2060:Ptk7	UTSW	17	46566238	missense	possibly damaging	0.83
R2155:Ptk7	UTSW	17	46579617	missense	probably benign	0.09
R2472:Ptk7	UTSW	17	46576848	missense	probably benign	0.35
R2937:Ptk7	UTSW	17	46572550	missense	probably damaging	0.99
R3824:Ptk7	UTSW	17	46565378	missense	probably damaging	1.00
R3845:Ptk7	UTSW	17	46586418	missense	probably benign	0.00
R4222:Ptk7	UTSW	17	46574463	missense	probably benign
R4671:Ptk7	UTSW	17	46574466	missense	probably benign
R4922:Ptk7	UTSW	17	46576491	critical splice donor site	probably null
R5319:Ptk7	UTSW	17	46572677	missense	probably damaging	1.00
R5993:Ptk7	UTSW	17	46565370	missense	probably benign
R6254:Ptk7	UTSW	17	46572642	missense	probably damaging	1.00
R6352:Ptk7	UTSW	17	46576890	missense	probably benign	0.00
R6806:Ptk7	UTSW	17	46573528	missense	probably damaging	0.99
R7338:Ptk7	UTSW	17	46579599	missense	probably benign	0.00
R7394:Ptk7	UTSW	17	46591757	missense	probably damaging	1.00
R7709:Ptk7	UTSW	17	46571643	missense	possibly damaging	0.81
R7949:Ptk7	UTSW	17	46586461	missense	possibly damaging	0.64

Predicted Primers

PCR Primer
(F):5'- GTGAGGGTTGTATCAGGAACGC -3'
(R):5'- ACCCTCACTCAAGTGGATCC -3'

Sequencing Primer
(F):5'- TTGTATCAGGAACGCAGCTACTGAC -3'
(R):5'- GGATCCACAGCCAGCGTTAATC -3'

Posted On

2021-03-08