Mutagenetix > Incidental Mutation

Incidental Mutation 'R8774:Thbs4'

664625

Institutional Source

Beutler Lab

Gene Symbol

Thbs4

Ensembl Gene

ENSMUSG00000021702

Gene Name

thrombospondin 4

Synonyms

TSP-4, TSP4

MMRRC Submission

068628-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8774 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

92751590-92794818 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 92761522 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 596 (D596E)

Ref Sequence

ENSEMBL: ENSMUSP00000022213 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022213]

AlphaFold

Q9Z1T2

Predicted Effect

probably damaging
Transcript: ENSMUST00000022213
AA Change: D596E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000022213
Gene: ENSMUSG00000021702
AA Change: D596E

Domain	Start	End	E-Value	Type
low complexity region	6	18	N/A	INTRINSIC
TSPN	26	194	1.66e-51	SMART
Pfam:COMP	220	264	1.2e-24	PFAM
low complexity region	280	290	N/A	INTRINSIC
EGF	291	327	1.04e-3	SMART
EGF_CA	328	380	7.29e-8	SMART
EGF_CA	381	421	1.42e-10	SMART
EGF	425	464	4.32e-1	SMART
Pfam:TSP_3	498	533	7.1e-15	PFAM
Pfam:TSP_3	557	592	7.8e-17	PFAM
Pfam:TSP_3	616	653	1.4e-11	PFAM
Pfam:TSP_3	654	693	1.3e-10	PFAM
Pfam:TSP_3	694	729	1e-14	PFAM
Pfam:TSP_C	747	944	3.8e-102	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (67/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the thrombospondin protein family. Thrombospondin family members are adhesive glycoproteins that mediate cell-to-cell and cell-to-matrix interactions. This protein forms a pentamer and can bind to heparin and calcium. It is involved in local signaling in the developing and adult nervous system, and it contributes to spinal sensitization and neuropathic pain states. This gene is activated during the stromal response to invasive breast cancer. It may also play a role in inflammatory responses in Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a targeted allele exhibit increased sensitivity to cardiac pressure overload, including increased hypertrophy, decreased ejection fraction, decreased microvessle number, increased extracellular matrix deposition and increased fibrosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	T	C	4: 42,971,087	L140P	probably damaging	Het
Abca1	A	G	4: 53,090,358	S364P	possibly damaging	Het
Abcc2	T	A	19: 43,799,138	Y208N	probably damaging	Het
Acy1	A	T	9: 106,436,714	D82E	probably damaging	Het
Ankub1	A	G	3: 57,690,381	L56P	probably damaging	Het
Aoc1	T	A	6: 48,908,595	F678Y	probably damaging	Het
Asxl3	C	A	18: 22,524,044	Q1704K	probably damaging	Het
Atg9b	T	C	5: 24,390,573	D236G	probably damaging	Het
Auh	A	T	13: 52,839,595	M261K	probably benign	Het
C2cd6	A	T	1: 59,060,666	M372K	possibly damaging	Het
Ccdc88b	A	T	19: 6,847,722	N1287K	probably damaging	Het
Cebpz	A	G	17: 78,921,644	S958P	probably benign	Het
Cgn	T	A	3: 94,773,500	Q576L	probably damaging	Het
Chd7	T	A	4: 8,854,692	M2011K	probably damaging	Het
Cntnap4	A	G	8: 112,803,188	E676G	probably benign	Het
Cspp1	A	T	1: 10,112,914	E781D	possibly damaging	Het
Cyb5d2	A	C	11: 72,789,075		probably null	Het
Epn3	G	T	11: 94,492,394	P335T	possibly damaging	Het
Fam160a1	G	C	3: 85,672,790	Q703E	probably benign	Het
Far2	T	A	6: 148,146,131	S103T	probably benign	Het
Fhl2	A	G	1: 43,123,591	S255P	probably damaging	Het
Fmnl2	T	A	2: 53,042,309	V100D		Het
Gabbr1	T	C	17: 37,071,857	L814P	probably damaging	Het
Gzmg	C	T	14: 56,156,736	V234I	probably benign	Het
Ift172	A	G	5: 31,257,863	V1334A	probably benign	Het
Itga8	C	G	2: 12,182,684	G728A	probably damaging	Het
Klrg1	T	C	6: 122,278,234	T80A	probably benign	Het
Lrp4	A	G	2: 91,477,698	N496S	probably benign	Het
Lsmem1	G	T	12: 40,177,146	N113K	probably damaging	Het
Map3k2	G	A	18: 32,212,064	S314N	probably damaging	Het
Mtpap	C	T	18: 4,387,032	R361*	probably null	Het
Muc5b	T	A	7: 141,865,094	S3926T	probably benign	Het
Nat10	C	A	2: 103,731,407	R643L	probably damaging	Het
Ncbp3	T	C	11: 73,047,982	V28A	probably benign	Het
Nlrp9a	T	C	7: 26,558,559	L534P	possibly damaging	Het
Nmi	T	C	2: 51,958,962	K39E	probably benign	Het
Nxpe4	A	G	9: 48,393,392	N260D	probably benign	Het
Olfr1282	T	C	2: 111,335,973	Y35C	probably damaging	Het
Olfr612	C	A	7: 103,538,758	V159L	probably benign	Het
Olfr806	T	A	10: 129,738,057	I287F	probably damaging	Het
Olfr897-ps1	G	A	9: 38,309,304	A170T	unknown	Het
Phf2	G	T	13: 48,818,402		probably benign	Het
Pirb	G	T	7: 3,717,729	L257M	probably damaging	Het
Plcg2	A	T	8: 117,579,846	D313V	possibly damaging	Het
Ppard	G	A	17: 28,298,890	V311I	possibly damaging	Het
Ptcd1	A	T	5: 145,155,365	M308K	probably damaging	Het
Pygo1	A	G	9: 72,945,154	N208D	possibly damaging	Het
Robo1	T	G	16: 73,035,831	D1497E	probably benign	Het
Sdk2	T	C	11: 113,839,343	D1022G	probably damaging	Het
Shc3	G	A	13: 51,461,439	H161Y	probably damaging	Het
Slc15a1	G	T	14: 121,487,011	Q150K	probably damaging	Het
Slc6a11	C	A	6: 114,230,034		probably benign	Het
Sod1	T	G	16: 90,226,151	V120G	probably damaging	Het
Sprr2f	T	A	3: 92,366,016	C41S	unknown	Het
Svil	A	T	18: 5,049,068	Y115F	probably damaging	Het
Tdp1	T	C	12: 99,911,658	S400P	probably damaging	Het
Tshz1	T	A	18: 84,014,976	M436L	possibly damaging	Het
Ube3c	C	T	5: 29,607,031	T423I	probably benign	Het
Unc93a	A	T	17: 13,122,950	I98N	probably damaging	Het
Usp33	T	A	3: 152,379,576	Y624*	probably null	Het
Utp20	A	G	10: 88,752,901		probably benign	Het
Vmn1r217	T	A	13: 23,113,938	M265L	probably benign	Het
Vmn1r222	A	T	13: 23,232,248	M265K	probably benign	Het
Vmn2r16	C	T	5: 109,340,365	T368M	probably benign	Het
Zfp867	A	G	11: 59,464,011	F164S	probably damaging	Het
Zswim1	C	T	2: 164,826,142	T438I	probably benign	Het

Other mutations in Thbs4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01680:Thbs4	APN	13	92776980	missense	probably benign	0.04
IGL02318:Thbs4	APN	13	92763584	missense	probably damaging	1.00
IGL02887:Thbs4	APN	13	92790798	missense	probably benign	0.00
IGL03205:Thbs4	APN	13	92762774	missense	probably damaging	1.00
IGL03382:Thbs4	APN	13	92769548	missense	probably benign	0.37
R0087:Thbs4	UTSW	13	92755235	missense	probably damaging	0.99
R0128:Thbs4	UTSW	13	92754410	missense	probably benign	0.00
R0130:Thbs4	UTSW	13	92754410	missense	probably benign	0.00
R0276:Thbs4	UTSW	13	92775532	missense	probably benign	0.00
R0423:Thbs4	UTSW	13	92756571	missense	probably damaging	0.99
R0504:Thbs4	UTSW	13	92767184	missense	probably benign	0.04
R0708:Thbs4	UTSW	13	92773186	missense	probably damaging	1.00
R0836:Thbs4	UTSW	13	92758038	missense	probably damaging	1.00
R1078:Thbs4	UTSW	13	92762926	splice site	probably benign
R1139:Thbs4	UTSW	13	92774718	missense	probably damaging	1.00
R1253:Thbs4	UTSW	13	92776905	missense	probably benign	0.17
R1342:Thbs4	UTSW	13	92752417	missense	probably damaging	1.00
R1416:Thbs4	UTSW	13	92761533	missense	probably benign
R1834:Thbs4	UTSW	13	92761481	missense	probably benign	0.00
R1950:Thbs4	UTSW	13	92769571	missense	probably damaging	0.99
R2056:Thbs4	UTSW	13	92790879	missense	probably benign	0.00
R2184:Thbs4	UTSW	13	92774794	missense	probably benign
R2198:Thbs4	UTSW	13	92763271	missense	possibly damaging	0.78
R2859:Thbs4	UTSW	13	92790708	missense	probably benign	0.02
R3605:Thbs4	UTSW	13	92757959	nonsense	probably null
R3783:Thbs4	UTSW	13	92773164	missense	probably benign	0.09
R3784:Thbs4	UTSW	13	92773164	missense	probably benign	0.09
R3786:Thbs4	UTSW	13	92773164	missense	probably benign	0.09
R3787:Thbs4	UTSW	13	92773164	missense	probably benign	0.09
R4061:Thbs4	UTSW	13	92776097	critical splice donor site	probably null
R4790:Thbs4	UTSW	13	92762806	missense	probably damaging	1.00
R4968:Thbs4	UTSW	13	92758068	missense	possibly damaging	0.55
R4983:Thbs4	UTSW	13	92790699	missense	probably benign	0.29
R5185:Thbs4	UTSW	13	92775167	missense	probably damaging	0.97
R5352:Thbs4	UTSW	13	92763590	missense	probably damaging	1.00
R5361:Thbs4	UTSW	13	92776993	missense	probably benign
R5589:Thbs4	UTSW	13	92776074	splice site	probably null
R5700:Thbs4	UTSW	13	92776953	missense	probably benign	0.00
R6061:Thbs4	UTSW	13	92751795	missense	probably benign	0.00
R6101:Thbs4	UTSW	13	92775485	missense	possibly damaging	0.90
R6105:Thbs4	UTSW	13	92775485	missense	possibly damaging	0.90
R6227:Thbs4	UTSW	13	92774682	missense	probably null	1.00
R6249:Thbs4	UTSW	13	92774707	missense	probably damaging	1.00
R6651:Thbs4	UTSW	13	92756536	missense	probably benign	0.06
R6735:Thbs4	UTSW	13	92755166	missense	possibly damaging	0.71
R6885:Thbs4	UTSW	13	92762869	missense	probably damaging	0.96
R6913:Thbs4	UTSW	13	92757936	missense	possibly damaging	0.94
R7409:Thbs4	UTSW	13	92773259	nonsense	probably null
R7480:Thbs4	UTSW	13	92767221	missense	probably benign	0.00
R7682:Thbs4	UTSW	13	92775562	missense	probably benign	0.21
R8022:Thbs4	UTSW	13	92752447	missense	probably damaging	1.00
R8213:Thbs4	UTSW	13	92760586	critical splice acceptor site	probably null
R8231:Thbs4	UTSW	13	92774844	missense	probably benign
R8353:Thbs4	UTSW	13	92790817	missense	probably benign	0.04
R8445:Thbs4	UTSW	13	92790841	missense	probably benign	0.00
R8453:Thbs4	UTSW	13	92790817	missense	probably benign	0.04
R8520:Thbs4	UTSW	13	92754284	nonsense	probably null
R8560:Thbs4	UTSW	13	92755100	missense	probably damaging	0.97
R8774-TAIL:Thbs4	UTSW	13	92761522	missense	probably damaging	1.00
R9061:Thbs4	UTSW	13	92774679	critical splice donor site	probably null
R9223:Thbs4	UTSW	13	92761490	missense	probably damaging	1.00
R9653:Thbs4	UTSW	13	92761514	missense	probably benign
R9691:Thbs4	UTSW	13	92754388	missense	probably damaging	1.00
R9778:Thbs4	UTSW	13	92776987	missense	probably benign	0.17
Z1177:Thbs4	UTSW	13	92754376	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CGACTGGACCAGTTTATTCCC -3'
(R):5'- CTAGAGATGGTGATGTAGCCGG -3'

Sequencing Primer
(F):5'- ATGACCTCATGCATGTCATTGC -3'
(R):5'- TGTAGCCGGAATAAGACACC -3'

Posted On

2021-03-08