Incidental Mutation 'R8777:Aff4'
ID 664763
Institutional Source Beutler Lab
Gene Symbol Aff4
Ensembl Gene ENSMUSG00000049470
Gene Name AF4/FMR2 family, member 4
Synonyms Laf4l, Alf4
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8777 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 53350833-53421830 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 53399956 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Asparagine at position 581 (S581N)
Ref Sequence ENSEMBL: ENSMUSP00000051479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060945]
AlphaFold Q9ESC8
Predicted Effect probably damaging
Transcript: ENSMUST00000060945
AA Change: S581N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000051479
Gene: ENSMUSG00000049470
AA Change: S581N

DomainStartEndE-ValueType
Pfam:AF-4 2 1156 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152616
SMART Domains Protein: ENSMUSP00000118866
Gene: ENSMUSG00000049470

DomainStartEndE-ValueType
Pfam:AF-4 1 51 4e-15 PFAM
Pfam:AF-4 46 159 1.3e-30 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the AF4 family of transcription factors involved in leukemia. It is a component of the positive transcription elongation factor b (P-TEFb) complex. A chromosomal translocation involving this gene and MLL gene on chromosome 11 is found in infant acute lymphoblastic leukemia with ins(5;11)(q31;q31q23). [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display embryonic and neonatal lethality with incomplete penetrance, abnormal respiration, and shrunken alveoli. Surviving males are infertile with azoospermia and arrest of spermatogenesis but, do not develop hematological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830010M20Rik T G 5: 107,510,427 I1621R probably damaging Het
Abcb4 A T 5: 8,939,894 T816S probably benign Het
Aimp2 G A 5: 143,903,007 A253V probably damaging Het
Arl6ip4 T G 5: 124,116,548 S35A probably benign Het
Atp1a4 A T 1: 172,232,302 Y787N probably damaging Het
Ccdc169 T C 3: 55,150,913 S13P probably damaging Het
Ccdc186 G A 19: 56,813,361 S108F probably damaging Het
Ccdc39 G A 3: 33,839,133 T101I probably benign Het
Cdh13 G T 8: 119,236,967 probably null Het
Clec1b A T 6: 129,403,574 E151V probably benign Het
Cplx1 T A 5: 108,525,569 probably null Het
Diablo T A 5: 123,517,927 I150F unknown Het
Esp31 T C 17: 38,644,691 V75A probably benign Het
Gm49336 G A 14: 60,228,736 L458F probably damaging Het
Gm6502 A G 5: 94,317,168 D471G probably benign Het
Grin3b A T 10: 79,973,138 S241C possibly damaging Het
Gxylt2 A G 6: 100,750,471 N182S probably damaging Het
Hephl1 T G 9: 15,060,794 D950A probably benign Het
Hkdc1 A G 10: 62,398,833 I556T possibly damaging Het
Ints4 C A 7: 97,485,020 A53D probably damaging Het
Kmt5c T C 7: 4,742,713 V124A possibly damaging Het
Lrpprc T A 17: 84,751,229 Q734H probably benign Het
Map1b T C 13: 99,430,796 T1806A unknown Het
Mcmbp A T 7: 128,707,131 F389I probably damaging Het
Mcrs1 C T 15: 99,243,356 G422S probably damaging Het
Mgam A G 6: 40,655,251 H173R probably damaging Het
Mib1 G A 18: 10,747,422 G200S probably benign Het
Myh13 A T 11: 67,361,335 Q1423L possibly damaging Het
Myh2 A G 11: 67,192,572 R1454G possibly damaging Het
Mylk4 C T 13: 32,729,106 V70I probably benign Het
Myof A G 19: 37,980,393 V358A probably benign Het
Ncor1 T A 11: 62,433,666 I48F probably benign Het
Ncor1 T A 11: 62,433,668 H47L probably damaging Het
Neurog2 G T 3: 127,634,093 R122L probably damaging Het
Npdc1 T A 2: 25,408,117 L193Q probably damaging Het
Nrxn3 A G 12: 89,260,464 N290D probably damaging Het
Nynrin T C 14: 55,871,663 M1409T probably benign Het
Oas1h T C 5: 120,867,044 L185P probably damaging Het
Olfr248 A T 1: 174,391,282 Y71F probably damaging Het
Olfr30 C T 11: 58,455,931 W6* probably null Het
Olfr788 T A 10: 129,473,505 V271E possibly damaging Het
Osbpl8 T A 10: 111,293,113 N853K probably benign Het
Papd7 T A 13: 69,510,705 D337V probably damaging Het
Pcsk4 G T 10: 80,323,723 P405Q probably benign Het
Piwil4 A C 9: 14,739,389 probably null Het
Pkhd1l1 T C 15: 44,498,571 Y547H probably damaging Het
Rft1 T C 14: 30,660,199 L51P probably damaging Het
Rufy2 T G 10: 62,997,881 L241V possibly damaging Het
Slc5a5 T C 8: 70,891,290 I155V possibly damaging Het
Slc7a2 T G 8: 40,898,954 M18R probably damaging Het
Snapc4 A G 2: 26,369,363 S592P probably benign Het
Strn4 T C 7: 16,816,608 W86R probably damaging Het
Tenm4 A G 7: 96,896,037 N2457S probably damaging Het
Timd4 C A 11: 46,815,482 T37N possibly damaging Het
Tmem268 T A 4: 63,577,839 N172K probably damaging Het
Trrap T A 5: 144,837,139 V2855D probably benign Het
Tubb6 A T 18: 67,401,528 T166S probably damaging Het
Tufm A G 7: 126,488,862 Y179C probably benign Het
Ube2r2 C T 4: 41,190,715 S203L possibly damaging Het
Vldlr G T 19: 27,240,546 V465L probably benign Het
Vmn2r16 C T 5: 109,340,365 T368M probably benign Het
Vmn2r42 A G 7: 8,192,693 F485L probably benign Het
Zcchc6 T C 13: 59,785,783 N1302D probably benign Het
Other mutations in Aff4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Aff4 APN 11 53411990 missense probably damaging 0.98
IGL01348:Aff4 APN 11 53402500 missense probably benign
IGL01446:Aff4 APN 11 53415469 missense probably damaging 0.99
IGL02151:Aff4 APN 11 53399806 missense probably benign
IGL02526:Aff4 APN 11 53406682 splice site probably benign
IGL02567:Aff4 APN 11 53372751 missense possibly damaging 0.64
IGL02633:Aff4 APN 11 53409371 splice site probably benign
IGL02707:Aff4 APN 11 53399740 missense probably benign
R0090:Aff4 UTSW 11 53392782 missense probably benign 0.01
R0128:Aff4 UTSW 11 53415466 missense probably damaging 0.99
R0243:Aff4 UTSW 11 53397858 missense possibly damaging 0.74
R0345:Aff4 UTSW 11 53372881 missense probably benign 0.00
R0347:Aff4 UTSW 11 53400088 missense probably benign 0.01
R0732:Aff4 UTSW 11 53375596 missense probably benign
R0737:Aff4 UTSW 11 53410953 nonsense probably null
R1464:Aff4 UTSW 11 53372524 missense probably damaging 0.97
R1464:Aff4 UTSW 11 53372524 missense probably damaging 0.97
R1500:Aff4 UTSW 11 53372378 missense probably benign 0.00
R1693:Aff4 UTSW 11 53396553 missense probably damaging 1.00
R1743:Aff4 UTSW 11 53368695 missense possibly damaging 0.65
R1961:Aff4 UTSW 11 53372999 missense probably damaging 1.00
R2048:Aff4 UTSW 11 53398385 missense probably benign 0.39
R2138:Aff4 UTSW 11 53372512 missense possibly damaging 0.94
R2155:Aff4 UTSW 11 53399619 missense probably damaging 1.00
R2379:Aff4 UTSW 11 53408478 splice site probably benign
R4156:Aff4 UTSW 11 53410899 intron probably benign
R5001:Aff4 UTSW 11 53404357 missense probably damaging 1.00
R5281:Aff4 UTSW 11 53372288 missense probably damaging 1.00
R5477:Aff4 UTSW 11 53408472 critical splice donor site probably null
R5677:Aff4 UTSW 11 53400275 missense possibly damaging 0.55
R5992:Aff4 UTSW 11 53373010 missense probably damaging 0.99
R6576:Aff4 UTSW 11 53400441 missense probably damaging 1.00
R6764:Aff4 UTSW 11 53399830 missense probably damaging 1.00
R6988:Aff4 UTSW 11 53398237 missense probably damaging 1.00
R7034:Aff4 UTSW 11 53408409 missense probably damaging 0.99
R7177:Aff4 UTSW 11 53406639 missense probably benign 0.10
R7426:Aff4 UTSW 11 53372875 missense probably damaging 1.00
R7755:Aff4 UTSW 11 53398379 missense probably damaging 0.97
R7848:Aff4 UTSW 11 53404512 missense probably benign 0.05
R7968:Aff4 UTSW 11 53409348 missense probably damaging 1.00
R8159:Aff4 UTSW 11 53411894 missense possibly damaging 0.71
R8218:Aff4 UTSW 11 53398257 missense probably damaging 0.98
R8241:Aff4 UTSW 11 53400171 missense probably benign 0.00
R8284:Aff4 UTSW 11 53404552 missense probably damaging 0.99
R8373:Aff4 UTSW 11 53400267 nonsense probably null
R8695:Aff4 UTSW 11 53368682 missense probably damaging 1.00
R8777-TAIL:Aff4 UTSW 11 53399956 missense probably damaging 1.00
R8780:Aff4 UTSW 11 53380617 missense probably damaging 1.00
R8798:Aff4 UTSW 11 53400508 critical splice donor site probably benign
R8838:Aff4 UTSW 11 53406638 missense possibly damaging 0.77
R8939:Aff4 UTSW 11 53372404 missense probably benign
R9146:Aff4 UTSW 11 53408136 missense probably benign 0.06
R9329:Aff4 UTSW 11 53397859 missense probably damaging 1.00
R9378:Aff4 UTSW 11 53372479 missense probably damaging 0.98
R9471:Aff4 UTSW 11 53380646 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- AGTAACTACACAGATCCAGGGG -3'
(R):5'- AGTCTCTATGATCTCCCGAGAC -3'

Sequencing Primer
(F):5'- GGACAAAAGAAACGAGCTCTGCC -3'
(R):5'- ATGATCTCCCGAGACTTCTGGG -3'
Posted On 2021-03-08