Incidental Mutation 'R8777:Mgam'
ID 664741
Institutional Source Beutler Lab
Gene Symbol Mgam
Ensembl Gene ENSMUSG00000068587
Gene Name maltase-glucoamylase
Synonyms 6030407P20Rik
MMRRC Submission 068720-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.231) question?
Stock # R8777 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 40605765-40746057 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 40632185 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 173 (H173R)
Ref Sequence ENSEMBL: ENSMUSP00000071466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071535] [ENSMUST00000201148] [ENSMUST00000202636]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000071535
AA Change: H173R

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000071466
Gene: ENSMUSG00000068587
AA Change: H173R

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 47 59 N/A INTRINSIC
PD 63 111 1.81e-8 SMART
Pfam:NtCtMGAM_N 124 233 6.2e-36 PFAM
Pfam:Glyco_hydro_31 323 795 3.4e-145 PFAM
PD 924 977 4.52e-9 SMART
Pfam:NtCtMGAM_N 988 1101 1.5e-30 PFAM
Blast:ANK 1141 1171 1e-7 BLAST
Pfam:Glyco_hydro_31 1189 1691 2e-139 PFAM
low complexity region 1776 1791 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000201148
AA Change: H173R

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000143946
Gene: ENSMUSG00000068587
AA Change: H173R

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 47 59 N/A INTRINSIC
PD 63 111 1.81e-8 SMART
Pfam:NtCtMGAM_N 124 233 6.2e-36 PFAM
Pfam:Glyco_hydro_31 323 795 3.4e-145 PFAM
PD 924 977 4.52e-9 SMART
Pfam:NtCtMGAM_N 988 1101 1.5e-30 PFAM
Blast:ANK 1141 1171 1e-7 BLAST
Pfam:Glyco_hydro_31 1189 1691 2e-139 PFAM
low complexity region 1776 1791 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000202636
AA Change: H136R

PolyPhen 2 Score 0.746 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000144652
Gene: ENSMUSG00000068587
AA Change: H136R

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
Pfam:Trefoil 28 70 3.6e-12 PFAM
Pfam:NtCtMGAM_N 87 196 1.4e-36 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes maltase-glucoamylase, which is a brush border membrane enzyme that plays a role in the final steps of digestion of starch. The protein has two catalytic sites identical to those of sucrase-isomaltase, but the proteins are only 59% homologous. Both are members of glycosyl hydrolase family 31, which has a variety of substrate specificities. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display abnormalities in starch digestion and prandial glucose homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A T 5: 8,989,894 (GRCm39) T816S probably benign Het
Aff4 G A 11: 53,290,783 (GRCm39) S581N probably damaging Het
Aimp2 G A 5: 143,839,825 (GRCm39) A253V probably damaging Het
Arl6ip4 T G 5: 124,254,611 (GRCm39) S35A probably benign Het
Atp1a4 A T 1: 172,059,869 (GRCm39) Y787N probably damaging Het
Btbd8 T G 5: 107,658,293 (GRCm39) I1621R probably damaging Het
Ccdc169 T C 3: 55,058,334 (GRCm39) S13P probably damaging Het
Ccdc186 G A 19: 56,801,793 (GRCm39) S108F probably damaging Het
Ccdc39 G A 3: 33,893,282 (GRCm39) T101I probably benign Het
Cdh13 G T 8: 119,963,706 (GRCm39) probably null Het
Clec1b A T 6: 129,380,537 (GRCm39) E151V probably benign Het
Cplx1 T A 5: 108,673,435 (GRCm39) probably null Het
Diablo T A 5: 123,655,990 (GRCm39) I150F unknown Het
Esp31 T C 17: 38,955,582 (GRCm39) V75A probably benign Het
Gm49336 G A 14: 60,466,185 (GRCm39) L458F probably damaging Het
Grin3b A T 10: 79,808,972 (GRCm39) S241C possibly damaging Het
Gxylt2 A G 6: 100,727,432 (GRCm39) N182S probably damaging Het
Hephl1 T G 9: 14,972,090 (GRCm39) D950A probably benign Het
Hkdc1 A G 10: 62,234,612 (GRCm39) I556T possibly damaging Het
Ints4 C A 7: 97,134,227 (GRCm39) A53D probably damaging Het
Kmt5c T C 7: 4,745,712 (GRCm39) V124A possibly damaging Het
Lrpprc T A 17: 85,058,657 (GRCm39) Q734H probably benign Het
Map1b T C 13: 99,567,304 (GRCm39) T1806A unknown Het
Mcmbp A T 7: 128,308,855 (GRCm39) F389I probably damaging Het
Mcrs1 C T 15: 99,141,237 (GRCm39) G422S probably damaging Het
Mib1 G A 18: 10,747,422 (GRCm39) G200S probably benign Het
Myh13 A T 11: 67,252,161 (GRCm39) Q1423L possibly damaging Het
Myh2 A G 11: 67,083,398 (GRCm39) R1454G possibly damaging Het
Mylk4 C T 13: 32,913,089 (GRCm39) V70I probably benign Het
Myof A G 19: 37,968,841 (GRCm39) V358A probably benign Het
Ncor1 T A 11: 62,324,494 (GRCm39) H47L probably damaging Het
Ncor1 T A 11: 62,324,492 (GRCm39) I48F probably benign Het
Neurog2 G T 3: 127,427,742 (GRCm39) R122L probably damaging Het
Npdc1 T A 2: 25,298,129 (GRCm39) L193Q probably damaging Het
Nrxn3 A G 12: 89,227,234 (GRCm39) N290D probably damaging Het
Nynrin T C 14: 56,109,120 (GRCm39) M1409T probably benign Het
Oas1h T C 5: 121,005,107 (GRCm39) L185P probably damaging Het
Or10x4 A T 1: 174,218,848 (GRCm39) Y71F probably damaging Het
Or2z2 C T 11: 58,346,757 (GRCm39) W6* probably null Het
Or6c3 T A 10: 129,309,374 (GRCm39) V271E possibly damaging Het
Osbpl8 T A 10: 111,128,974 (GRCm39) N853K probably benign Het
Pcsk4 G T 10: 80,159,557 (GRCm39) P405Q probably benign Het
Piwil4 A C 9: 14,650,685 (GRCm39) probably null Het
Pkhd1l1 T C 15: 44,361,967 (GRCm39) Y547H probably damaging Het
Pramel40 A G 5: 94,465,027 (GRCm39) D471G probably benign Het
Rft1 T C 14: 30,382,156 (GRCm39) L51P probably damaging Het
Rufy2 T G 10: 62,833,660 (GRCm39) L241V possibly damaging Het
Slc5a5 T C 8: 71,343,934 (GRCm39) I155V possibly damaging Het
Slc7a2 T G 8: 41,351,991 (GRCm39) M18R probably damaging Het
Snapc4 A G 2: 26,259,375 (GRCm39) S592P probably benign Het
Strn4 T C 7: 16,550,533 (GRCm39) W86R probably damaging Het
Tenm4 A G 7: 96,545,244 (GRCm39) N2457S probably damaging Het
Tent4a T A 13: 69,658,824 (GRCm39) D337V probably damaging Het
Timd4 C A 11: 46,706,309 (GRCm39) T37N possibly damaging Het
Tmem268 T A 4: 63,496,076 (GRCm39) N172K probably damaging Het
Trrap T A 5: 144,773,949 (GRCm39) V2855D probably benign Het
Tubb6 A T 18: 67,534,598 (GRCm39) T166S probably damaging Het
Tufm A G 7: 126,088,034 (GRCm39) Y179C probably benign Het
Tut7 T C 13: 59,933,597 (GRCm39) N1302D probably benign Het
Ube2r2 C T 4: 41,190,715 (GRCm39) S203L possibly damaging Het
Vldlr G T 19: 27,217,946 (GRCm39) V465L probably benign Het
Vmn2r16 C T 5: 109,488,231 (GRCm39) T368M probably benign Het
Vmn2r42 A G 7: 8,195,692 (GRCm39) F485L probably benign Het
Other mutations in Mgam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Mgam APN 6 40,619,944 (GRCm39) missense probably benign
IGL01065:Mgam APN 6 40,639,644 (GRCm39) critical splice donor site probably null
IGL01402:Mgam APN 6 40,621,879 (GRCm39) missense probably benign 0.01
IGL01404:Mgam APN 6 40,621,879 (GRCm39) missense probably benign 0.01
IGL01413:Mgam APN 6 40,638,211 (GRCm39) missense probably damaging 1.00
IGL01546:Mgam APN 6 40,631,627 (GRCm39) missense probably damaging 0.98
IGL01596:Mgam APN 6 40,635,204 (GRCm39) missense probably damaging 1.00
IGL02133:Mgam APN 6 40,620,010 (GRCm39) missense probably damaging 0.98
IGL02734:Mgam APN 6 40,639,628 (GRCm39) missense probably damaging 1.00
BB002:Mgam UTSW 6 40,735,985 (GRCm39) missense probably damaging 0.99
BB012:Mgam UTSW 6 40,735,985 (GRCm39) missense probably damaging 0.99
R0012:Mgam UTSW 6 40,742,190 (GRCm39) splice site probably null
R0116:Mgam UTSW 6 40,635,921 (GRCm39) missense probably damaging 1.00
R0310:Mgam UTSW 6 40,737,969 (GRCm39) splice site probably benign
R0452:Mgam UTSW 6 40,736,024 (GRCm39) missense probably damaging 1.00
R0497:Mgam UTSW 6 40,641,826 (GRCm39) missense probably damaging 1.00
R0699:Mgam UTSW 6 40,619,953 (GRCm39) missense possibly damaging 0.84
R0738:Mgam UTSW 6 40,731,869 (GRCm39) missense probably benign 0.01
R1033:Mgam UTSW 6 40,657,558 (GRCm39) missense probably benign 0.07
R1403:Mgam UTSW 6 40,643,815 (GRCm39) missense possibly damaging 0.93
R1403:Mgam UTSW 6 40,643,815 (GRCm39) missense possibly damaging 0.93
R1430:Mgam UTSW 6 40,733,305 (GRCm39) missense probably benign 0.08
R1432:Mgam UTSW 6 40,733,301 (GRCm39) missense probably damaging 1.00
R1443:Mgam UTSW 6 40,736,714 (GRCm39) nonsense probably null
R1470:Mgam UTSW 6 40,736,062 (GRCm39) missense probably damaging 1.00
R1470:Mgam UTSW 6 40,736,062 (GRCm39) missense probably damaging 1.00
R1519:Mgam UTSW 6 40,638,617 (GRCm39) missense probably benign 0.45
R1654:Mgam UTSW 6 40,734,421 (GRCm39) missense probably damaging 1.00
R1667:Mgam UTSW 6 40,653,978 (GRCm39) missense possibly damaging 0.62
R1730:Mgam UTSW 6 40,641,794 (GRCm39) missense possibly damaging 0.92
R1781:Mgam UTSW 6 40,646,797 (GRCm39) missense probably damaging 1.00
R1783:Mgam UTSW 6 40,641,794 (GRCm39) missense possibly damaging 0.92
R1829:Mgam UTSW 6 40,643,826 (GRCm39) missense probably damaging 1.00
R1833:Mgam UTSW 6 40,631,652 (GRCm39) critical splice donor site probably null
R1872:Mgam UTSW 6 40,638,234 (GRCm39) nonsense probably null
R1912:Mgam UTSW 6 40,741,119 (GRCm39) nonsense probably null
R1977:Mgam UTSW 6 40,641,814 (GRCm39) missense probably benign 0.01
R2048:Mgam UTSW 6 40,633,363 (GRCm39) missense possibly damaging 0.80
R2086:Mgam UTSW 6 40,737,962 (GRCm39) splice site probably null
R2138:Mgam UTSW 6 40,733,384 (GRCm39) missense probably damaging 1.00
R2224:Mgam UTSW 6 40,741,208 (GRCm39) splice site probably null
R2408:Mgam UTSW 6 40,663,456 (GRCm39) missense probably damaging 1.00
R2508:Mgam UTSW 6 40,736,717 (GRCm39) missense probably damaging 1.00
R2842:Mgam UTSW 6 40,638,279 (GRCm39) missense probably benign 0.01
R2847:Mgam UTSW 6 40,629,649 (GRCm39) missense possibly damaging 0.67
R2848:Mgam UTSW 6 40,629,649 (GRCm39) missense possibly damaging 0.67
R2965:Mgam UTSW 6 40,745,154 (GRCm39) missense possibly damaging 0.46
R2966:Mgam UTSW 6 40,745,154 (GRCm39) missense possibly damaging 0.46
R3035:Mgam UTSW 6 40,640,464 (GRCm39) missense probably benign
R3895:Mgam UTSW 6 40,736,054 (GRCm39) missense probably damaging 1.00
R4027:Mgam UTSW 6 40,731,836 (GRCm39) missense probably damaging 1.00
R4030:Mgam UTSW 6 40,731,836 (GRCm39) missense probably damaging 1.00
R4302:Mgam UTSW 6 40,740,019 (GRCm39) missense probably benign 0.02
R4707:Mgam UTSW 6 40,691,566 (GRCm39) splice site probably null
R4826:Mgam UTSW 6 40,657,582 (GRCm39) missense possibly damaging 0.52
R4898:Mgam UTSW 6 40,619,988 (GRCm39) missense probably benign
R5438:Mgam UTSW 6 40,661,455 (GRCm39) missense probably damaging 1.00
R5492:Mgam UTSW 6 40,733,297 (GRCm39) missense probably damaging 1.00
R5770:Mgam UTSW 6 40,646,738 (GRCm39) missense probably benign 0.01
R5839:Mgam UTSW 6 40,716,998 (GRCm39) missense possibly damaging 0.90
R5845:Mgam UTSW 6 40,652,257 (GRCm39) missense possibly damaging 0.78
R5847:Mgam UTSW 6 40,660,989 (GRCm39) missense probably benign 0.42
R5891:Mgam UTSW 6 40,721,282 (GRCm39) missense probably benign
R6158:Mgam UTSW 6 40,734,648 (GRCm39) missense probably damaging 1.00
R6193:Mgam UTSW 6 40,724,854 (GRCm39) nonsense probably null
R6423:Mgam UTSW 6 40,653,979 (GRCm39) missense possibly damaging 0.84
R6706:Mgam UTSW 6 40,721,720 (GRCm39) missense probably benign 0.00
R6813:Mgam UTSW 6 40,727,099 (GRCm39) missense probably damaging 0.99
R6863:Mgam UTSW 6 40,705,943 (GRCm39) missense probably benign 0.00
R6906:Mgam UTSW 6 40,724,853 (GRCm39) missense probably damaging 1.00
R7091:Mgam UTSW 6 40,745,210 (GRCm39) missense possibly damaging 0.95
R7099:Mgam UTSW 6 40,638,650 (GRCm39) missense probably benign 0.09
R7282:Mgam UTSW 6 40,740,045 (GRCm39) missense probably benign
R7282:Mgam UTSW 6 40,633,446 (GRCm39) missense possibly damaging 0.71
R7354:Mgam UTSW 6 40,721,732 (GRCm39) missense probably damaging 1.00
R7374:Mgam UTSW 6 40,734,373 (GRCm39) missense possibly damaging 0.89
R7399:Mgam UTSW 6 40,643,788 (GRCm39) missense probably damaging 0.99
R7406:Mgam UTSW 6 40,640,459 (GRCm39) missense probably benign 0.13
R7446:Mgam UTSW 6 40,723,266 (GRCm39) missense probably damaging 1.00
R7466:Mgam UTSW 6 40,721,723 (GRCm39) missense probably benign 0.00
R7525:Mgam UTSW 6 40,742,954 (GRCm39) missense probably benign 0.01
R7530:Mgam UTSW 6 40,686,152 (GRCm39) splice site probably null
R7570:Mgam UTSW 6 40,723,367 (GRCm39) missense probably benign 0.16
R7669:Mgam UTSW 6 40,635,944 (GRCm39) missense probably benign 0.00
R7679:Mgam UTSW 6 40,619,980 (GRCm39) missense probably damaging 0.98
R7746:Mgam UTSW 6 40,645,127 (GRCm39) missense probably damaging 0.99
R7859:Mgam UTSW 6 40,717,113 (GRCm39) missense possibly damaging 0.75
R7925:Mgam UTSW 6 40,735,985 (GRCm39) missense probably damaging 0.99
R8206:Mgam UTSW 6 40,657,169 (GRCm39) missense probably benign 0.00
R8244:Mgam UTSW 6 40,727,520 (GRCm39) missense probably damaging 1.00
R8309:Mgam UTSW 6 40,722,111 (GRCm39) missense possibly damaging 0.88
R8472:Mgam UTSW 6 40,671,460 (GRCm39) splice site probably null
R8758:Mgam UTSW 6 40,705,977 (GRCm39) missense probably benign 0.41
R8777-TAIL:Mgam UTSW 6 40,632,185 (GRCm39) missense probably damaging 0.97
R8783:Mgam UTSW 6 40,633,423 (GRCm39) missense probably damaging 0.99
R8939:Mgam UTSW 6 40,740,137 (GRCm39) critical splice donor site probably null
R8968:Mgam UTSW 6 40,734,745 (GRCm39) critical splice acceptor site probably null
R8987:Mgam UTSW 6 40,706,570 (GRCm39) missense probably damaging 1.00
R9055:Mgam UTSW 6 40,691,663 (GRCm39) intron probably benign
R9171:Mgam UTSW 6 40,745,146 (GRCm39) missense possibly damaging 0.76
R9252:Mgam UTSW 6 40,706,577 (GRCm39) missense probably damaging 0.99
R9258:Mgam UTSW 6 40,657,121 (GRCm39) missense probably benign
R9262:Mgam UTSW 6 40,723,422 (GRCm39) critical splice donor site probably null
R9287:Mgam UTSW 6 40,705,905 (GRCm39) intron probably benign
R9521:Mgam UTSW 6 40,722,118 (GRCm39) missense probably damaging 1.00
R9589:Mgam UTSW 6 40,727,519 (GRCm39) missense probably damaging 1.00
R9658:Mgam UTSW 6 40,721,311 (GRCm39) missense possibly damaging 0.93
R9784:Mgam UTSW 6 40,736,024 (GRCm39) missense probably damaging 1.00
RF011:Mgam UTSW 6 40,734,370 (GRCm39) missense probably damaging 1.00
RF020:Mgam UTSW 6 40,662,243 (GRCm39) missense probably damaging 1.00
RF023:Mgam UTSW 6 40,657,642 (GRCm39) missense probably benign
X0021:Mgam UTSW 6 40,635,981 (GRCm39) missense probably damaging 1.00
Z1088:Mgam UTSW 6 40,619,994 (GRCm39) missense probably benign 0.01
Z1176:Mgam UTSW 6 40,706,000 (GRCm39) missense probably damaging 1.00
Z1176:Mgam UTSW 6 40,654,578 (GRCm39) critical splice donor site probably null
Z1177:Mgam UTSW 6 40,717,005 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAATGTCAGTTTGATCACTGTCG -3'
(R):5'- CTTGGAGCACAGTAAGATCAGTAG -3'

Sequencing Primer
(F):5'- GATCACTGTCGAATTTCCAGTAC -3'
(R):5'- GTCCCAAACAGACATGCATGGTATG -3'
Posted On 2021-03-08