Incidental Mutation 'R8777:Map1b'
ID 664773
Institutional Source Beutler Lab
Gene Symbol Map1b
Ensembl Gene ENSMUSG00000052727
Gene Name microtubule-associated protein 1B
Synonyms Mtap1b, MAP5, Mtap-5, Mtap5, LC1
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8777 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 99421446-99516540 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 99430796 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1806 (T1806A)
Ref Sequence ENSEMBL: ENSMUSP00000068374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064762]
AlphaFold P14873
Predicted Effect unknown
Transcript: ENSMUST00000064762
AA Change: T1806A
SMART Domains Protein: ENSMUSP00000068374
Gene: ENSMUSG00000052727
AA Change: T1806A

DomainStartEndE-ValueType
low complexity region 41 50 N/A INTRINSIC
Blast:Lactamase_B 270 514 1e-56 BLAST
low complexity region 578 595 N/A INTRINSIC
low complexity region 597 617 N/A INTRINSIC
SCOP:d1gkub2 633 735 8e-4 SMART
low complexity region 771 813 N/A INTRINSIC
low complexity region 855 866 N/A INTRINSIC
low complexity region 889 913 N/A INTRINSIC
low complexity region 935 956 N/A INTRINSIC
low complexity region 1006 1030 N/A INTRINSIC
low complexity region 1247 1261 N/A INTRINSIC
low complexity region 1390 1404 N/A INTRINSIC
low complexity region 1545 1557 N/A INTRINSIC
low complexity region 1724 1735 N/A INTRINSIC
Pfam:MAP1B_neuraxin 1891 1907 1.9e-10 PFAM
Pfam:MAP1B_neuraxin 1908 1924 8.3e-11 PFAM
Pfam:MAP1B_neuraxin 1942 1958 3.1e-9 PFAM
Pfam:MAP1B_neuraxin 1959 1975 6.2e-9 PFAM
Pfam:MAP1B_neuraxin 2027 2043 2.9e-10 PFAM
Pfam:MAP1B_neuraxin 2044 2060 3.9e-9 PFAM
low complexity region 2227 2257 N/A INTRINSIC
low complexity region 2286 2307 N/A INTRINSIC
low complexity region 2316 2343 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The product of this gene is a precursor polypeptide that presumably undergoes proteolytic processing to generate the final MAP1B heavy chain and LC1 light chain. Gene knockout studies of the mouse microtubule-associated protein 1B gene suggested an important role in development and function of the nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one knock-out allele die prior to E8.5. While mice homozygous for other knock-out alleles exhibit behavioral, visual system, and nervous system defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830010M20Rik T G 5: 107,510,427 I1621R probably damaging Het
Abcb4 A T 5: 8,939,894 T816S probably benign Het
Aff4 G A 11: 53,399,956 S581N probably damaging Het
Aimp2 G A 5: 143,903,007 A253V probably damaging Het
Arl6ip4 T G 5: 124,116,548 S35A probably benign Het
Atp1a4 A T 1: 172,232,302 Y787N probably damaging Het
Ccdc169 T C 3: 55,150,913 S13P probably damaging Het
Ccdc186 G A 19: 56,813,361 S108F probably damaging Het
Ccdc39 G A 3: 33,839,133 T101I probably benign Het
Cdh13 G T 8: 119,236,967 probably null Het
Clec1b A T 6: 129,403,574 E151V probably benign Het
Cplx1 T A 5: 108,525,569 probably null Het
Diablo T A 5: 123,517,927 I150F unknown Het
Esp31 T C 17: 38,644,691 V75A probably benign Het
Gm49336 G A 14: 60,228,736 L458F probably damaging Het
Gm6502 A G 5: 94,317,168 D471G probably benign Het
Grin3b A T 10: 79,973,138 S241C possibly damaging Het
Gxylt2 A G 6: 100,750,471 N182S probably damaging Het
Hephl1 T G 9: 15,060,794 D950A probably benign Het
Hkdc1 A G 10: 62,398,833 I556T possibly damaging Het
Ints4 C A 7: 97,485,020 A53D probably damaging Het
Kmt5c T C 7: 4,742,713 V124A possibly damaging Het
Lrpprc T A 17: 84,751,229 Q734H probably benign Het
Mcmbp A T 7: 128,707,131 F389I probably damaging Het
Mcrs1 C T 15: 99,243,356 G422S probably damaging Het
Mgam A G 6: 40,655,251 H173R probably damaging Het
Mib1 G A 18: 10,747,422 G200S probably benign Het
Myh13 A T 11: 67,361,335 Q1423L possibly damaging Het
Myh2 A G 11: 67,192,572 R1454G possibly damaging Het
Mylk4 C T 13: 32,729,106 V70I probably benign Het
Myof A G 19: 37,980,393 V358A probably benign Het
Ncor1 T A 11: 62,433,666 I48F probably benign Het
Ncor1 T A 11: 62,433,668 H47L probably damaging Het
Neurog2 G T 3: 127,634,093 R122L probably damaging Het
Npdc1 T A 2: 25,408,117 L193Q probably damaging Het
Nrxn3 A G 12: 89,260,464 N290D probably damaging Het
Nynrin T C 14: 55,871,663 M1409T probably benign Het
Oas1h T C 5: 120,867,044 L185P probably damaging Het
Olfr248 A T 1: 174,391,282 Y71F probably damaging Het
Olfr30 C T 11: 58,455,931 W6* probably null Het
Olfr788 T A 10: 129,473,505 V271E possibly damaging Het
Osbpl8 T A 10: 111,293,113 N853K probably benign Het
Papd7 T A 13: 69,510,705 D337V probably damaging Het
Pcsk4 G T 10: 80,323,723 P405Q probably benign Het
Piwil4 A C 9: 14,739,389 probably null Het
Pkhd1l1 T C 15: 44,498,571 Y547H probably damaging Het
Rft1 T C 14: 30,660,199 L51P probably damaging Het
Rufy2 T G 10: 62,997,881 L241V possibly damaging Het
Slc5a5 T C 8: 70,891,290 I155V possibly damaging Het
Slc7a2 T G 8: 40,898,954 M18R probably damaging Het
Snapc4 A G 2: 26,369,363 S592P probably benign Het
Strn4 T C 7: 16,816,608 W86R probably damaging Het
Tenm4 A G 7: 96,896,037 N2457S probably damaging Het
Timd4 C A 11: 46,815,482 T37N possibly damaging Het
Tmem268 T A 4: 63,577,839 N172K probably damaging Het
Trrap T A 5: 144,837,139 V2855D probably benign Het
Tubb6 A T 18: 67,401,528 T166S probably damaging Het
Tufm A G 7: 126,488,862 Y179C probably benign Het
Ube2r2 C T 4: 41,190,715 S203L possibly damaging Het
Vldlr G T 19: 27,240,546 V465L probably benign Het
Vmn2r16 C T 5: 109,340,365 T368M probably benign Het
Vmn2r42 A G 7: 8,192,693 F485L probably benign Het
Zcchc6 T C 13: 59,785,783 N1302D probably benign Het
Other mutations in Map1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Map1b APN 13 99429233 missense unknown
IGL00533:Map1b APN 13 99432604 missense unknown
IGL00801:Map1b APN 13 99430097 missense unknown
IGL01141:Map1b APN 13 99434761 missense probably damaging 1.00
IGL01418:Map1b APN 13 99431830 missense unknown
IGL01464:Map1b APN 13 99432743 missense unknown
IGL01690:Map1b APN 13 99435004 missense probably damaging 1.00
IGL01991:Map1b APN 13 99429569 missense unknown
IGL02245:Map1b APN 13 99431528 missense unknown
IGL02376:Map1b APN 13 99435595 missense probably damaging 1.00
IGL02380:Map1b APN 13 99431143 missense unknown
IGL02442:Map1b APN 13 99508198 missense probably damaging 1.00
IGL02465:Map1b APN 13 99433406 missense unknown
IGL02816:Map1b APN 13 99441755 missense probably damaging 1.00
IGL02859:Map1b APN 13 99433036 missense unknown
IGL02934:Map1b APN 13 99435131 missense probably benign 0.09
IGL02970:Map1b APN 13 99430734 nonsense probably null
IGL03148:Map1b APN 13 99441695 missense probably damaging 1.00
IGL03401:Map1b APN 13 99427268 missense unknown
IGL03138:Map1b UTSW 13 99425826 missense unknown
R0006:Map1b UTSW 13 99435302 missense probably damaging 1.00
R0006:Map1b UTSW 13 99435302 missense probably damaging 1.00
R0035:Map1b UTSW 13 99435338 missense probably damaging 1.00
R0069:Map1b UTSW 13 99429848 missense unknown
R0315:Map1b UTSW 13 99431116 missense unknown
R0539:Map1b UTSW 13 99434018 missense unknown
R0548:Map1b UTSW 13 99431683 missense unknown
R0613:Map1b UTSW 13 99441641 missense probably damaging 1.00
R0730:Map1b UTSW 13 99429766 nonsense probably null
R1103:Map1b UTSW 13 99427466 splice site probably benign
R1300:Map1b UTSW 13 99432521 missense unknown
R1353:Map1b UTSW 13 99427326 missense unknown
R1387:Map1b UTSW 13 99432650 missense unknown
R1481:Map1b UTSW 13 99431171 missense unknown
R1509:Map1b UTSW 13 99431528 missense unknown
R1521:Map1b UTSW 13 99432739 missense unknown
R1604:Map1b UTSW 13 99429572 missense unknown
R1649:Map1b UTSW 13 99516478 missense probably benign 0.03
R1651:Map1b UTSW 13 99432583 missense unknown
R1661:Map1b UTSW 13 99431929 missense unknown
R1665:Map1b UTSW 13 99431929 missense unknown
R1770:Map1b UTSW 13 99430493 missense unknown
R1926:Map1b UTSW 13 99430692 missense unknown
R1928:Map1b UTSW 13 99430946 missense unknown
R2093:Map1b UTSW 13 99429670 missense unknown
R2110:Map1b UTSW 13 99431121 missense unknown
R2116:Map1b UTSW 13 99430644 missense unknown
R2164:Map1b UTSW 13 99429338 missense unknown
R2207:Map1b UTSW 13 99431083 missense unknown
R2273:Map1b UTSW 13 99432084 missense unknown
R2443:Map1b UTSW 13 99430411 missense unknown
R3054:Map1b UTSW 13 99432742 missense unknown
R3766:Map1b UTSW 13 99434087 missense unknown
R3911:Map1b UTSW 13 99431072 missense unknown
R4005:Map1b UTSW 13 99429907 missense unknown
R4130:Map1b UTSW 13 99431680 missense unknown
R4513:Map1b UTSW 13 99444233 missense probably damaging 1.00
R4613:Map1b UTSW 13 99430302 nonsense probably null
R4633:Map1b UTSW 13 99434942 missense probably damaging 1.00
R4646:Map1b UTSW 13 99432469 missense unknown
R4690:Map1b UTSW 13 99431068 missense unknown
R4704:Map1b UTSW 13 99430475 missense unknown
R4836:Map1b UTSW 13 99431054 missense unknown
R4916:Map1b UTSW 13 99433300 missense unknown
R4951:Map1b UTSW 13 99432427 missense unknown
R4960:Map1b UTSW 13 99432212 missense probably benign 0.23
R4961:Map1b UTSW 13 99435653 missense probably damaging 1.00
R5030:Map1b UTSW 13 99434174 missense unknown
R5090:Map1b UTSW 13 99430026 nonsense probably null
R5469:Map1b UTSW 13 99429338 missense unknown
R5820:Map1b UTSW 13 99432824 missense unknown
R5885:Map1b UTSW 13 99430081 missense unknown
R5915:Map1b UTSW 13 99430331 missense unknown
R5923:Map1b UTSW 13 99433153 missense unknown
R6063:Map1b UTSW 13 99431137 missense unknown
R6102:Map1b UTSW 13 99425873 missense unknown
R6218:Map1b UTSW 13 99433206 missense unknown
R6435:Map1b UTSW 13 99516363 missense probably damaging 0.99
R6663:Map1b UTSW 13 99430022 missense unknown
R6765:Map1b UTSW 13 99425941 missense unknown
R6860:Map1b UTSW 13 99434767 missense probably damaging 1.00
R6997:Map1b UTSW 13 99430634 missense unknown
R7001:Map1b UTSW 13 99430593 missense unknown
R7310:Map1b UTSW 13 99433655 missense unknown
R7349:Map1b UTSW 13 99433640 missense unknown
R7448:Map1b UTSW 13 99508140 missense probably damaging 0.99
R7449:Map1b UTSW 13 99508140 missense probably damaging 0.99
R7452:Map1b UTSW 13 99508140 missense probably damaging 0.99
R7810:Map1b UTSW 13 99431882 missense unknown
R7820:Map1b UTSW 13 99431177 missense unknown
R8396:Map1b UTSW 13 99434113 missense unknown
R8470:Map1b UTSW 13 99516442 missense probably damaging 0.98
R8535:Map1b UTSW 13 99435154 missense probably damaging 1.00
R8777-TAIL:Map1b UTSW 13 99430796 missense unknown
R8812:Map1b UTSW 13 99432815 missense unknown
R8903:Map1b UTSW 13 99432509 nonsense probably null
R8928:Map1b UTSW 13 99432116 missense unknown
R8954:Map1b UTSW 13 99434227 missense unknown
R9164:Map1b UTSW 13 99425843 missense unknown
R9164:Map1b UTSW 13 99432308 nonsense probably null
R9190:Map1b UTSW 13 99435406 missense probably damaging 0.99
R9334:Map1b UTSW 13 99431640 missense unknown
R9339:Map1b UTSW 13 99431062 missense unknown
R9357:Map1b UTSW 13 99430200 nonsense probably null
R9430:Map1b UTSW 13 99434108 missense unknown
RF003:Map1b UTSW 13 99430750 missense unknown
X0019:Map1b UTSW 13 99429968 missense unknown
X0019:Map1b UTSW 13 99432412 missense unknown
Z1088:Map1b UTSW 13 99508115 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- ATCTTCTTCATCTGGAGATCCGG -3'
(R):5'- TGTTCCTCCCAGAGAGATGTCC -3'

Sequencing Primer
(F):5'- TAGGCATAGTTAAAGTCTCCGG -3'
(R):5'- CCCAGAGAGATGTCCTTATATGC -3'
Posted On 2021-03-08