Mutagenetix > Incidental Mutations

Incidental Mutation 'R8775:Anapc1'

664648

Institutional Source

Beutler Lab

Gene Symbol

Anapc1

Ensembl Gene

ENSMUSG00000014355

Gene Name

anaphase promoting complex subunit 1

Synonyms

2610021O03Rik, tsg24, Apc1, Mcpr

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8775 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

128610104-128687391 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 128657173 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 860 (Y860N)

Ref Sequence

ENSEMBL: ENSMUSP00000014499 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014499] [ENSMUST00000110333]

AlphaFold

P53995

Predicted Effect

possibly damaging
Transcript: ENSMUST00000014499
AA Change: Y860N

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000014499
Gene: ENSMUSG00000014355
AA Change: Y860N

Domain	Start	End	E-Value	Type
Pfam:ANAPC1	150	214	1.7e-13	PFAM
low complexity region	323	345	N/A	INTRINSIC
low complexity region	1404	1415	N/A	INTRINSIC
Pfam:PC_rep	1467	1501	8.3e-8	PFAM
low complexity region	1516	1528	N/A	INTRINSIC
low complexity region	1924	1936	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000110333
AA Change: Y860N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000105962
Gene: ENSMUSG00000014355
AA Change: Y860N

Domain	Start	End	E-Value	Type
Pfam:Apc1	149	227	1.7e-22	PFAM
low complexity region	323	345	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the anaphase-promoting complex. This complex is an E3 ubiquitin ligase that regulates progression through the metaphase to anaphase portion of the cell cycle by ubiquitinating proteins which targets them for degradation. [provided by RefSeq, Dec 2011]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adck2	T	C	6: 39,575,208		probably null	Het
Alpk3	A	C	7: 81,077,850	M243L	probably benign	Het
Asprv1	T	C	6: 86,628,339	S56P	probably damaging	Het
D130043K22Rik	G	T	13: 24,856,999	E135*	probably null	Het
Dnmt3b	A	G	2: 153,669,791	H293R	possibly damaging	Het
Dsg1a	C	T	18: 20,340,507	S879L	probably damaging	Het
Fbxo24	C	T	5: 137,612,951	A526T	possibly damaging	Het
Fign	A	T	2: 63,980,547	D126E	probably benign	Het
Gpr137	A	G	19: 6,938,432	F377L	probably damaging	Het
Gsdma2	A	G	11: 98,649,183	K44E	probably damaging	Het
Iigp1	A	C	18: 60,390,524	Y238S	probably damaging	Het
Itga8	C	G	2: 12,182,684	G728A	probably damaging	Het
Kcnip2	T	C	19: 45,793,710	N258S	possibly damaging	Het
Lcat	A	G	8: 105,942,391	I84T	possibly damaging	Het
Mansc1	C	T	6: 134,610,668	R182H	probably benign	Het
Myh4	T	C	11: 67,257,180	M1685T	probably benign	Het
Myo10	T	A	15: 25,800,059	V1407E	probably damaging	Het
Ncam2	T	A	16: 81,517,541	N468K	probably benign	Het
Nckap1	A	G	2: 80,545,066	S297P	probably benign	Het
Nefm	T	C	14: 68,124,659	Y52C	probably damaging	Het
Ntng2	A	T	2: 29,227,964	N157K	possibly damaging	Het
Oscp1	T	C	4: 126,076,826	V136A	probably benign	Het
Oser1	G	A	2: 163,407,084	T66I	probably benign	Het
Palld	A	G	8: 61,684,972	L583P	possibly damaging	Het
Pex7	A	G	10: 19,884,776		probably null	Het
Ppp2r3a	A	G	9: 101,127,005	Y378H	probably benign	Het
Prss33	T	A	17: 23,833,911	N263I	possibly damaging	Het
Psg25	A	C	7: 18,521,228	C454W	probably damaging	Het
Ptpn21	T	C	12: 98,682,742		probably null	Het
Sh3bp2	A	T	5: 34,562,407	S587C	probably damaging	Het
Sos2	A	G	12: 69,617,232	F493L	probably benign	Het
St8sia4	T	A	1: 95,591,747	T339S	possibly damaging	Het
Taok1	T	C	11: 77,579,806	K58E	probably benign	Het
Thsd1	A	G	8: 22,259,627	D838G	possibly damaging	Het
Tulp2	A	G	7: 45,515,490	T65A	probably benign	Het
Usp54	A	T	14: 20,588,398	S205T	probably benign	Het
Vmn2r16	C	T	5: 109,340,365	T368M	probably benign	Het
Vmn2r37	A	T	7: 9,215,992	Y464*	probably null	Het
Wdsub1	A	G	2: 59,862,670	M300T	probably damaging	Het
Xrcc5	C	T	1: 72,393,930	T716I	probably benign	Het
Zfp619	G	T	7: 39,535,215	C223F	possibly damaging	Het

Other mutations in Anapc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00232:Anapc1	APN	2	128645130	splice site	probably benign
IGL00704:Anapc1	APN	2	128663984	missense	possibly damaging	0.48
IGL01023:Anapc1	APN	2	128629729	missense	probably damaging	1.00
IGL01432:Anapc1	APN	2	128633408	missense	probably damaging	1.00
IGL01549:Anapc1	APN	2	128653170	missense	probably benign
IGL02089:Anapc1	APN	2	128663933	missense	probably damaging	1.00
IGL02275:Anapc1	APN	2	128659852	missense	probably benign
IGL02570:Anapc1	APN	2	128645200	missense	probably damaging	1.00
IGL02597:Anapc1	APN	2	128623931	missense	probably benign	0.02
IGL02726:Anapc1	APN	2	128659785	missense	probably benign	0.05
IGL03265:Anapc1	APN	2	128627197	missense	probably damaging	1.00
IGL03304:Anapc1	APN	2	128627113	splice site	probably benign
IGL03327:Anapc1	APN	2	128623934	missense	probably benign	0.00
R0023:Anapc1	UTSW	2	128678218	missense	probably damaging	0.99
R0027:Anapc1	UTSW	2	128641511	missense	possibly damaging	0.96
R0027:Anapc1	UTSW	2	128641511	missense	possibly damaging	0.96
R0084:Anapc1	UTSW	2	128623966	splice site	probably benign
R0103:Anapc1	UTSW	2	128680452	splice site	probably benign
R0103:Anapc1	UTSW	2	128680452	splice site	probably benign
R0109:Anapc1	UTSW	2	128634693	missense	probably damaging	1.00
R0109:Anapc1	UTSW	2	128634693	missense	probably damaging	1.00
R0241:Anapc1	UTSW	2	128628629	missense	possibly damaging	0.89
R0241:Anapc1	UTSW	2	128628629	missense	possibly damaging	0.89
R0255:Anapc1	UTSW	2	128634711	missense	probably damaging	0.99
R0377:Anapc1	UTSW	2	128641340	critical splice donor site	probably null
R0467:Anapc1	UTSW	2	128669043	missense	probably damaging	0.99
R0514:Anapc1	UTSW	2	128632655	missense	probably damaging	0.99
R0591:Anapc1	UTSW	2	128619332	missense	probably benign	0.17
R0919:Anapc1	UTSW	2	128617731	missense	probably benign
R1175:Anapc1	UTSW	2	128680188	missense	probably damaging	1.00
R1473:Anapc1	UTSW	2	128617697	missense	possibly damaging	0.88
R1547:Anapc1	UTSW	2	128617556	missense	probably benign	0.44
R1556:Anapc1	UTSW	2	128624899	missense	probably benign	0.00
R1567:Anapc1	UTSW	2	128617716	missense	probably damaging	1.00
R1635:Anapc1	UTSW	2	128628532	missense	probably damaging	1.00
R1645:Anapc1	UTSW	2	128658246	critical splice donor site	probably null
R1677:Anapc1	UTSW	2	128676208	missense	probably benign	0.09
R1854:Anapc1	UTSW	2	128675890	missense	probably damaging	1.00
R1856:Anapc1	UTSW	2	128659788	missense	probably damaging	0.96
R1959:Anapc1	UTSW	2	128633415	missense	probably benign	0.36
R1984:Anapc1	UTSW	2	128669688	missense	possibly damaging	0.85
R2034:Anapc1	UTSW	2	128648458	missense	possibly damaging	0.92
R2283:Anapc1	UTSW	2	128642548	missense	probably benign	0.23
R2928:Anapc1	UTSW	2	128680137	missense	probably damaging	1.00
R3547:Anapc1	UTSW	2	128642682	missense	possibly damaging	0.58
R3904:Anapc1	UTSW	2	128642519	missense	probably damaging	1.00
R4156:Anapc1	UTSW	2	128627229	intron	probably benign
R4359:Anapc1	UTSW	2	128623556	missense	possibly damaging	0.64
R4392:Anapc1	UTSW	2	128676249	critical splice acceptor site	probably null
R4574:Anapc1	UTSW	2	128627195	missense	probably damaging	1.00
R4682:Anapc1	UTSW	2	128664005	missense	probably benign	0.05
R4770:Anapc1	UTSW	2	128686060	splice site	probably benign
R4824:Anapc1	UTSW	2	128628690	missense	possibly damaging	0.69
R4960:Anapc1	UTSW	2	128684594	missense	probably benign	0.23
R5016:Anapc1	UTSW	2	128607175	unclassified	probably benign
R5063:Anapc1	UTSW	2	128629549	missense	possibly damaging	0.48
R5128:Anapc1	UTSW	2	128659917	missense	probably benign
R5271:Anapc1	UTSW	2	128685985	nonsense	probably null
R5363:Anapc1	UTSW	2	128650194	critical splice donor site	probably null
R5469:Anapc1	UTSW	2	128675701	nonsense	probably null
R5473:Anapc1	UTSW	2	128607195	unclassified	probably benign
R5559:Anapc1	UTSW	2	128680434	nonsense	probably null
R5631:Anapc1	UTSW	2	128657217	missense	possibly damaging	0.85
R5747:Anapc1	UTSW	2	128624916	missense	probably benign	0.19
R5840:Anapc1	UTSW	2	128607037	unclassified	probably benign
R6226:Anapc1	UTSW	2	128650372	missense	probably damaging	1.00
R6526:Anapc1	UTSW	2	128672135	nonsense	probably null
R6561:Anapc1	UTSW	2	128663999	missense	probably damaging	0.98
R6743:Anapc1	UTSW	2	128684534	nonsense	probably null
R6799:Anapc1	UTSW	2	128659737	missense	probably null	0.38
R6887:Anapc1	UTSW	2	128659768	missense	possibly damaging	0.91
R6978:Anapc1	UTSW	2	128669900	missense	probably benign	0.06
R7011:Anapc1	UTSW	2	128648681	splice site	probably null
R7041:Anapc1	UTSW	2	128628656	missense	possibly damaging	0.88
R7047:Anapc1	UTSW	2	128615430	missense	probably damaging	0.96
R7074:Anapc1	UTSW	2	128678274	missense	probably damaging	1.00
R7109:Anapc1	UTSW	2	128674602	missense	probably benign	0.33
R7123:Anapc1	UTSW	2	128613010	missense	probably damaging	1.00
R7309:Anapc1	UTSW	2	128674684	missense	probably damaging	0.96
R7693:Anapc1	UTSW	2	128641537	missense	possibly damaging	0.86
R7839:Anapc1	UTSW	2	128684608	missense	probably damaging	0.99
R7847:Anapc1	UTSW	2	128669908	missense	possibly damaging	0.93
R7960:Anapc1	UTSW	2	128674593	missense	probably damaging	1.00
R8061:Anapc1	UTSW	2	128648488	missense	probably damaging	0.98
R8127:Anapc1	UTSW	2	128632627	missense	probably damaging	0.96
R8228:Anapc1	UTSW	2	128619917	nonsense	probably null
R8402:Anapc1	UTSW	2	128630228	missense	probably benign	0.02
R8422:Anapc1	UTSW	2	128675837	missense	probably benign
R8425:Anapc1	UTSW	2	128669868	missense	probably damaging	1.00
R8469:Anapc1	UTSW	2	128658344	splice site	probably null
R8553:Anapc1	UTSW	2	128619913	missense	possibly damaging	0.80
R8688:Anapc1	UTSW	2	128685828	missense	probably benign	0.19
R8699:Anapc1	UTSW	2	128641453	missense	probably damaging	1.00
R8719:Anapc1	UTSW	2	128641449	missense	probably damaging	1.00
R8775-TAIL:Anapc1	UTSW	2	128657173	missense	possibly damaging	0.92
R8806:Anapc1	UTSW	2	128622413	missense	possibly damaging	0.67
R8973:Anapc1	UTSW	2	128664032	missense	probably damaging	0.99
R8977:Anapc1	UTSW	2	128641402	missense	probably damaging	1.00
R9000:Anapc1	UTSW	2	128634708	missense	probably damaging	1.00
R9080:Anapc1	UTSW	2	128622506	missense	possibly damaging	0.82
R9203:Anapc1	UTSW	2	128623502	missense	possibly damaging	0.66
R9314:Anapc1	UTSW	2	128622500	missense	possibly damaging	0.69
R9386:Anapc1	UTSW	2	128617722	missense	probably benign	0.08
R9415:Anapc1	UTSW	2	128634678	missense	probably benign
R9436:Anapc1	UTSW	2	128676125	missense	probably benign
X0066:Anapc1	UTSW	2	128674701	missense	probably benign	0.10

Predicted Primers

PCR Primer
(F):5'- GCTGAAGTGTACAGAACTGTATGGG -3'
(R):5'- GTAATCAGCTATTTACTGTGACAGG -3'

Sequencing Primer
(F):5'- GGGAAAAGAAACAATGTGAGTTTTAC -3'
(R):5'- CAGCTATTTACTGTGACAGGAATATG -3'

Posted On

2021-03-08