Mutagenetix > Incidental Mutation

Incidental Mutation 'R8777:Atp1a4'

664722

Institutional Source

Beutler Lab

Gene Symbol

Atp1a4

Ensembl Gene

ENSMUSG00000007107

Gene Name

ATPase, Na+/K+ transporting, alpha 4 polypeptide

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8777 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

172223513-172258414 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 172232302 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 787 (Y787N)

Ref Sequence

ENSEMBL: ENSMUSP00000106874 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000111243]

AlphaFold

Q9WV27

Predicted Effect

probably damaging
Transcript: ENSMUST00000111243
AA Change: Y787N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000106874
Gene: ENSMUSG00000007107
AA Change: Y787N

Domain	Start	End	E-Value	Type
low complexity region	33	50	N/A	INTRINSIC
Cation_ATPase_N	51	125	1.22e-14	SMART
Pfam:E1-E2_ATPase	144	375	2.6e-59	PFAM
Pfam:Hydrolase	380	738	8.1e-19	PFAM
Pfam:HAD	383	735	1.6e-17	PFAM
Pfam:Cation_ATPase	437	531	9.2e-25	PFAM
Pfam:Cation_ATPase_C	808	1017	1.2e-47	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 4 subunit. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Male mice homozygous for a knock-out allele exhibit infertility associated with asthenozoospermia and teratozoospermia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A830010M20Rik	T	G	5: 107,510,427	I1621R	probably damaging	Het
Abcb4	A	T	5: 8,939,894	T816S	probably benign	Het
Aff4	G	A	11: 53,399,956	S581N	probably damaging	Het
Aimp2	G	A	5: 143,903,007	A253V	probably damaging	Het
Arl6ip4	T	G	5: 124,116,548	S35A	probably benign	Het
Ccdc169	T	C	3: 55,150,913	S13P	probably damaging	Het
Ccdc186	G	A	19: 56,813,361	S108F	probably damaging	Het
Ccdc39	G	A	3: 33,839,133	T101I	probably benign	Het
Cdh13	G	T	8: 119,236,967		probably null	Het
Clec1b	A	T	6: 129,403,574	E151V	probably benign	Het
Cplx1	T	A	5: 108,525,569		probably null	Het
Diablo	T	A	5: 123,517,927	I150F	unknown	Het
Esp31	T	C	17: 38,644,691	V75A	probably benign	Het
Gm49336	G	A	14: 60,228,736	L458F	probably damaging	Het
Gm6502	A	G	5: 94,317,168	D471G	probably benign	Het
Grin3b	A	T	10: 79,973,138	S241C	possibly damaging	Het
Gxylt2	A	G	6: 100,750,471	N182S	probably damaging	Het
Hephl1	T	G	9: 15,060,794	D950A	probably benign	Het
Hkdc1	A	G	10: 62,398,833	I556T	possibly damaging	Het
Ints4	C	A	7: 97,485,020	A53D	probably damaging	Het
Kmt5c	T	C	7: 4,742,713	V124A	possibly damaging	Het
Lrpprc	T	A	17: 84,751,229	Q734H	probably benign	Het
Map1b	T	C	13: 99,430,796	T1806A	unknown	Het
Mcmbp	A	T	7: 128,707,131	F389I	probably damaging	Het
Mcrs1	C	T	15: 99,243,356	G422S	probably damaging	Het
Mgam	A	G	6: 40,655,251	H173R	probably damaging	Het
Mib1	G	A	18: 10,747,422	G200S	probably benign	Het
Myh13	A	T	11: 67,361,335	Q1423L	possibly damaging	Het
Myh2	A	G	11: 67,192,572	R1454G	possibly damaging	Het
Mylk4	C	T	13: 32,729,106	V70I	probably benign	Het
Myof	A	G	19: 37,980,393	V358A	probably benign	Het
Ncor1	T	A	11: 62,433,666	I48F	probably benign	Het
Ncor1	T	A	11: 62,433,668	H47L	probably damaging	Het
Neurog2	G	T	3: 127,634,093	R122L	probably damaging	Het
Npdc1	T	A	2: 25,408,117	L193Q	probably damaging	Het
Nrxn3	A	G	12: 89,260,464	N290D	probably damaging	Het
Nynrin	T	C	14: 55,871,663	M1409T	probably benign	Het
Oas1h	T	C	5: 120,867,044	L185P	probably damaging	Het
Olfr248	A	T	1: 174,391,282	Y71F	probably damaging	Het
Olfr30	C	T	11: 58,455,931	W6*	probably null	Het
Olfr788	T	A	10: 129,473,505	V271E	possibly damaging	Het
Osbpl8	T	A	10: 111,293,113	N853K	probably benign	Het
Papd7	T	A	13: 69,510,705	D337V	probably damaging	Het
Pcsk4	G	T	10: 80,323,723	P405Q	probably benign	Het
Piwil4	A	C	9: 14,739,389		probably null	Het
Pkhd1l1	T	C	15: 44,498,571	Y547H	probably damaging	Het
Rft1	T	C	14: 30,660,199	L51P	probably damaging	Het
Rufy2	T	G	10: 62,997,881	L241V	possibly damaging	Het
Slc5a5	T	C	8: 70,891,290	I155V	possibly damaging	Het
Slc7a2	T	G	8: 40,898,954	M18R	probably damaging	Het
Snapc4	A	G	2: 26,369,363	S592P	probably benign	Het
Strn4	T	C	7: 16,816,608	W86R	probably damaging	Het
Tenm4	A	G	7: 96,896,037	N2457S	probably damaging	Het
Timd4	C	A	11: 46,815,482	T37N	possibly damaging	Het
Tmem268	T	A	4: 63,577,839	N172K	probably damaging	Het
Trrap	T	A	5: 144,837,139	V2855D	probably benign	Het
Tubb6	A	T	18: 67,401,528	T166S	probably damaging	Het
Tufm	A	G	7: 126,488,862	Y179C	probably benign	Het
Ube2r2	C	T	4: 41,190,715	S203L	possibly damaging	Het
Vldlr	G	T	19: 27,240,546	V465L	probably benign	Het
Vmn2r16	C	T	5: 109,340,365	T368M	probably benign	Het
Vmn2r42	A	G	7: 8,192,693	F485L	probably benign	Het
Zcchc6	T	C	13: 59,785,783	N1302D	probably benign	Het

Other mutations in Atp1a4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00419:Atp1a4	APN	1	172239806	missense	probably damaging	1.00
IGL00924:Atp1a4	APN	1	172246772	missense	probably damaging	1.00
IGL01288:Atp1a4	APN	1	172257907	missense	possibly damaging	0.77
IGL01665:Atp1a4	APN	1	172246724	missense	probably benign
IGL02156:Atp1a4	APN	1	172257962	missense	probably benign
IGL02170:Atp1a4	APN	1	172234536	missense	possibly damaging	0.94
IGL02228:Atp1a4	APN	1	172254885	missense	possibly damaging	0.69
IGL02505:Atp1a4	APN	1	172235075	missense	probably damaging	1.00
IGL02653:Atp1a4	APN	1	172251406	missense	possibly damaging	0.81
IGL02792:Atp1a4	APN	1	172227299	critical splice donor site	probably null
IGL02794:Atp1a4	APN	1	172244086	missense	probably benign	0.13
IGL03102:Atp1a4	APN	1	172231151	missense	probably damaging	1.00
R0046:Atp1a4	UTSW	1	172240097	missense	probably benign	0.09
R0046:Atp1a4	UTSW	1	172240097	missense	probably benign	0.09
R0276:Atp1a4	UTSW	1	172257901	missense	probably damaging	1.00
R0309:Atp1a4	UTSW	1	172234987	missense	probably damaging	1.00
R0525:Atp1a4	UTSW	1	172239688	splice site	probably benign
R0615:Atp1a4	UTSW	1	172232060	splice site	probably benign
R0730:Atp1a4	UTSW	1	172240207	splice site	probably benign
R1412:Atp1a4	UTSW	1	172232009	missense	probably damaging	0.97
R1652:Atp1a4	UTSW	1	172254903	missense	probably damaging	1.00
R1898:Atp1a4	UTSW	1	172235048	missense	probably damaging	0.99
R1968:Atp1a4	UTSW	1	172240164	missense	probably benign
R2291:Atp1a4	UTSW	1	172244906	missense	probably damaging	1.00
R2897:Atp1a4	UTSW	1	172246690	missense	probably damaging	1.00
R2908:Atp1a4	UTSW	1	172234477	missense	probably benign
R3119:Atp1a4	UTSW	1	172239826	missense	probably damaging	0.99
R3731:Atp1a4	UTSW	1	172233961	missense	probably damaging	1.00
R4447:Atp1a4	UTSW	1	172234431	missense	probably damaging	0.99
R4602:Atp1a4	UTSW	1	172239765	missense	probably damaging	1.00
R4670:Atp1a4	UTSW	1	172235000	missense	probably benign	0.07
R4674:Atp1a4	UTSW	1	172257656	missense	possibly damaging	0.81
R4675:Atp1a4	UTSW	1	172257656	missense	possibly damaging	0.81
R4785:Atp1a4	UTSW	1	172254110	nonsense	probably null
R4958:Atp1a4	UTSW	1	172231151	missense	probably damaging	1.00
R5015:Atp1a4	UTSW	1	172254082	missense	probably damaging	1.00
R5149:Atp1a4	UTSW	1	172232005	missense	probably damaging	1.00
R5234:Atp1a4	UTSW	1	172227170	missense	possibly damaging	0.73
R5501:Atp1a4	UTSW	1	172246832	missense	probably damaging	1.00
R5682:Atp1a4	UTSW	1	172254163	missense	probably damaging	0.99
R5872:Atp1a4	UTSW	1	172244408	missense	probably damaging	1.00
R5933:Atp1a4	UTSW	1	172232274	missense	possibly damaging	0.91
R6722:Atp1a4	UTSW	1	172258050	unclassified	probably benign
R7087:Atp1a4	UTSW	1	172246702	missense	probably damaging	1.00
R7122:Atp1a4	UTSW	1	172231936	missense	possibly damaging	0.47
R7381:Atp1a4	UTSW	1	172240115	missense	possibly damaging	0.70
R7431:Atp1a4	UTSW	1	172250907	missense	probably benign	0.31
R8269:Atp1a4	UTSW	1	172232325	missense	probably damaging	1.00
R8400:Atp1a4	UTSW	1	172234494	missense	probably damaging	1.00
R8559:Atp1a4	UTSW	1	172251330	missense	probably damaging	1.00
R8680:Atp1a4	UTSW	1	172250999	missense	probably damaging	1.00
R8777-TAIL:Atp1a4	UTSW	1	172232302	missense	probably damaging	1.00
R8867:Atp1a4	UTSW	1	172244924	missense	probably damaging	0.99
R8869:Atp1a4	UTSW	1	172227123	missense	probably benign
R9260:Atp1a4	UTSW	1	172246792	missense	probably damaging	1.00
R9300:Atp1a4	UTSW	1	172239831	missense	probably damaging	1.00
R9545:Atp1a4	UTSW	1	172250897	missense	probably benign	0.35
Z1176:Atp1a4	UTSW	1	172231954	missense	probably benign	0.44

Predicted Primers

PCR Primer
(F):5'- CCTACACTCGATGGATCAGATCG -3'
(R):5'- TGACAGGCACACAGTTTGC -3'

Sequencing Primer
(F):5'- TGGATCAGATCGTAGGAATCCCC -3'
(R):5'- GTTTGCAGAGAAATCACAGGCCC -3'

Posted On

2021-03-08