Incidental Mutation 'R8777:Lrpprc'
ID 664780
Institutional Source Beutler Lab
Gene Symbol Lrpprc
Ensembl Gene ENSMUSG00000024120
Gene Name leucine-rich PPR-motif containing
Synonyms Lrp130, 3110001K13Rik
MMRRC Submission 068720-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8777 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 85012675-85098214 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 85058657 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Histidine at position 734 (Q734H)
Ref Sequence ENSEMBL: ENSMUSP00000107927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112308]
AlphaFold Q6PB66
Predicted Effect probably benign
Transcript: ENSMUST00000112308
AA Change: Q734H

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000107927
Gene: ENSMUSG00000024120
AA Change: Q734H

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 32 50 N/A INTRINSIC
low complexity region 123 136 N/A INTRINSIC
Pfam:PPR_3 196 228 9.1e-4 PFAM
Pfam:PPR 197 227 2.3e-4 PFAM
Pfam:PPR_3 231 264 7.9e-6 PFAM
Pfam:PPR 232 262 4e-4 PFAM
Pfam:PPR_3 266 297 9.7e-3 PFAM
internal_repeat_2 391 477 3.13e-7 PROSPERO
Pfam:PPR 750 778 3.4e-4 PFAM
low complexity region 1017 1028 N/A INTRINSIC
internal_repeat_1 1042 1362 1.09e-11 PROSPERO
low complexity region 1366 1375 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a leucine-rich protein that has multiple pentatricopeptide repeats (PPR). The precise role of this protein is unknown but studies suggest it may play a role in cytoskeletal organization, vesicular transport, or in transcriptional regulation of both nuclear and mitochondrial genes. The protein localizes primarily to mitochondria and is predicted to have an N-terminal mitochondrial targeting sequence. Mutations in this gene are associated with the French-Canadian type of Leigh syndrome. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit embryonic lethality during organogenesis associated with growth retardation. Mice homozygous for a knock-out allele exhibit embryonic lethality between somite formation and embryo turning. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted(3) Gene trapped(10)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A T 5: 8,989,894 (GRCm39) T816S probably benign Het
Aff4 G A 11: 53,290,783 (GRCm39) S581N probably damaging Het
Aimp2 G A 5: 143,839,825 (GRCm39) A253V probably damaging Het
Arl6ip4 T G 5: 124,254,611 (GRCm39) S35A probably benign Het
Atp1a4 A T 1: 172,059,869 (GRCm39) Y787N probably damaging Het
Btbd8 T G 5: 107,658,293 (GRCm39) I1621R probably damaging Het
Ccdc169 T C 3: 55,058,334 (GRCm39) S13P probably damaging Het
Ccdc186 G A 19: 56,801,793 (GRCm39) S108F probably damaging Het
Ccdc39 G A 3: 33,893,282 (GRCm39) T101I probably benign Het
Cdh13 G T 8: 119,963,706 (GRCm39) probably null Het
Clec1b A T 6: 129,380,537 (GRCm39) E151V probably benign Het
Cplx1 T A 5: 108,673,435 (GRCm39) probably null Het
Diablo T A 5: 123,655,990 (GRCm39) I150F unknown Het
Esp31 T C 17: 38,955,582 (GRCm39) V75A probably benign Het
Gm49336 G A 14: 60,466,185 (GRCm39) L458F probably damaging Het
Grin3b A T 10: 79,808,972 (GRCm39) S241C possibly damaging Het
Gxylt2 A G 6: 100,727,432 (GRCm39) N182S probably damaging Het
Hephl1 T G 9: 14,972,090 (GRCm39) D950A probably benign Het
Hkdc1 A G 10: 62,234,612 (GRCm39) I556T possibly damaging Het
Ints4 C A 7: 97,134,227 (GRCm39) A53D probably damaging Het
Kmt5c T C 7: 4,745,712 (GRCm39) V124A possibly damaging Het
Map1b T C 13: 99,567,304 (GRCm39) T1806A unknown Het
Mcmbp A T 7: 128,308,855 (GRCm39) F389I probably damaging Het
Mcrs1 C T 15: 99,141,237 (GRCm39) G422S probably damaging Het
Mgam A G 6: 40,632,185 (GRCm39) H173R probably damaging Het
Mib1 G A 18: 10,747,422 (GRCm39) G200S probably benign Het
Myh13 A T 11: 67,252,161 (GRCm39) Q1423L possibly damaging Het
Myh2 A G 11: 67,083,398 (GRCm39) R1454G possibly damaging Het
Mylk4 C T 13: 32,913,089 (GRCm39) V70I probably benign Het
Myof A G 19: 37,968,841 (GRCm39) V358A probably benign Het
Ncor1 T A 11: 62,324,492 (GRCm39) I48F probably benign Het
Ncor1 T A 11: 62,324,494 (GRCm39) H47L probably damaging Het
Neurog2 G T 3: 127,427,742 (GRCm39) R122L probably damaging Het
Npdc1 T A 2: 25,298,129 (GRCm39) L193Q probably damaging Het
Nrxn3 A G 12: 89,227,234 (GRCm39) N290D probably damaging Het
Nynrin T C 14: 56,109,120 (GRCm39) M1409T probably benign Het
Oas1h T C 5: 121,005,107 (GRCm39) L185P probably damaging Het
Or10x4 A T 1: 174,218,848 (GRCm39) Y71F probably damaging Het
Or2z2 C T 11: 58,346,757 (GRCm39) W6* probably null Het
Or6c3 T A 10: 129,309,374 (GRCm39) V271E possibly damaging Het
Osbpl8 T A 10: 111,128,974 (GRCm39) N853K probably benign Het
Pcsk4 G T 10: 80,159,557 (GRCm39) P405Q probably benign Het
Piwil4 A C 9: 14,650,685 (GRCm39) probably null Het
Pkhd1l1 T C 15: 44,361,967 (GRCm39) Y547H probably damaging Het
Pramel40 A G 5: 94,465,027 (GRCm39) D471G probably benign Het
Rft1 T C 14: 30,382,156 (GRCm39) L51P probably damaging Het
Rufy2 T G 10: 62,833,660 (GRCm39) L241V possibly damaging Het
Slc5a5 T C 8: 71,343,934 (GRCm39) I155V possibly damaging Het
Slc7a2 T G 8: 41,351,991 (GRCm39) M18R probably damaging Het
Snapc4 A G 2: 26,259,375 (GRCm39) S592P probably benign Het
Strn4 T C 7: 16,550,533 (GRCm39) W86R probably damaging Het
Tenm4 A G 7: 96,545,244 (GRCm39) N2457S probably damaging Het
Tent4a T A 13: 69,658,824 (GRCm39) D337V probably damaging Het
Timd4 C A 11: 46,706,309 (GRCm39) T37N possibly damaging Het
Tmem268 T A 4: 63,496,076 (GRCm39) N172K probably damaging Het
Trrap T A 5: 144,773,949 (GRCm39) V2855D probably benign Het
Tubb6 A T 18: 67,534,598 (GRCm39) T166S probably damaging Het
Tufm A G 7: 126,088,034 (GRCm39) Y179C probably benign Het
Tut7 T C 13: 59,933,597 (GRCm39) N1302D probably benign Het
Ube2r2 C T 4: 41,190,715 (GRCm39) S203L possibly damaging Het
Vldlr G T 19: 27,217,946 (GRCm39) V465L probably benign Het
Vmn2r16 C T 5: 109,488,231 (GRCm39) T368M probably benign Het
Vmn2r42 A G 7: 8,195,692 (GRCm39) F485L probably benign Het
Other mutations in Lrpprc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Lrpprc APN 17 85,057,953 (GRCm39) missense possibly damaging 0.91
IGL01319:Lrpprc APN 17 85,012,840 (GRCm39) utr 3 prime probably benign
IGL01380:Lrpprc APN 17 85,030,158 (GRCm39) missense probably benign
IGL01560:Lrpprc APN 17 85,015,547 (GRCm39) missense probably benign 0.07
IGL01582:Lrpprc APN 17 85,061,971 (GRCm39) missense probably null 0.00
IGL01996:Lrpprc APN 17 85,080,698 (GRCm39) missense probably benign
IGL02109:Lrpprc APN 17 85,033,998 (GRCm39) nonsense probably null
IGL02163:Lrpprc APN 17 85,060,900 (GRCm39) missense probably damaging 0.97
IGL02248:Lrpprc APN 17 85,078,895 (GRCm39) missense probably damaging 0.99
IGL02503:Lrpprc APN 17 85,033,767 (GRCm39) missense probably benign
IGL02545:Lrpprc APN 17 85,082,853 (GRCm39) missense probably benign
IGL02570:Lrpprc APN 17 85,057,981 (GRCm39) missense probably damaging 1.00
IGL02636:Lrpprc APN 17 85,060,532 (GRCm39) unclassified probably benign
IGL02943:Lrpprc APN 17 85,078,878 (GRCm39) missense probably benign 0.00
IGL03008:Lrpprc APN 17 85,058,675 (GRCm39) missense probably benign 0.05
elusory UTSW 17 85,020,215 (GRCm39) missense probably benign 0.01
phantom UTSW 17 85,079,575 (GRCm39) missense probably damaging 1.00
R6807_Lrpprc_629 UTSW 17 85,056,531 (GRCm39) missense possibly damaging 0.93
Stereotype UTSW 17 85,074,483 (GRCm39) missense probably damaging 1.00
thus UTSW 17 85,078,355 (GRCm39) missense probably benign 0.01
P0023:Lrpprc UTSW 17 85,033,766 (GRCm39) missense probably benign 0.00
R0027:Lrpprc UTSW 17 85,074,435 (GRCm39) nonsense probably null
R0027:Lrpprc UTSW 17 85,074,435 (GRCm39) nonsense probably null
R0302:Lrpprc UTSW 17 85,047,506 (GRCm39) missense possibly damaging 0.76
R0389:Lrpprc UTSW 17 85,060,540 (GRCm39) critical splice donor site probably null
R0448:Lrpprc UTSW 17 85,078,322 (GRCm39) missense probably benign 0.09
R1396:Lrpprc UTSW 17 85,033,731 (GRCm39) missense possibly damaging 0.68
R1759:Lrpprc UTSW 17 85,047,509 (GRCm39) missense probably damaging 1.00
R2019:Lrpprc UTSW 17 85,059,759 (GRCm39) missense possibly damaging 0.56
R2169:Lrpprc UTSW 17 85,077,505 (GRCm39) missense probably benign 0.00
R2312:Lrpprc UTSW 17 85,080,686 (GRCm39) missense probably damaging 0.96
R2319:Lrpprc UTSW 17 85,033,818 (GRCm39) missense probably benign
R2568:Lrpprc UTSW 17 85,034,077 (GRCm39) missense probably damaging 1.00
R3013:Lrpprc UTSW 17 85,074,497 (GRCm39) missense probably benign 0.04
R3620:Lrpprc UTSW 17 85,077,452 (GRCm39) missense probably benign 0.01
R3789:Lrpprc UTSW 17 85,078,956 (GRCm39) missense probably benign 0.25
R3848:Lrpprc UTSW 17 85,078,355 (GRCm39) missense probably benign 0.01
R3973:Lrpprc UTSW 17 85,078,269 (GRCm39) critical splice donor site probably null
R4111:Lrpprc UTSW 17 85,033,766 (GRCm39) missense probably benign 0.00
R4164:Lrpprc UTSW 17 85,038,617 (GRCm39) missense possibly damaging 0.47
R4331:Lrpprc UTSW 17 85,047,970 (GRCm39) critical splice donor site probably null
R4531:Lrpprc UTSW 17 85,020,215 (GRCm39) missense probably benign 0.01
R4832:Lrpprc UTSW 17 85,014,584 (GRCm39) missense probably benign 0.24
R4947:Lrpprc UTSW 17 85,078,966 (GRCm39) missense probably benign 0.02
R5134:Lrpprc UTSW 17 85,058,684 (GRCm39) missense probably benign 0.00
R5333:Lrpprc UTSW 17 85,097,821 (GRCm39) missense probably benign 0.01
R5950:Lrpprc UTSW 17 85,047,598 (GRCm39) missense possibly damaging 0.86
R5972:Lrpprc UTSW 17 85,020,250 (GRCm39) missense possibly damaging 0.88
R6185:Lrpprc UTSW 17 85,074,452 (GRCm39) missense probably benign
R6253:Lrpprc UTSW 17 85,048,065 (GRCm39) missense probably benign 0.00
R6488:Lrpprc UTSW 17 85,058,781 (GRCm39) missense probably damaging 1.00
R6807:Lrpprc UTSW 17 85,056,531 (GRCm39) missense possibly damaging 0.93
R6911:Lrpprc UTSW 17 85,063,711 (GRCm39) missense possibly damaging 0.67
R6933:Lrpprc UTSW 17 85,030,131 (GRCm39) missense probably benign 0.42
R6955:Lrpprc UTSW 17 85,084,417 (GRCm39) missense probably damaging 0.98
R7448:Lrpprc UTSW 17 85,079,567 (GRCm39) missense probably damaging 0.99
R7727:Lrpprc UTSW 17 85,084,375 (GRCm39) missense probably benign 0.00
R8003:Lrpprc UTSW 17 85,059,745 (GRCm39) missense probably benign 0.01
R8178:Lrpprc UTSW 17 85,079,575 (GRCm39) missense probably damaging 1.00
R8310:Lrpprc UTSW 17 85,080,524 (GRCm39) missense probably damaging 1.00
R8322:Lrpprc UTSW 17 85,047,496 (GRCm39) critical splice donor site probably null
R8389:Lrpprc UTSW 17 85,080,742 (GRCm39) missense possibly damaging 0.79
R8560:Lrpprc UTSW 17 85,047,495 (GRCm39) splice site probably benign
R8777-TAIL:Lrpprc UTSW 17 85,058,657 (GRCm39) missense probably benign 0.30
R8868:Lrpprc UTSW 17 85,078,920 (GRCm39) missense probably damaging 0.99
R8970:Lrpprc UTSW 17 85,074,483 (GRCm39) missense probably damaging 1.00
R9042:Lrpprc UTSW 17 85,059,736 (GRCm39) critical splice donor site probably null
R9493:Lrpprc UTSW 17 85,015,548 (GRCm39) missense probably damaging 0.99
R9664:Lrpprc UTSW 17 85,020,262 (GRCm39) missense probably damaging 0.99
X0026:Lrpprc UTSW 17 85,018,090 (GRCm39) missense probably benign 0.42
Z1088:Lrpprc UTSW 17 85,077,928 (GRCm39) critical splice acceptor site probably null
Z1088:Lrpprc UTSW 17 85,039,212 (GRCm39) nonsense probably null
Z1176:Lrpprc UTSW 17 85,077,859 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CCCTGCAGGAAGTATGACATCAG -3'
(R):5'- AAAACTGGCTTGCACATGC -3'

Sequencing Primer
(F):5'- CTGCAGGAAGTATGACATCAGTAACC -3'
(R):5'- CAGACATGGTTATTGGTGG -3'
Posted On 2021-03-08