Incidental Mutation 'R8774:Itga8'
ID 664578
Institutional Source Beutler Lab
Gene Symbol Itga8
Ensembl Gene ENSMUSG00000026768
Gene Name integrin alpha 8
Synonyms
MMRRC Submission 068628-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.870) question?
Stock # R8774 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 12111443-12306733 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to G at 12187495 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Alanine at position 728 (G728A)
Ref Sequence ENSEMBL: ENSMUSP00000028106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028106] [ENSMUST00000172791]
AlphaFold A2ARA8
Predicted Effect probably damaging
Transcript: ENSMUST00000028106
AA Change: G728A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028106
Gene: ENSMUSG00000026768
AA Change: G728A

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
Int_alpha 52 112 8.48e-8 SMART
Int_alpha 197 244 4.8e1 SMART
Int_alpha 262 312 5.91e-7 SMART
Int_alpha 316 377 6.94e-13 SMART
Int_alpha 381 437 1.92e-15 SMART
Int_alpha 445 494 8.23e-6 SMART
SCOP:d1m1xa2 643 780 2e-46 SMART
SCOP:d1m1xa3 784 1000 2e-80 SMART
transmembrane domain 1011 1033 N/A INTRINSIC
Pfam:Integrin_alpha 1034 1048 2.5e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172791
SMART Domains Protein: ENSMUSP00000134154
Gene: ENSMUSG00000026768

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
Int_alpha 52 112 8.48e-8 SMART
Int_alpha 197 244 4.8e1 SMART
Int_alpha 262 312 5.91e-7 SMART
Int_alpha 316 377 6.94e-13 SMART
Int_alpha 381 437 1.92e-15 SMART
Int_alpha 445 494 8.23e-6 SMART
Meta Mutation Damage Score 0.8466 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: This gene encodes a member of the integrin family of cell surface proteins that mediate cellular interactions with the extracellular matrix and other cells. The encoded protein undergoes proteolytic processing to generate the disulfide-linked heterodimeric alpha subunit which, in turn associates with a beta subunit to form the functional integrin receptor. Mice lacking the encoded protein mostly die after birth due to kidney defects, but some of animals that survive exhibit defects in the sensory hair cells of the inner ear. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die by the end of the second day after birth. Those that do survive have reduced kidneys and abnormal steriocilia in the inner ear. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,090,358 (GRCm39) S364P possibly damaging Het
Abcc2 T A 19: 43,787,577 (GRCm39) Y208N probably damaging Het
Acy1 A T 9: 106,313,913 (GRCm39) D82E probably damaging Het
Ankub1 A G 3: 57,597,802 (GRCm39) L56P probably damaging Het
Aoc1 T A 6: 48,885,529 (GRCm39) F678Y probably damaging Het
Asxl3 C A 18: 22,657,101 (GRCm39) Q1704K probably damaging Het
Atg9b T C 5: 24,595,571 (GRCm39) D236G probably damaging Het
Auh A T 13: 52,993,631 (GRCm39) M261K probably benign Het
C2cd6 A T 1: 59,099,825 (GRCm39) M372K possibly damaging Het
Ccdc88b A T 19: 6,825,090 (GRCm39) N1287K probably damaging Het
Cebpz A G 17: 79,229,073 (GRCm39) S958P probably benign Het
Cgn T A 3: 94,680,810 (GRCm39) Q576L probably damaging Het
Chd7 T A 4: 8,854,692 (GRCm39) M2011K probably damaging Het
Cntnap4 A G 8: 113,529,820 (GRCm39) E676G probably benign Het
Cspp1 A T 1: 10,183,139 (GRCm39) E781D possibly damaging Het
Cyb5d2 A C 11: 72,679,901 (GRCm39) probably null Het
Epn3 G T 11: 94,383,220 (GRCm39) P335T possibly damaging Het
Far2 T A 6: 148,047,629 (GRCm39) S103T probably benign Het
Fhip1a G C 3: 85,580,097 (GRCm39) Q703E probably benign Het
Fhl2 A G 1: 43,162,751 (GRCm39) S255P probably damaging Het
Fmnl2 T A 2: 52,932,321 (GRCm39) V100D Het
Gabbr1 T C 17: 37,382,749 (GRCm39) L814P probably damaging Het
Gzmg C T 14: 56,394,193 (GRCm39) V234I probably benign Het
Ift172 A G 5: 31,415,207 (GRCm39) V1334A probably benign Het
Klrg1 T C 6: 122,255,193 (GRCm39) T80A probably benign Het
Lrp4 A G 2: 91,308,043 (GRCm39) N496S probably benign Het
Lsmem1 G T 12: 40,227,145 (GRCm39) N113K probably damaging Het
Map3k2 G A 18: 32,345,117 (GRCm39) S314N probably damaging Het
Mtpap C T 18: 4,387,032 (GRCm39) R361* probably null Het
Muc5b T A 7: 141,418,831 (GRCm39) S3926T probably benign Het
Nat10 C A 2: 103,561,752 (GRCm39) R643L probably damaging Het
Ncbp3 T C 11: 72,938,808 (GRCm39) V28A probably benign Het
Nlrp9a T C 7: 26,257,984 (GRCm39) L534P possibly damaging Het
Nmi T C 2: 51,848,974 (GRCm39) K39E probably benign Het
Nxpe4 A G 9: 48,304,692 (GRCm39) N260D probably benign Het
Or4k38 T C 2: 111,166,318 (GRCm39) Y35C probably damaging Het
Or51aa2 C A 7: 103,187,965 (GRCm39) V159L probably benign Het
Or6c213 T A 10: 129,573,926 (GRCm39) I287F probably damaging Het
Or8c19-ps1 G A 9: 38,220,600 (GRCm39) A170T unknown Het
Phf2 G T 13: 48,971,878 (GRCm39) probably benign Het
Pirb G T 7: 3,720,728 (GRCm39) L257M probably damaging Het
Plcg2 A T 8: 118,306,585 (GRCm39) D313V possibly damaging Het
Ppard G A 17: 28,517,864 (GRCm39) V311I possibly damaging Het
Ptcd1 A T 5: 145,092,175 (GRCm39) M308K probably damaging Het
Pygo1 A G 9: 72,852,436 (GRCm39) N208D possibly damaging Het
Robo1 T G 16: 72,832,719 (GRCm39) D1497E probably benign Het
Sdk2 T C 11: 113,730,169 (GRCm39) D1022G probably damaging Het
Shc3 G A 13: 51,615,475 (GRCm39) H161Y probably damaging Het
Slc15a1 G T 14: 121,724,423 (GRCm39) Q150K probably damaging Het
Slc6a11 C A 6: 114,206,995 (GRCm39) probably benign Het
Sod1 T G 16: 90,023,039 (GRCm39) V120G probably damaging Het
Spata31g1 T C 4: 42,971,087 (GRCm39) L140P probably damaging Het
Sprr2f T A 3: 92,273,323 (GRCm39) C41S unknown Het
Svil A T 18: 5,049,068 (GRCm39) Y115F probably damaging Het
Tdp1 T C 12: 99,877,917 (GRCm39) S400P probably damaging Het
Thbs4 A T 13: 92,898,030 (GRCm39) D596E probably damaging Het
Tshz1 T A 18: 84,033,101 (GRCm39) M436L possibly damaging Het
Ube3c C T 5: 29,812,029 (GRCm39) T423I probably benign Het
Unc93a A T 17: 13,341,837 (GRCm39) I98N probably damaging Het
Usp33 T A 3: 152,085,213 (GRCm39) Y624* probably null Het
Utp20 A G 10: 88,588,763 (GRCm39) probably benign Het
Vmn1r217 T A 13: 23,298,108 (GRCm39) M265L probably benign Het
Vmn1r222 A T 13: 23,416,418 (GRCm39) M265K probably benign Het
Vmn2r16 C T 5: 109,488,231 (GRCm39) T368M probably benign Het
Zfp867 A G 11: 59,354,837 (GRCm39) F164S probably damaging Het
Zswim1 C T 2: 164,668,062 (GRCm39) T438I probably benign Het
Other mutations in Itga8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00806:Itga8 APN 2 12,260,777 (GRCm39) nonsense probably null
IGL00820:Itga8 APN 2 12,237,703 (GRCm39) missense possibly damaging 0.85
IGL01409:Itga8 APN 2 12,196,525 (GRCm39) missense probably benign
IGL01508:Itga8 APN 2 12,237,613 (GRCm39) missense possibly damaging 0.67
IGL01585:Itga8 APN 2 12,165,123 (GRCm39) splice site probably benign
IGL01590:Itga8 APN 2 12,165,144 (GRCm39) missense probably damaging 1.00
IGL01743:Itga8 APN 2 12,270,144 (GRCm39) missense probably benign 0.04
IGL02634:Itga8 APN 2 12,145,289 (GRCm39) missense possibly damaging 0.55
IGL02805:Itga8 APN 2 12,194,291 (GRCm39) missense possibly damaging 0.83
IGL03200:Itga8 APN 2 12,196,010 (GRCm39) missense probably benign 0.00
IGL03218:Itga8 APN 2 12,115,836 (GRCm39) missense possibly damaging 0.77
IGL03248:Itga8 APN 2 12,137,327 (GRCm39) missense probably benign 0.20
PIT4576001:Itga8 UTSW 2 12,234,903 (GRCm39) missense probably benign 0.19
R0196:Itga8 UTSW 2 12,209,540 (GRCm39) critical splice donor site probably null
R0356:Itga8 UTSW 2 12,187,532 (GRCm39) missense possibly damaging 0.73
R0466:Itga8 UTSW 2 12,237,697 (GRCm39) missense probably damaging 1.00
R0530:Itga8 UTSW 2 12,196,627 (GRCm39) missense probably damaging 0.99
R0715:Itga8 UTSW 2 12,196,053 (GRCm39) splice site probably benign
R0800:Itga8 UTSW 2 12,198,362 (GRCm39) missense possibly damaging 0.95
R0881:Itga8 UTSW 2 12,267,003 (GRCm39) splice site probably null
R1675:Itga8 UTSW 2 12,204,974 (GRCm39) missense probably damaging 0.99
R1758:Itga8 UTSW 2 12,270,144 (GRCm39) missense possibly damaging 0.83
R1939:Itga8 UTSW 2 12,305,657 (GRCm39) missense probably damaging 1.00
R2187:Itga8 UTSW 2 12,199,231 (GRCm39) missense possibly damaging 0.60
R2295:Itga8 UTSW 2 12,187,520 (GRCm39) missense probably benign 0.38
R2356:Itga8 UTSW 2 12,204,952 (GRCm39) missense probably benign
R2371:Itga8 UTSW 2 12,258,277 (GRCm39) missense probably damaging 1.00
R2412:Itga8 UTSW 2 12,306,526 (GRCm39) missense probably benign
R2440:Itga8 UTSW 2 12,183,491 (GRCm39) missense possibly damaging 0.70
R2848:Itga8 UTSW 2 12,165,215 (GRCm39) missense probably damaging 0.98
R3730:Itga8 UTSW 2 12,198,321 (GRCm39) missense possibly damaging 0.92
R3933:Itga8 UTSW 2 12,194,330 (GRCm39) missense probably benign
R3982:Itga8 UTSW 2 12,305,774 (GRCm39) missense possibly damaging 0.92
R4513:Itga8 UTSW 2 12,187,547 (GRCm39) missense probably benign 0.01
R4514:Itga8 UTSW 2 12,187,547 (GRCm39) missense probably benign 0.01
R4660:Itga8 UTSW 2 12,270,069 (GRCm39) missense probably damaging 1.00
R4890:Itga8 UTSW 2 12,198,102 (GRCm39) splice site probably benign
R5533:Itga8 UTSW 2 12,165,161 (GRCm39) missense possibly damaging 0.90
R5619:Itga8 UTSW 2 12,270,139 (GRCm39) missense probably damaging 1.00
R5720:Itga8 UTSW 2 12,115,898 (GRCm39) missense probably damaging 0.99
R5749:Itga8 UTSW 2 12,266,889 (GRCm39) missense probably damaging 1.00
R5930:Itga8 UTSW 2 12,235,019 (GRCm39) missense possibly damaging 0.84
R5954:Itga8 UTSW 2 12,137,297 (GRCm39) missense probably damaging 0.99
R6035:Itga8 UTSW 2 12,196,525 (GRCm39) missense probably benign
R6035:Itga8 UTSW 2 12,196,525 (GRCm39) missense probably benign
R6211:Itga8 UTSW 2 12,198,320 (GRCm39) missense probably damaging 1.00
R6337:Itga8 UTSW 2 12,258,280 (GRCm39) nonsense probably null
R6442:Itga8 UTSW 2 12,234,954 (GRCm39) missense probably benign 0.00
R6491:Itga8 UTSW 2 12,209,587 (GRCm39) missense probably damaging 1.00
R6543:Itga8 UTSW 2 12,306,455 (GRCm39) missense probably damaging 0.99
R6574:Itga8 UTSW 2 12,234,972 (GRCm39) missense probably benign 0.17
R6760:Itga8 UTSW 2 12,306,451 (GRCm39) missense probably damaging 1.00
R6858:Itga8 UTSW 2 12,204,892 (GRCm39) missense probably benign 0.00
R6943:Itga8 UTSW 2 12,160,182 (GRCm39) critical splice donor site probably null
R7048:Itga8 UTSW 2 12,115,895 (GRCm39) missense probably damaging 0.99
R7203:Itga8 UTSW 2 12,234,906 (GRCm39) missense possibly damaging 0.77
R7266:Itga8 UTSW 2 12,237,712 (GRCm39) missense probably damaging 1.00
R7323:Itga8 UTSW 2 12,266,940 (GRCm39) missense probably damaging 1.00
R7540:Itga8 UTSW 2 12,115,848 (GRCm39) missense possibly damaging 0.82
R7637:Itga8 UTSW 2 12,113,998 (GRCm39) missense probably damaging 1.00
R7748:Itga8 UTSW 2 12,235,050 (GRCm39) missense possibly damaging 0.80
R7848:Itga8 UTSW 2 12,196,548 (GRCm39) missense probably damaging 0.99
R8031:Itga8 UTSW 2 12,160,297 (GRCm39) missense probably benign
R8077:Itga8 UTSW 2 12,247,244 (GRCm39) missense probably benign 0.09
R8757:Itga8 UTSW 2 12,266,940 (GRCm39) missense probably damaging 1.00
R8759:Itga8 UTSW 2 12,266,940 (GRCm39) missense probably damaging 1.00
R8772:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8773:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8774-TAIL:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8775:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8775-TAIL:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8808:Itga8 UTSW 2 12,137,328 (GRCm39) nonsense probably null
R8898:Itga8 UTSW 2 12,145,206 (GRCm39) missense probably benign 0.05
R8962:Itga8 UTSW 2 12,196,045 (GRCm39) missense possibly damaging 0.94
R9056:Itga8 UTSW 2 12,235,019 (GRCm39) missense possibly damaging 0.84
R9155:Itga8 UTSW 2 12,194,330 (GRCm39) missense probably benign
R9354:Itga8 UTSW 2 12,237,668 (GRCm39) missense possibly damaging 0.94
R9563:Itga8 UTSW 2 12,165,219 (GRCm39) missense possibly damaging 0.83
R9589:Itga8 UTSW 2 12,237,701 (GRCm39) missense probably damaging 1.00
R9663:Itga8 UTSW 2 12,196,580 (GRCm39) missense probably benign 0.00
Z1176:Itga8 UTSW 2 12,306,643 (GRCm39) start gained probably benign
Z1176:Itga8 UTSW 2 12,266,947 (GRCm39) missense probably benign 0.01
Z1176:Itga8 UTSW 2 12,252,329 (GRCm39) missense probably damaging 1.00
Z1177:Itga8 UTSW 2 12,305,744 (GRCm39) missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TGTGAAAGCCAAGATCAGTTTG -3'
(R):5'- CCGCACAGGTGTTTGAAATC -3'

Sequencing Primer
(F):5'- TCACCCCATGGAGGTTAAAATG -3'
(R):5'- TTTGAAATCAAGGGGAGCGCTC -3'
Posted On 2021-03-08