Incidental Mutation 'R8777:Map1b'
ID 664773
Institutional Source Beutler Lab
Gene Symbol Map1b
Ensembl Gene ENSMUSG00000052727
Gene Name microtubule-associated protein 1B
Synonyms Mtap1b, Mtap-5, MAP5, Mtap5, LC1
MMRRC Submission 068720-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8777 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 99557954-99653048 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 99567304 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1806 (T1806A)
Ref Sequence ENSEMBL: ENSMUSP00000068374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064762]
AlphaFold P14873
Predicted Effect unknown
Transcript: ENSMUST00000064762
AA Change: T1806A
SMART Domains Protein: ENSMUSP00000068374
Gene: ENSMUSG00000052727
AA Change: T1806A

DomainStartEndE-ValueType
low complexity region 41 50 N/A INTRINSIC
Blast:Lactamase_B 270 514 1e-56 BLAST
low complexity region 578 595 N/A INTRINSIC
low complexity region 597 617 N/A INTRINSIC
SCOP:d1gkub2 633 735 8e-4 SMART
low complexity region 771 813 N/A INTRINSIC
low complexity region 855 866 N/A INTRINSIC
low complexity region 889 913 N/A INTRINSIC
low complexity region 935 956 N/A INTRINSIC
low complexity region 1006 1030 N/A INTRINSIC
low complexity region 1247 1261 N/A INTRINSIC
low complexity region 1390 1404 N/A INTRINSIC
low complexity region 1545 1557 N/A INTRINSIC
low complexity region 1724 1735 N/A INTRINSIC
Pfam:MAP1B_neuraxin 1891 1907 1.9e-10 PFAM
Pfam:MAP1B_neuraxin 1908 1924 8.3e-11 PFAM
Pfam:MAP1B_neuraxin 1942 1958 3.1e-9 PFAM
Pfam:MAP1B_neuraxin 1959 1975 6.2e-9 PFAM
Pfam:MAP1B_neuraxin 2027 2043 2.9e-10 PFAM
Pfam:MAP1B_neuraxin 2044 2060 3.9e-9 PFAM
low complexity region 2227 2257 N/A INTRINSIC
low complexity region 2286 2307 N/A INTRINSIC
low complexity region 2316 2343 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The product of this gene is a precursor polypeptide that presumably undergoes proteolytic processing to generate the final MAP1B heavy chain and LC1 light chain. Gene knockout studies of the mouse microtubule-associated protein 1B gene suggested an important role in development and function of the nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one knock-out allele die prior to E8.5. While mice homozygous for other knock-out alleles exhibit behavioral, visual system, and nervous system defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A T 5: 8,989,894 (GRCm39) T816S probably benign Het
Aff4 G A 11: 53,290,783 (GRCm39) S581N probably damaging Het
Aimp2 G A 5: 143,839,825 (GRCm39) A253V probably damaging Het
Arl6ip4 T G 5: 124,254,611 (GRCm39) S35A probably benign Het
Atp1a4 A T 1: 172,059,869 (GRCm39) Y787N probably damaging Het
Btbd8 T G 5: 107,658,293 (GRCm39) I1621R probably damaging Het
Ccdc169 T C 3: 55,058,334 (GRCm39) S13P probably damaging Het
Ccdc186 G A 19: 56,801,793 (GRCm39) S108F probably damaging Het
Ccdc39 G A 3: 33,893,282 (GRCm39) T101I probably benign Het
Cdh13 G T 8: 119,963,706 (GRCm39) probably null Het
Clec1b A T 6: 129,380,537 (GRCm39) E151V probably benign Het
Cplx1 T A 5: 108,673,435 (GRCm39) probably null Het
Diablo T A 5: 123,655,990 (GRCm39) I150F unknown Het
Esp31 T C 17: 38,955,582 (GRCm39) V75A probably benign Het
Gm49336 G A 14: 60,466,185 (GRCm39) L458F probably damaging Het
Grin3b A T 10: 79,808,972 (GRCm39) S241C possibly damaging Het
Gxylt2 A G 6: 100,727,432 (GRCm39) N182S probably damaging Het
Hephl1 T G 9: 14,972,090 (GRCm39) D950A probably benign Het
Hkdc1 A G 10: 62,234,612 (GRCm39) I556T possibly damaging Het
Ints4 C A 7: 97,134,227 (GRCm39) A53D probably damaging Het
Kmt5c T C 7: 4,745,712 (GRCm39) V124A possibly damaging Het
Lrpprc T A 17: 85,058,657 (GRCm39) Q734H probably benign Het
Mcmbp A T 7: 128,308,855 (GRCm39) F389I probably damaging Het
Mcrs1 C T 15: 99,141,237 (GRCm39) G422S probably damaging Het
Mgam A G 6: 40,632,185 (GRCm39) H173R probably damaging Het
Mib1 G A 18: 10,747,422 (GRCm39) G200S probably benign Het
Myh13 A T 11: 67,252,161 (GRCm39) Q1423L possibly damaging Het
Myh2 A G 11: 67,083,398 (GRCm39) R1454G possibly damaging Het
Mylk4 C T 13: 32,913,089 (GRCm39) V70I probably benign Het
Myof A G 19: 37,968,841 (GRCm39) V358A probably benign Het
Ncor1 T A 11: 62,324,492 (GRCm39) I48F probably benign Het
Ncor1 T A 11: 62,324,494 (GRCm39) H47L probably damaging Het
Neurog2 G T 3: 127,427,742 (GRCm39) R122L probably damaging Het
Npdc1 T A 2: 25,298,129 (GRCm39) L193Q probably damaging Het
Nrxn3 A G 12: 89,227,234 (GRCm39) N290D probably damaging Het
Nynrin T C 14: 56,109,120 (GRCm39) M1409T probably benign Het
Oas1h T C 5: 121,005,107 (GRCm39) L185P probably damaging Het
Or10x4 A T 1: 174,218,848 (GRCm39) Y71F probably damaging Het
Or2z2 C T 11: 58,346,757 (GRCm39) W6* probably null Het
Or6c3 T A 10: 129,309,374 (GRCm39) V271E possibly damaging Het
Osbpl8 T A 10: 111,128,974 (GRCm39) N853K probably benign Het
Pcsk4 G T 10: 80,159,557 (GRCm39) P405Q probably benign Het
Piwil4 A C 9: 14,650,685 (GRCm39) probably null Het
Pkhd1l1 T C 15: 44,361,967 (GRCm39) Y547H probably damaging Het
Pramel40 A G 5: 94,465,027 (GRCm39) D471G probably benign Het
Rft1 T C 14: 30,382,156 (GRCm39) L51P probably damaging Het
Rufy2 T G 10: 62,833,660 (GRCm39) L241V possibly damaging Het
Slc5a5 T C 8: 71,343,934 (GRCm39) I155V possibly damaging Het
Slc7a2 T G 8: 41,351,991 (GRCm39) M18R probably damaging Het
Snapc4 A G 2: 26,259,375 (GRCm39) S592P probably benign Het
Strn4 T C 7: 16,550,533 (GRCm39) W86R probably damaging Het
Tenm4 A G 7: 96,545,244 (GRCm39) N2457S probably damaging Het
Tent4a T A 13: 69,658,824 (GRCm39) D337V probably damaging Het
Timd4 C A 11: 46,706,309 (GRCm39) T37N possibly damaging Het
Tmem268 T A 4: 63,496,076 (GRCm39) N172K probably damaging Het
Trrap T A 5: 144,773,949 (GRCm39) V2855D probably benign Het
Tubb6 A T 18: 67,534,598 (GRCm39) T166S probably damaging Het
Tufm A G 7: 126,088,034 (GRCm39) Y179C probably benign Het
Tut7 T C 13: 59,933,597 (GRCm39) N1302D probably benign Het
Ube2r2 C T 4: 41,190,715 (GRCm39) S203L possibly damaging Het
Vldlr G T 19: 27,217,946 (GRCm39) V465L probably benign Het
Vmn2r16 C T 5: 109,488,231 (GRCm39) T368M probably benign Het
Vmn2r42 A G 7: 8,195,692 (GRCm39) F485L probably benign Het
Other mutations in Map1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Map1b APN 13 99,565,741 (GRCm39) missense unknown
IGL00533:Map1b APN 13 99,569,112 (GRCm39) missense unknown
IGL00801:Map1b APN 13 99,566,605 (GRCm39) missense unknown
IGL01141:Map1b APN 13 99,571,269 (GRCm39) missense probably damaging 1.00
IGL01418:Map1b APN 13 99,568,338 (GRCm39) missense unknown
IGL01464:Map1b APN 13 99,569,251 (GRCm39) missense unknown
IGL01690:Map1b APN 13 99,571,512 (GRCm39) missense probably damaging 1.00
IGL01991:Map1b APN 13 99,566,077 (GRCm39) missense unknown
IGL02245:Map1b APN 13 99,568,036 (GRCm39) missense unknown
IGL02376:Map1b APN 13 99,572,103 (GRCm39) missense probably damaging 1.00
IGL02380:Map1b APN 13 99,567,651 (GRCm39) missense unknown
IGL02442:Map1b APN 13 99,644,706 (GRCm39) missense probably damaging 1.00
IGL02465:Map1b APN 13 99,569,914 (GRCm39) missense unknown
IGL02816:Map1b APN 13 99,578,263 (GRCm39) missense probably damaging 1.00
IGL02859:Map1b APN 13 99,569,544 (GRCm39) missense unknown
IGL02934:Map1b APN 13 99,571,639 (GRCm39) missense probably benign 0.09
IGL02970:Map1b APN 13 99,567,242 (GRCm39) nonsense probably null
IGL03148:Map1b APN 13 99,578,203 (GRCm39) missense probably damaging 1.00
IGL03401:Map1b APN 13 99,563,776 (GRCm39) missense unknown
IGL03138:Map1b UTSW 13 99,562,334 (GRCm39) missense unknown
R0006:Map1b UTSW 13 99,571,810 (GRCm39) missense probably damaging 1.00
R0006:Map1b UTSW 13 99,571,810 (GRCm39) missense probably damaging 1.00
R0035:Map1b UTSW 13 99,571,846 (GRCm39) missense probably damaging 1.00
R0069:Map1b UTSW 13 99,566,356 (GRCm39) missense unknown
R0315:Map1b UTSW 13 99,567,624 (GRCm39) missense unknown
R0539:Map1b UTSW 13 99,570,526 (GRCm39) missense unknown
R0548:Map1b UTSW 13 99,568,191 (GRCm39) missense unknown
R0613:Map1b UTSW 13 99,578,149 (GRCm39) missense probably damaging 1.00
R0730:Map1b UTSW 13 99,566,274 (GRCm39) nonsense probably null
R1103:Map1b UTSW 13 99,563,974 (GRCm39) splice site probably benign
R1300:Map1b UTSW 13 99,569,029 (GRCm39) missense unknown
R1353:Map1b UTSW 13 99,563,834 (GRCm39) missense unknown
R1387:Map1b UTSW 13 99,569,158 (GRCm39) missense unknown
R1481:Map1b UTSW 13 99,567,679 (GRCm39) missense unknown
R1509:Map1b UTSW 13 99,568,036 (GRCm39) missense unknown
R1521:Map1b UTSW 13 99,569,247 (GRCm39) missense unknown
R1604:Map1b UTSW 13 99,566,080 (GRCm39) missense unknown
R1649:Map1b UTSW 13 99,652,986 (GRCm39) missense probably benign 0.03
R1651:Map1b UTSW 13 99,569,091 (GRCm39) missense unknown
R1661:Map1b UTSW 13 99,568,437 (GRCm39) missense unknown
R1665:Map1b UTSW 13 99,568,437 (GRCm39) missense unknown
R1770:Map1b UTSW 13 99,567,001 (GRCm39) missense unknown
R1926:Map1b UTSW 13 99,567,200 (GRCm39) missense unknown
R1928:Map1b UTSW 13 99,567,454 (GRCm39) missense unknown
R2093:Map1b UTSW 13 99,566,178 (GRCm39) missense unknown
R2110:Map1b UTSW 13 99,567,629 (GRCm39) missense unknown
R2116:Map1b UTSW 13 99,567,152 (GRCm39) missense unknown
R2164:Map1b UTSW 13 99,565,846 (GRCm39) missense unknown
R2207:Map1b UTSW 13 99,567,591 (GRCm39) missense unknown
R2273:Map1b UTSW 13 99,568,592 (GRCm39) missense unknown
R2443:Map1b UTSW 13 99,566,919 (GRCm39) missense unknown
R3054:Map1b UTSW 13 99,569,250 (GRCm39) missense unknown
R3766:Map1b UTSW 13 99,570,595 (GRCm39) missense unknown
R3911:Map1b UTSW 13 99,567,580 (GRCm39) missense unknown
R4005:Map1b UTSW 13 99,566,415 (GRCm39) missense unknown
R4130:Map1b UTSW 13 99,568,188 (GRCm39) missense unknown
R4513:Map1b UTSW 13 99,580,741 (GRCm39) missense probably damaging 1.00
R4613:Map1b UTSW 13 99,566,810 (GRCm39) nonsense probably null
R4633:Map1b UTSW 13 99,571,450 (GRCm39) missense probably damaging 1.00
R4646:Map1b UTSW 13 99,568,977 (GRCm39) missense unknown
R4690:Map1b UTSW 13 99,567,576 (GRCm39) missense unknown
R4704:Map1b UTSW 13 99,566,983 (GRCm39) missense unknown
R4836:Map1b UTSW 13 99,567,562 (GRCm39) missense unknown
R4916:Map1b UTSW 13 99,569,808 (GRCm39) missense unknown
R4951:Map1b UTSW 13 99,568,935 (GRCm39) missense unknown
R4960:Map1b UTSW 13 99,568,720 (GRCm39) missense probably benign 0.23
R4961:Map1b UTSW 13 99,572,161 (GRCm39) missense probably damaging 1.00
R5030:Map1b UTSW 13 99,570,682 (GRCm39) missense unknown
R5090:Map1b UTSW 13 99,566,534 (GRCm39) nonsense probably null
R5469:Map1b UTSW 13 99,565,846 (GRCm39) missense unknown
R5820:Map1b UTSW 13 99,569,332 (GRCm39) missense unknown
R5885:Map1b UTSW 13 99,566,589 (GRCm39) missense unknown
R5915:Map1b UTSW 13 99,566,839 (GRCm39) missense unknown
R5923:Map1b UTSW 13 99,569,661 (GRCm39) missense unknown
R6063:Map1b UTSW 13 99,567,645 (GRCm39) missense unknown
R6102:Map1b UTSW 13 99,562,381 (GRCm39) missense unknown
R6218:Map1b UTSW 13 99,569,714 (GRCm39) missense unknown
R6435:Map1b UTSW 13 99,652,871 (GRCm39) missense probably damaging 0.99
R6663:Map1b UTSW 13 99,566,530 (GRCm39) missense unknown
R6765:Map1b UTSW 13 99,562,449 (GRCm39) missense unknown
R6860:Map1b UTSW 13 99,571,275 (GRCm39) missense probably damaging 1.00
R6997:Map1b UTSW 13 99,567,142 (GRCm39) missense unknown
R7001:Map1b UTSW 13 99,567,101 (GRCm39) missense unknown
R7310:Map1b UTSW 13 99,570,163 (GRCm39) missense unknown
R7349:Map1b UTSW 13 99,570,148 (GRCm39) missense unknown
R7448:Map1b UTSW 13 99,644,648 (GRCm39) missense probably damaging 0.99
R7449:Map1b UTSW 13 99,644,648 (GRCm39) missense probably damaging 0.99
R7452:Map1b UTSW 13 99,644,648 (GRCm39) missense probably damaging 0.99
R7810:Map1b UTSW 13 99,568,390 (GRCm39) missense unknown
R7820:Map1b UTSW 13 99,567,685 (GRCm39) missense unknown
R8396:Map1b UTSW 13 99,570,621 (GRCm39) missense unknown
R8470:Map1b UTSW 13 99,652,950 (GRCm39) missense probably damaging 0.98
R8535:Map1b UTSW 13 99,571,662 (GRCm39) missense probably damaging 1.00
R8777-TAIL:Map1b UTSW 13 99,567,304 (GRCm39) missense unknown
R8812:Map1b UTSW 13 99,569,323 (GRCm39) missense unknown
R8903:Map1b UTSW 13 99,569,017 (GRCm39) nonsense probably null
R8928:Map1b UTSW 13 99,568,624 (GRCm39) missense unknown
R8954:Map1b UTSW 13 99,570,735 (GRCm39) missense unknown
R9164:Map1b UTSW 13 99,568,816 (GRCm39) nonsense probably null
R9164:Map1b UTSW 13 99,562,351 (GRCm39) missense unknown
R9190:Map1b UTSW 13 99,571,914 (GRCm39) missense probably damaging 0.99
R9334:Map1b UTSW 13 99,568,148 (GRCm39) missense unknown
R9339:Map1b UTSW 13 99,567,570 (GRCm39) missense unknown
R9357:Map1b UTSW 13 99,566,708 (GRCm39) nonsense probably null
R9430:Map1b UTSW 13 99,570,616 (GRCm39) missense unknown
RF003:Map1b UTSW 13 99,567,258 (GRCm39) missense unknown
X0019:Map1b UTSW 13 99,568,920 (GRCm39) missense unknown
X0019:Map1b UTSW 13 99,566,476 (GRCm39) missense unknown
Z1088:Map1b UTSW 13 99,644,623 (GRCm39) missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- ATCTTCTTCATCTGGAGATCCGG -3'
(R):5'- TGTTCCTCCCAGAGAGATGTCC -3'

Sequencing Primer
(F):5'- TAGGCATAGTTAAAGTCTCCGG -3'
(R):5'- CCCAGAGAGATGTCCTTATATGC -3'
Posted On 2021-03-08