Incidental Mutation 'R8775:Tulp2'
ID664661
Institutional Source Beutler Lab
Gene Symbol Tulp2
Ensembl Gene ENSMUSG00000023467
Gene Nametubby-like protein 2
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R8775 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location45481877-45523632 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45515490 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 65 (T65A)
Ref Sequence ENSEMBL: ENSMUSP00000024233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024233] [ENSMUST00000085331] [ENSMUST00000107758] [ENSMUST00000107759] [ENSMUST00000107762] [ENSMUST00000209763] [ENSMUST00000210299] [ENSMUST00000210532] [ENSMUST00000210813] [ENSMUST00000210868]
Predicted Effect probably benign
Transcript: ENSMUST00000024233
AA Change: T65A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000024233
Gene: ENSMUSG00000023467
AA Change: T65A

DomainStartEndE-ValueType
low complexity region 67 77 N/A INTRINSIC
low complexity region 212 220 N/A INTRINSIC
Pfam:Tub 315 556 1.1e-116 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000085331
SMART Domains Protein: ENSMUSP00000082438
Gene: ENSMUSG00000023467

DomainStartEndE-ValueType
low complexity region 88 96 N/A INTRINSIC
Pfam:Tub 191 432 6.2e-117 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107758
SMART Domains Protein: ENSMUSP00000103387
Gene: ENSMUSG00000023467

DomainStartEndE-ValueType
low complexity region 100 108 N/A INTRINSIC
Pfam:Tub 203 451 4.1e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107759
SMART Domains Protein: ENSMUSP00000103388
Gene: ENSMUSG00000023467

DomainStartEndE-ValueType
low complexity region 100 108 N/A INTRINSIC
Pfam:Tub 203 444 3.4e-117 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107762
AA Change: T65A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103391
Gene: ENSMUSG00000023467
AA Change: T65A

DomainStartEndE-ValueType
Pfam:Tub_N 39 295 8.8e-36 PFAM
Pfam:Tub 315 556 1.3e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209763
Predicted Effect probably benign
Transcript: ENSMUST00000210299
AA Change: T9A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000210532
Predicted Effect probably benign
Transcript: ENSMUST00000210813
Predicted Effect probably benign
Transcript: ENSMUST00000210868
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TULP2 is a member of a family of tubby-like genes (TULPs) that encode proteins of unknown function. Members of this family have been identified in plants, vertebrates, and invertebrates. The TULP proteins share a conserved C-terminal region of approximately 200 amino acid residues. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck2 T C 6: 39,575,208 probably null Het
Alpk3 A C 7: 81,077,850 M243L probably benign Het
Anapc1 A T 2: 128,657,173 Y860N possibly damaging Het
Asprv1 T C 6: 86,628,339 S56P probably damaging Het
D130043K22Rik G T 13: 24,856,999 E135* probably null Het
Dnmt3b A G 2: 153,669,791 H293R possibly damaging Het
Dsg1a C T 18: 20,340,507 S879L probably damaging Het
Fbxo24 C T 5: 137,612,951 A526T possibly damaging Het
Fign A T 2: 63,980,547 D126E probably benign Het
Gpr137 A G 19: 6,938,432 F377L probably damaging Het
Gsdma2 A G 11: 98,649,183 K44E probably damaging Het
Iigp1 A C 18: 60,390,524 Y238S probably damaging Het
Itga8 C G 2: 12,182,684 G728A probably damaging Het
Kcnip2 T C 19: 45,793,710 N258S possibly damaging Het
Lcat A G 8: 105,942,391 I84T possibly damaging Het
Mansc1 C T 6: 134,610,668 R182H probably benign Het
Myh4 T C 11: 67,257,180 M1685T probably benign Het
Myo10 T A 15: 25,800,059 V1407E probably damaging Het
Ncam2 T A 16: 81,517,541 N468K probably benign Het
Nckap1 A G 2: 80,545,066 S297P probably benign Het
Nefm T C 14: 68,124,659 Y52C probably damaging Het
Ntng2 A T 2: 29,227,964 N157K possibly damaging Het
Oscp1 T C 4: 126,076,826 V136A probably benign Het
Oser1 G A 2: 163,407,084 T66I probably benign Het
Palld A G 8: 61,684,972 L583P possibly damaging Het
Pex7 A G 10: 19,884,776 probably null Het
Ppp2r3a A G 9: 101,127,005 Y378H probably benign Het
Prss33 T A 17: 23,833,911 N263I possibly damaging Het
Psg25 A C 7: 18,521,228 C454W probably damaging Het
Ptpn21 T C 12: 98,682,742 probably null Het
Sh3bp2 A T 5: 34,562,407 S587C probably damaging Het
Sos2 A G 12: 69,617,232 F493L probably benign Het
St8sia4 T A 1: 95,591,747 T339S possibly damaging Het
Taok1 T C 11: 77,579,806 K58E probably benign Het
Thsd1 A G 8: 22,259,627 D838G possibly damaging Het
Usp54 A T 14: 20,588,398 S205T probably benign Het
Vmn2r16 C T 5: 109,340,365 T368M probably benign Het
Vmn2r37 A T 7: 9,215,992 Y464* probably null Het
Wdsub1 A G 2: 59,862,670 M300T probably damaging Het
Xrcc5 C T 1: 72,393,930 T716I probably benign Het
Zfp619 G T 7: 39,535,215 C223F possibly damaging Het
Other mutations in Tulp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Tulp2 APN 7 45521908 missense probably damaging 1.00
IGL00942:Tulp2 APN 7 45516268 missense possibly damaging 0.87
IGL01881:Tulp2 APN 7 45520795 missense probably damaging 1.00
IGL03240:Tulp2 APN 7 45522310 missense probably damaging 1.00
IGL03242:Tulp2 APN 7 45521858 missense probably damaging 0.99
IGL03353:Tulp2 APN 7 45516272 missense probably damaging 1.00
R0063:Tulp2 UTSW 7 45520860 unclassified probably benign
R0063:Tulp2 UTSW 7 45520860 unclassified probably benign
R0306:Tulp2 UTSW 7 45518576 unclassified probably benign
R0648:Tulp2 UTSW 7 45519786 missense probably damaging 1.00
R0710:Tulp2 UTSW 7 45520808 missense possibly damaging 0.92
R1168:Tulp2 UTSW 7 45517842 missense probably benign
R1345:Tulp2 UTSW 7 45518721 missense probably benign 0.13
R1737:Tulp2 UTSW 7 45519777 missense probably damaging 1.00
R1854:Tulp2 UTSW 7 45517943 missense probably damaging 0.98
R1918:Tulp2 UTSW 7 45517941 missense possibly damaging 0.95
R2356:Tulp2 UTSW 7 45518628 missense possibly damaging 0.85
R3012:Tulp2 UTSW 7 45518763 missense probably damaging 1.00
R3419:Tulp2 UTSW 7 45518752 missense possibly damaging 0.56
R4236:Tulp2 UTSW 7 45521874 missense probably damaging 1.00
R4701:Tulp2 UTSW 7 45517924 missense probably damaging 0.98
R5367:Tulp2 UTSW 7 45516651 missense possibly damaging 0.95
R6056:Tulp2 UTSW 7 45490373 splice site probably null
R6294:Tulp2 UTSW 7 45514692 missense probably damaging 1.00
R6432:Tulp2 UTSW 7 45518588 missense probably benign 0.01
R6875:Tulp2 UTSW 7 45518614 missense probably benign 0.05
R7459:Tulp2 UTSW 7 45519803 missense probably damaging 1.00
R7556:Tulp2 UTSW 7 45518581 splice site probably null
R7676:Tulp2 UTSW 7 45521027 missense possibly damaging 0.86
R7883:Tulp2 UTSW 7 45516764 splice site probably null
R8775-TAIL:Tulp2 UTSW 7 45515490 missense probably benign
R8804:Tulp2 UTSW 7 45520974 missense probably damaging 1.00
Z1088:Tulp2 UTSW 7 45521986 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCTGACAGGACAGGACTGG -3'
(R):5'- AGAGACCTGACTTACAGCCC -3'

Sequencing Primer
(F):5'- CTGGAGGGACTGGATACCTG -3'
(R):5'- GCCCCATCTCTATCCTCAAAGAG -3'
Posted On2021-03-08