Incidental Mutation 'R8777:Oas1h'
ID 664736
Institutional Source Beutler Lab
Gene Symbol Oas1h
Ensembl Gene ENSMUSG00000001168
Gene Name 2'-5' oligoadenylate synthetase 1H
Synonyms
MMRRC Submission 068720-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.068) question?
Stock # R8777 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 120999485-121011569 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 121005107 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 185 (L185P)
Ref Sequence ENSEMBL: ENSMUSP00000072297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072476] [ENSMUST00000171820]
AlphaFold Q8VI97
Predicted Effect probably damaging
Transcript: ENSMUST00000072476
AA Change: L185P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072297
Gene: ENSMUSG00000001168
AA Change: L185P

DomainStartEndE-ValueType
Pfam:NTP_transf_2 45 146 1.6e-9 PFAM
Pfam:OAS1_C 175 361 2.3e-76 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171820
AA Change: L185P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132033
Gene: ENSMUSG00000001168
AA Change: L185P

DomainStartEndE-ValueType
Pfam:NTP_transf_2 46 157 1.6e-7 PFAM
Pfam:OAS1_C 174 236 1e-22 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A T 5: 8,989,894 (GRCm39) T816S probably benign Het
Aff4 G A 11: 53,290,783 (GRCm39) S581N probably damaging Het
Aimp2 G A 5: 143,839,825 (GRCm39) A253V probably damaging Het
Arl6ip4 T G 5: 124,254,611 (GRCm39) S35A probably benign Het
Atp1a4 A T 1: 172,059,869 (GRCm39) Y787N probably damaging Het
Btbd8 T G 5: 107,658,293 (GRCm39) I1621R probably damaging Het
Ccdc169 T C 3: 55,058,334 (GRCm39) S13P probably damaging Het
Ccdc186 G A 19: 56,801,793 (GRCm39) S108F probably damaging Het
Ccdc39 G A 3: 33,893,282 (GRCm39) T101I probably benign Het
Cdh13 G T 8: 119,963,706 (GRCm39) probably null Het
Clec1b A T 6: 129,380,537 (GRCm39) E151V probably benign Het
Cplx1 T A 5: 108,673,435 (GRCm39) probably null Het
Diablo T A 5: 123,655,990 (GRCm39) I150F unknown Het
Esp31 T C 17: 38,955,582 (GRCm39) V75A probably benign Het
Gm49336 G A 14: 60,466,185 (GRCm39) L458F probably damaging Het
Grin3b A T 10: 79,808,972 (GRCm39) S241C possibly damaging Het
Gxylt2 A G 6: 100,727,432 (GRCm39) N182S probably damaging Het
Hephl1 T G 9: 14,972,090 (GRCm39) D950A probably benign Het
Hkdc1 A G 10: 62,234,612 (GRCm39) I556T possibly damaging Het
Ints4 C A 7: 97,134,227 (GRCm39) A53D probably damaging Het
Kmt5c T C 7: 4,745,712 (GRCm39) V124A possibly damaging Het
Lrpprc T A 17: 85,058,657 (GRCm39) Q734H probably benign Het
Map1b T C 13: 99,567,304 (GRCm39) T1806A unknown Het
Mcmbp A T 7: 128,308,855 (GRCm39) F389I probably damaging Het
Mcrs1 C T 15: 99,141,237 (GRCm39) G422S probably damaging Het
Mgam A G 6: 40,632,185 (GRCm39) H173R probably damaging Het
Mib1 G A 18: 10,747,422 (GRCm39) G200S probably benign Het
Myh13 A T 11: 67,252,161 (GRCm39) Q1423L possibly damaging Het
Myh2 A G 11: 67,083,398 (GRCm39) R1454G possibly damaging Het
Mylk4 C T 13: 32,913,089 (GRCm39) V70I probably benign Het
Myof A G 19: 37,968,841 (GRCm39) V358A probably benign Het
Ncor1 T A 11: 62,324,494 (GRCm39) H47L probably damaging Het
Ncor1 T A 11: 62,324,492 (GRCm39) I48F probably benign Het
Neurog2 G T 3: 127,427,742 (GRCm39) R122L probably damaging Het
Npdc1 T A 2: 25,298,129 (GRCm39) L193Q probably damaging Het
Nrxn3 A G 12: 89,227,234 (GRCm39) N290D probably damaging Het
Nynrin T C 14: 56,109,120 (GRCm39) M1409T probably benign Het
Or10x4 A T 1: 174,218,848 (GRCm39) Y71F probably damaging Het
Or2z2 C T 11: 58,346,757 (GRCm39) W6* probably null Het
Or6c3 T A 10: 129,309,374 (GRCm39) V271E possibly damaging Het
Osbpl8 T A 10: 111,128,974 (GRCm39) N853K probably benign Het
Pcsk4 G T 10: 80,159,557 (GRCm39) P405Q probably benign Het
Piwil4 A C 9: 14,650,685 (GRCm39) probably null Het
Pkhd1l1 T C 15: 44,361,967 (GRCm39) Y547H probably damaging Het
Pramel40 A G 5: 94,465,027 (GRCm39) D471G probably benign Het
Rft1 T C 14: 30,382,156 (GRCm39) L51P probably damaging Het
Rufy2 T G 10: 62,833,660 (GRCm39) L241V possibly damaging Het
Slc5a5 T C 8: 71,343,934 (GRCm39) I155V possibly damaging Het
Slc7a2 T G 8: 41,351,991 (GRCm39) M18R probably damaging Het
Snapc4 A G 2: 26,259,375 (GRCm39) S592P probably benign Het
Strn4 T C 7: 16,550,533 (GRCm39) W86R probably damaging Het
Tenm4 A G 7: 96,545,244 (GRCm39) N2457S probably damaging Het
Tent4a T A 13: 69,658,824 (GRCm39) D337V probably damaging Het
Timd4 C A 11: 46,706,309 (GRCm39) T37N possibly damaging Het
Tmem268 T A 4: 63,496,076 (GRCm39) N172K probably damaging Het
Trrap T A 5: 144,773,949 (GRCm39) V2855D probably benign Het
Tubb6 A T 18: 67,534,598 (GRCm39) T166S probably damaging Het
Tufm A G 7: 126,088,034 (GRCm39) Y179C probably benign Het
Tut7 T C 13: 59,933,597 (GRCm39) N1302D probably benign Het
Ube2r2 C T 4: 41,190,715 (GRCm39) S203L possibly damaging Het
Vldlr G T 19: 27,217,946 (GRCm39) V465L probably benign Het
Vmn2r16 C T 5: 109,488,231 (GRCm39) T368M probably benign Het
Vmn2r42 A G 7: 8,195,692 (GRCm39) F485L probably benign Het
Other mutations in Oas1h
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01676:Oas1h APN 5 121,009,897 (GRCm39) missense probably damaging 1.00
IGL01890:Oas1h APN 5 121,000,852 (GRCm39) splice site probably null
IGL02745:Oas1h APN 5 120,999,542 (GRCm39) missense probably benign 0.04
IGL02888:Oas1h APN 5 120,999,610 (GRCm39) missense probably benign 0.34
IGL02970:Oas1h APN 5 120,999,698 (GRCm39) missense possibly damaging 0.91
R0125:Oas1h UTSW 5 121,000,626 (GRCm39) nonsense probably null
R1261:Oas1h UTSW 5 121,009,930 (GRCm39) missense probably benign 0.01
R1506:Oas1h UTSW 5 121,009,951 (GRCm39) missense possibly damaging 0.66
R1565:Oas1h UTSW 5 121,000,663 (GRCm39) missense probably damaging 0.97
R1696:Oas1h UTSW 5 121,000,885 (GRCm39) critical splice donor site probably null
R1750:Oas1h UTSW 5 121,009,840 (GRCm39) splice site probably null
R3116:Oas1h UTSW 5 120,999,679 (GRCm39) nonsense probably null
R4814:Oas1h UTSW 5 121,000,728 (GRCm39) missense probably damaging 0.99
R4906:Oas1h UTSW 5 121,005,172 (GRCm39) nonsense probably null
R4944:Oas1h UTSW 5 121,000,846 (GRCm39) missense probably damaging 1.00
R4961:Oas1h UTSW 5 121,009,159 (GRCm39) missense probably damaging 1.00
R5160:Oas1h UTSW 5 121,009,145 (GRCm39) missense probably damaging 1.00
R5698:Oas1h UTSW 5 121,009,045 (GRCm39) missense probably damaging 1.00
R5903:Oas1h UTSW 5 121,009,040 (GRCm39) missense probably damaging 1.00
R6014:Oas1h UTSW 5 121,005,229 (GRCm39) missense possibly damaging 0.68
R7062:Oas1h UTSW 5 120,999,528 (GRCm39) unclassified probably benign
R7966:Oas1h UTSW 5 121,009,962 (GRCm39) missense probably damaging 0.97
R7975:Oas1h UTSW 5 121,009,890 (GRCm39) missense probably damaging 1.00
R8777-TAIL:Oas1h UTSW 5 121,005,107 (GRCm39) missense probably damaging 1.00
R8951:Oas1h UTSW 5 121,000,657 (GRCm39) missense probably damaging 1.00
R8987:Oas1h UTSW 5 121,005,152 (GRCm39) missense probably damaging 1.00
R9748:Oas1h UTSW 5 121,005,088 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GATGCTTGCTGCGGACAAAG -3'
(R):5'- GCTATAATAGACCTCTTCTCTGGCC -3'

Sequencing Primer
(F):5'- GCTGCGGACAAAGTTTTCC -3'
(R):5'- GTATGCACGTTCTCTACACATAGGG -3'
Posted On 2021-03-08