Incidental Mutation 'Z1186:Atp4a'
ID 664887
Institutional Source Beutler Lab
Gene Symbol Atp4a
Ensembl Gene ENSMUSG00000005553
Gene Name ATPase, H+/K+ exchanging, gastric, alpha polypeptide
Synonyms H+K+-transporting alpha 1, H+/K+-ATPase alpha
Accession Numbers
Essential gene? Probably non essential (E-score: 0.085) question?
Stock # Z1186 ()
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 30411634-30424959 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 30416782 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 495 (I495T)
Ref Sequence ENSEMBL: ENSMUSP00000131964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005692] [ENSMUST00000170371] [ENSMUST00000171014]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000005692
AA Change: I495T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000005692
Gene: ENSMUSG00000005553
AA Change: I495T

DomainStartEndE-ValueType
Pfam:H-K_ATPase_N 2 42 5.4e-23 PFAM
Cation_ATPase_N 52 126 2.26e-18 SMART
Pfam:E1-E2_ATPase 144 375 1.1e-57 PFAM
Pfam:Hydrolase 380 739 5.3e-16 PFAM
Pfam:HAD 383 736 1.9e-18 PFAM
Pfam:Cation_ATPase 436 531 1.6e-24 PFAM
Pfam:Cation_ATPase_C 809 1019 4.8e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170371
AA Change: I495T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131964
Gene: ENSMUSG00000005553
AA Change: I495T

DomainStartEndE-ValueType
Pfam:H-K_ATPase_N 2 42 4.9e-28 PFAM
Cation_ATPase_N 52 126 2.26e-18 SMART
Pfam:E1-E2_ATPase 145 376 1e-62 PFAM
Pfam:Hydrolase 380 730 9.3e-25 PFAM
Pfam:HAD 383 727 2.1e-15 PFAM
Pfam:Hydrolase_like2 436 531 4e-25 PFAM
Pfam:Cation_ATPase_C 800 1010 1.5e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171014
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of P-type cation-transporting ATPases. The gastric H+, K+-ATPase is a heterodimer consisting of a high molecular weight catalytic alpha subunit and a smaller but heavily glycosylated beta subunit. This enzyme is a proton pump that catalyzes the hydrolysis of ATP coupled with the exchange of H(+) and K(+) ions across the plasma membrane. It is also responsible for gastric acid secretion. This gene encodes a catalytic alpha subunit of the gastric H+, K+-ATPase. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in achlorhydria, hypergastrinemia, and abnormalities of the parietal cells. Mice homozygous for an ENU-induced allele exhibit iron-deficiency anemia. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 532 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700086D15Rik A G 11: 65,044,114 (GRCm39) W27R unknown Het
1700086D15Rik A G 11: 65,044,080 (GRCm39) F38S unknown Het
1700086D15Rik A C 11: 65,043,809 (GRCm39) V84G unknown Het
1700086D15Rik T A 11: 65,043,794 (GRCm39) Q89L unknown Het
1700086D15Rik A G 11: 65,044,128 (GRCm39) L22P unknown Het
1810065E05Rik C T 11: 58,313,027 (GRCm39) L27F probably benign Het
1810065E05Rik C T 11: 58,316,625 (GRCm39) L202F probably benign Het
1810065E05Rik C T 11: 58,313,060 (GRCm39) L38F possibly damaging Het
2200002D01Rik GCCTTCTTCTCCTTCTTCTCCTTCT GCCTTCTTCTCCTTCT 7: 28,947,029 (GRCm39) probably benign Het
2200002J24Rik T C 7: 30,399,215 (GRCm39) V3A probably benign Het
2810021J22Rik C T 11: 58,771,361 (GRCm39) A281V probably benign Het
4930438A08Rik A G 11: 58,184,844 (GRCm39) T521A unknown Het
4933427D14Rik G T 11: 72,080,442 (GRCm39) P408H probably damaging Het
4933427D14Rik AAAAGTAA AAA 11: 72,086,538 (GRCm39) probably null Het
4933427D14Rik A G 11: 72,086,569 (GRCm39) C281R possibly damaging Het
4933427D14Rik T G 11: 72,086,580 (GRCm39) K277T probably damaging Het
4933427D14Rik T TCCCCAGC 11: 72,086,590 (GRCm39) probably null Het
4933427D14Rik T C 11: 72,086,595 (GRCm39) Q272R probably damaging Het
4933427D14Rik G A 11: 72,089,308 (GRCm39) P192L probably benign Het
4933427D14Rik C A 11: 72,089,360 (GRCm39) A175S probably benign Het
4933427D14Rik T G 11: 72,089,750 (GRCm39) S45R probably damaging Het
4933427D14Rik G A 11: 72,067,535 (GRCm39) T585I possibly damaging Het
Akap10 T A 11: 61,806,096 (GRCm39) S211C probably benign Het
Alkbh6 G A 7: 30,011,719 (GRCm39) R81H probably damaging Het
Alox8 C T 11: 69,076,873 (GRCm39) R536Q probably benign Het
Alox8 A G 11: 69,088,322 (GRCm39) V76A probably benign Het
Aloxe3 A G 11: 69,019,501 (GRCm39) Q138R probably benign Het
Aloxe3 C T 11: 69,039,429 (GRCm39) A667V probably benign Het
Arhgap33 C G 7: 30,223,076 (GRCm39) R952P possibly damaging Het
Arhgap33 AGAGGA AGAGGAGGA 7: 30,223,904 (GRCm39) probably benign Het
Arhgap33 C G 7: 30,223,860 (GRCm39) G723A probably benign Het
Arhgef12 A G 9: 42,911,311 (GRCm39) V558A probably damaging Het
Art1 T C 7: 101,756,066 (GRCm39) W86R probably damaging Het
Aspa G T 11: 73,213,013 (GRCm39) L110I probably benign Het
Aurkb C T 11: 68,938,692 (GRCm39) R44W probably damaging Het
Aurkb T C 11: 68,938,696 (GRCm39) F45S probably benign Het
B9d1 A T 11: 61,396,029 (GRCm39) probably benign Het
Bnc1 G A 7: 81,623,007 (GRCm39) A740V probably benign Het
Borcs6 G A 11: 68,951,453 (GRCm39) R277Q possibly damaging Het
Braf C A 6: 39,702,187 (GRCm39) G15C unknown Het
Braf C G 6: 39,702,189 (GRCm39) G14A unknown Het
Brca2 G T 5: 150,460,048 (GRCm39) S441I probably damaging Het
Btnl10 T C 11: 58,810,138 (GRCm39) V93A probably benign Het
Btnl10 C T 11: 58,817,650 (GRCm39) T250I unknown Het
Btnl10 AAAGA AAAGAAGA 11: 58,814,753 (GRCm39) probably benign Het
Catsperg1 T C 7: 28,881,287 (GRCm39) H1089R possibly damaging Het
Catsperg1 C G 7: 28,881,297 (GRCm39) V1086L probably benign Het
Catsperg1 C T 7: 28,881,477 (GRCm39) R1061Q probably damaging Het
Catsperg1 T C 7: 28,881,547 (GRCm39) N1038D probably benign Het
Catsperg1 C T 7: 28,889,675 (GRCm39) R809Q probably benign Het
Catsperg1 G T 7: 28,881,286 (GRCm39) H1089Q possibly damaging Het
Ccdc42 C T 11: 68,478,017 (GRCm39) probably benign Het
Ccdc92b A G 11: 74,520,880 (GRCm39) M61V possibly damaging Het
Ccer2 G C 7: 28,456,593 (GRCm39) E112D possibly damaging Het
Ccer2 A C 7: 28,456,915 (GRCm39) S220R probably benign Het
Cd22 C T 7: 30,575,292 (GRCm39) R250H probably damaging Het
Cd22 A T 7: 30,566,478 (GRCm39) S814T probably benign Het
Cd22 T C 7: 30,566,891 (GRCm39) T796A probably benign Het
Chd3 C A 11: 69,239,271 (GRCm39) E1753D probably benign Het
Chd3 A G 11: 69,252,277 (GRCm39) W42R probably benign Het
Chst8 C T 7: 34,447,606 (GRCm39) R4Q probably damaging Het
Cluh CGAGCCTGAGCCTGAGCC CGAGCCTGAGCCTGAGCCTGAGCC 11: 74,560,343 (GRCm39) probably benign Het
Cluh AGCC AGCCTGGGCC 11: 74,560,357 (GRCm39) probably benign Het
Cntnap4 C A 8: 113,479,002 (GRCm39) L243I probably damaging Het
Cntrob C T 11: 69,196,404 (GRCm39) R677H probably benign Het
Cntrob G A 11: 69,198,882 (GRCm39) P622L probably benign Het
Cyb5d1 C A 11: 69,286,098 (GRCm39) A8S probably benign Het
Cyb5d1 A G 11: 69,286,028 (GRCm39) L31P probably benign Het
Cyp2d22 T C 15: 82,260,086 (GRCm39) T6A probably benign Het
Dmkn TGGCAACAGCAACAGTGGCAACAGCGGCAACAGCAACAGTGGCAACAGCGGCAACAGC TGGCAACAGCAACAGTGGCAACAGCGGCAACAGC 7: 30,464,826 (GRCm39) probably benign Het
Dmkn AGCAACAGTGGCAACAGCAACAGTGGCAACAGCGGCAACAGCAACAGTGGCAACAG AGCAACAGCGGCAACAGCAACAGTGGCAACAG 7: 30,464,818 (GRCm39) probably benign Het
Dmkn TGGAAGTGGTGGAAGTGGTGGAAGTGG TGGAAGTGGTGGAAGTGGTGGAAGTGGAGGAAGTGGTGGAAGTGGTGGAAGTGG 7: 30,466,602 (GRCm39) probably benign Het
Dmkn GGGTGGAAGTGGTGGAAGTGGTGGAAGTGGTGG GGGTGGAAGTGGTGGAAGTGGTGGAAGTGGTGGAAGTGGTGGAAGTGGTGGAAGTGGTGG 7: 30,466,599 (GRCm39) probably benign Het
Dmkn CAGGGGTGGAAGTGGTGGAAGTGGTGGAAG CAGGGGTGGAAGTGGTGGAAGTGGTGGAAGGGGTGGAAGTGGTGGAAGTGGTGGAAG 7: 30,466,596 (GRCm39) probably benign Het
Dnah9 G A 11: 66,038,207 (GRCm39) H110Y probably benign Het
Dnah9 A C 11: 65,976,000 (GRCm39) S1350A probably benign Het
Elac2 T C 11: 64,870,015 (GRCm39) S27P probably benign Het
Epn2 C A 11: 61,470,460 (GRCm39) probably benign Het
Fam114a2 G A 11: 57,380,940 (GRCm39) A438V probably benign Het
Fam114a2 A G 11: 57,374,858 (GRCm39) S494P probably benign Het
Fam114a2 C T 11: 57,405,060 (GRCm39) G14E probably benign Het
Fam114a2 T C 11: 57,390,623 (GRCm39) N304D probably benign Het
Fam114a2 C T 11: 57,390,581 (GRCm39) V318I probably benign Het
Fam83g G A 11: 61,594,020 (GRCm39) R518Q probably benign Het
Fam98c G T 7: 28,855,565 (GRCm39) L11M probably damaging Het
Fam98c C A 7: 28,855,192 (GRCm39) W77L probably benign Het
Fam98c G A 7: 28,852,883 (GRCm39) S50F probably benign Het
Fat2 T G 11: 55,200,625 (GRCm39) K816N probably benign Het
Fat2 TGTACCTCACCCCAGTACCT TGTACCT 11: 55,199,796 (GRCm39) probably null Het
Fbxo17 CCGCCGACGCCGACGCCGACGCCGACGCCGACG CCGCCGACGCCGACGCCGACGCCGACG 7: 28,432,169 (GRCm39) probably benign Het
Fbxo27 C T 7: 28,394,438 (GRCm39) R159C probably benign Het
Fbxo27 G A 7: 28,392,347 (GRCm39) probably benign Het
Fbxw10 G C 11: 62,738,118 (GRCm39) R4T probably benign Het
Fbxw10 G A 11: 62,767,671 (GRCm39) V836I probably benign Het
Fcgbp G C 7: 27,791,072 (GRCm39) E778Q probably benign Het
Fcgbp A G 7: 27,792,770 (GRCm39) M925V probably benign Het
Fcgbp C G 7: 27,803,309 (GRCm39) P1638A probably benign Het
Fcgbp T C 7: 27,785,616 (GRCm39) V351A probably benign Het
Fcgbp A C 7: 27,789,180 (GRCm39) D582A probably benign Het
Fcgbpl1 G A 7: 27,846,130 (GRCm39) E941K probably benign Het
Fcgbpl1 A G 7: 27,856,411 (GRCm39) H2066R probably benign Het
Fcgbpl1 A G 7: 27,830,997 (GRCm39) H70R probably benign Het
Ffar3 C T 7: 30,555,495 (GRCm39) probably benign Het
Fxyd1 T C 7: 30,751,377 (GRCm39) D61G Het
Fxyd5 C T 7: 30,734,588 (GRCm39) R179Q unknown Het
Fxyd5 G A 7: 30,737,356 (GRCm39) A65V possibly damaging Het
Galnt10 G A 11: 57,656,514 (GRCm39) V233I probably benign Het
Garre1 G A 7: 33,938,583 (GRCm39) A984V probably benign Het
Garre1 C T 7: 33,938,533 (GRCm39) V1001M probably benign Het
Garre1 C T 7: 33,945,185 (GRCm39) R565K probably benign Het
Gemin5 C G 11: 58,037,345 (GRCm39) E623D probably benign Het
Gemin5 C G 11: 58,030,401 (GRCm39) C808S probably benign Het
Gemin5 C G 11: 58,030,336 (GRCm39) A830P probably benign Het
Gemin5 T C 11: 58,020,897 (GRCm39) M1097V probably benign Het
Gemin5 T C 11: 58,016,044 (GRCm39) S1321G probably benign Het
Gemin5 C G 11: 58,013,115 (GRCm39) S1446T probably benign Het
Ggn TGCGG TGCGGCGGCGG 7: 28,870,900 (GRCm39) probably benign Het
Gjc2 A G 11: 59,067,318 (GRCm39) V388A unknown Het
Gjc2 ACCCTCCCT ACCCTCCCTCCCT 11: 59,073,561 (GRCm39) probably benign Het
Glod4 A G 11: 76,133,836 (GRCm39) V6A probably benign Het
Glod4 C A 11: 76,133,819 (GRCm39) probably null Het
Glp2r C A 11: 67,600,394 (GRCm39) R485L probably damaging Het
Glp2r C A 11: 67,661,662 (GRCm39) A13S probably benign Het
Glp2r C G 11: 67,600,472 (GRCm39) G459A probably benign Het
Glp2r A C 11: 67,630,949 (GRCm39) I309M probably benign Het
Glp2r C T 11: 67,630,993 (GRCm39) V295I probably benign Het
Glp2r A G 11: 67,631,878 (GRCm39) V283A probably benign Het
Glp2r T C 11: 67,631,885 (GRCm39) I281V probably benign Het
Glp2r T C 11: 67,633,129 (GRCm39) T235A probably benign Het
Glp2r A G 11: 67,635,773 (GRCm39) V189A probably benign Het
Glp2r C A 11: 67,600,470 (GRCm39) V460F probably benign Het
Gm12253 A C 11: 58,325,686 (GRCm39) E52D probably benign Het
Gm12253 A C 11: 58,326,237 (GRCm39) E84A probably benign Het
Gm12253 G A 11: 58,326,309 (GRCm39) S108N probably benign Het
Gm12253 G A 11: 58,331,835 (GRCm39) A215T possibly damaging Het
Gm12253 G C 11: 58,325,367 (GRCm39) S13T possibly damaging Het
Gm12253 A G 11: 58,325,658 (GRCm39) E43G probably benign Het
Gm12258 G A 11: 58,749,764 (GRCm39) R313H unknown Het
Gm12258 G A 11: 58,749,776 (GRCm39) G317E unknown Het
Gm12258 A T 11: 58,749,833 (GRCm39) E336V unknown Het
Gm12258 A G 11: 58,750,013 (GRCm39) probably benign Het
Gm12258 T A 11: 58,750,014 (GRCm39) probably benign Het
Gm12258 G C 11: 58,750,690 (GRCm39) G622R unknown Het
Gm12258 T G 11: 58,749,126 (GRCm39) S100R Het
Gm12258 C T 11: 58,749,262 (GRCm39) R146W Het
Gm6096 G A 7: 33,950,811 (GRCm39) A117T possibly damaging Het
Gm6096 G A 7: 33,950,817 (GRCm39) V119I possibly damaging Het
Gpatch1 G C 7: 35,017,770 (GRCm39) D23E probably benign Het
Gpatch1 C T 7: 34,980,797 (GRCm39) G908R unknown Het
Gpatch1 C T 7: 34,997,079 (GRCm39) R373Q possibly damaging Het
Gpi1 T C 7: 33,926,662 (GRCm39) N95D probably benign Het
Gps2 C T 11: 69,807,130 (GRCm39) A60V probably benign Het
Gramd1a G A 7: 30,843,198 (GRCm39) P37S possibly damaging Het
Gucy2e C A 11: 69,114,431 (GRCm39) A1033S probably benign Het
Gucy2e C G 11: 69,127,429 (GRCm39) G15R unknown Het
Guk1 G A 11: 59,082,747 (GRCm39) probably benign Het
Haspin A G 11: 73,028,777 (GRCm39) L104P probably benign Het
Haspin T C 11: 73,028,174 (GRCm39) Q305R probably benign Het
Haus5 C T 7: 30,357,052 (GRCm39) G460S probably damaging Het
Haus5 T G 7: 30,362,541 (GRCm39) K58T probably benign Het
Haus5 C T 7: 30,361,300 (GRCm39) A107T probably damaging Het
Haus5 T C 7: 30,361,072 (GRCm39) H156R probably benign Het
Haus5 C T 7: 30,358,332 (GRCm39) R321H probably damaging Het
Hes7 T C 11: 69,013,782 (GRCm39) S214P probably benign Het
Hic1 G A 11: 75,058,352 (GRCm39) T179M probably damaging Het
Hnrnpu G T 1: 178,164,591 (GRCm39) S182R probably benign Het
Iba57 CAGA CAGAGA 11: 59,052,329 (GRCm39) probably null Het
Iba57 C G 11: 59,053,865 (GRCm39) G36R unknown Het
Iba57 T C 11: 59,052,384 (GRCm39) T86A unknown Het
Iba57 T C 11: 59,052,381 (GRCm39) T87A unknown Het
Iba57 A AGC 11: 59,052,332 (GRCm39) probably null Het
Ifnl2 T C 7: 28,208,305 (GRCm39) N188S probably benign Het
Ifnl2 A T 7: 28,209,094 (GRCm39) F74I probably benign Het
Ifnl2 G A 7: 28,209,091 (GRCm39) P75S probably benign Het
Ifnl2 A G 7: 28,208,523 (GRCm39) S143P probably benign Het
Ifnl2 G T 7: 28,208,362 (GRCm39) A169D probably benign Het
Ifnl3 A G 7: 28,222,929 (GRCm39) M67V probably benign Het
Iftap T C 2: 101,440,950 (GRCm39) K18E probably benign Het
Igf1r GAGGAGCTGGAGA GAGGAGCTGGAGAAGGAGCTGGAGA 7: 67,875,916 (GRCm39) probably benign Het
Igf1r AGGAGCTGGAGATGGAGC AGGAGCTGGAGATGGAGCTGGAGATGGAGC 7: 67,875,917 (GRCm39) probably benign Het
Igf1r CTGGAGATGGAG CTGGAGATGGAGGTGGAGATGGAG 7: 67,875,922 (GRCm39) probably benign Het
Igf1r ATGGAGC ATGGAGCTGGAGCTGGAGC 7: 67,875,928 (GRCm39) probably benign Het
Igf1r GGAGC GGAGCTGGAGATCGAGC 7: 67,875,930 (GRCm39) probably benign Het
Igtp C G 11: 58,097,791 (GRCm39) L321V possibly damaging Het
Igtp T G 11: 58,097,169 (GRCm39) D113E probably damaging Het
Igtp C G 11: 58,097,944 (GRCm39) L372V probably benign Het
Irgm2 A G 11: 58,110,389 (GRCm39) N27D probably benign Het
Irgm2 T A 11: 58,110,339 (GRCm39) V10D probably benign Het
Irgm2 C G 11: 58,111,389 (GRCm39) T360S probably benign Het
Irgm2 G T 11: 58,111,238 (GRCm39) A310S possibly damaging Het
Irgm2 A C 11: 58,110,951 (GRCm39) H214P probably benign Het
Irgm2 G A 11: 58,110,924 (GRCm39) S205N probably benign Het
Irgm2 G A 11: 58,110,833 (GRCm39) V175I probably benign Het
Irgm2 T C 11: 58,110,780 (GRCm39) L157S probably benign Het
Irgm2 T C 11: 58,110,738 (GRCm39) I143T probably benign Het
Itgae T A 11: 72,994,713 (GRCm39) L22M possibly damaging Het
Itgae C G 11: 73,024,953 (GRCm39) S1028W probably benign Het
Itgae G T 11: 73,012,783 (GRCm39) G705V probably benign Het
Itgae A T 11: 73,012,757 (GRCm39) K696N probably benign Het
Itgae G A 11: 73,008,913 (GRCm39) V465I probably benign Het
Itgae A G 11: 73,006,466 (GRCm39) H378R probably benign Het
Itgae A T 11: 72,994,786 (GRCm39) Q46L probably damaging Het
Kif1c C T 11: 70,614,940 (GRCm39) P578L probably benign Het
Kirrel2 T A 7: 30,147,622 (GRCm39) E675D probably benign Het
Kmt2b C G 7: 30,284,732 (GRCm39) S720T probably benign Het
Kmt2b T C 7: 30,274,404 (GRCm39) Q2100R probably benign Het
Kndc1 G C 7: 139,490,729 (GRCm39) Q410H probably damaging Het
Krt26 C T 11: 99,228,643 (GRCm39) G30R probably damaging Het
Larp1 G A 11: 57,933,166 (GRCm39) V257I probably benign Het
Lgals4 T A 7: 28,535,353 (GRCm39) M79K probably benign Het
Lgi4 G A 7: 30,768,596 (GRCm39) E532K probably benign Het
Llgl1 ACCCCAGCCCTTCTGATTACTGCCCTCCCCAGC ACCCCAGC 11: 60,603,923 (GRCm39) probably null Het
Lypd8 G A 11: 58,275,489 (GRCm39) E75K probably benign Het
Lypd8 CAATCACCAACA CAATCACCAACAGTTCCCTCGCCTCTGTTACCCCACAAATCACCAACA 11: 58,281,059 (GRCm39) probably benign Het
Lypd8 ACCAACA ACCAACAGTTCCCTCGCCTCTGTTACCCCACAAATCCCCAACA 11: 58,281,064 (GRCm39) probably benign Het
Lypd8 A AGTTCCCTCGCCTCTGTTACCCCACAAATCCCCAACC 11: 58,281,070 (GRCm39) probably benign Het
Lypd8 T C 11: 58,273,601 (GRCm39) Y27H probably benign Het
Lypd8 C A 11: 58,275,475 (GRCm39) A70E possibly damaging Het
Lypd8l T G 11: 58,503,397 (GRCm39) S44R probably benign Het
Lypd8l G A 11: 58,499,335 (GRCm39) P161L probably benign Het
Lypd8l A G 11: 58,503,387 (GRCm39) L47P probably benign Het
Mapk7 CGCTGGTGCTGG CGCTGGTGCTGGTGCTGG 11: 61,381,038 (GRCm39) probably benign Het
Mapk7 GGTGCT GGTGCTTGTGCT 11: 61,381,042 (GRCm39) probably benign Het
Mapk7 TGGGGCAGGGGCAGGGGCAGG TGGCGCTGGGGCAGGGGCAGGGGCAGGGGCAGG 11: 61,381,053 (GRCm39) probably benign Het
Mdga2 T G 12: 66,615,727 (GRCm39) T627P possibly damaging Het
Mfap3 A T 11: 57,418,866 (GRCm39) I9F possibly damaging Het
Mfap3 G A 11: 57,418,902 (GRCm39) G21S probably benign Het
Mrm3 C T 11: 76,138,221 (GRCm39) P203L probably benign Het
Mrpl22 G A 11: 58,062,521 (GRCm39) A4T unknown Het
Mrpl55 A G 11: 59,094,999 (GRCm39) probably null Het
Mrpl55 A T 11: 59,095,415 (GRCm39) L26F probably benign Het
Mrps33 T C 6: 39,779,449 (GRCm39) Q82R possibly damaging Het
Myocd A G 11: 65,075,418 (GRCm39) S697P probably benign Het
Naalad2 A C 9: 18,297,110 (GRCm39) F59V possibly damaging Het
Nccrp1 T C 7: 28,246,461 (GRCm39) T34A probably benign Het
Nefh TTTGGCCTCAGCTGGTGACTTGGGCTCAGCTGGAGACTTGGCCTCACCTGGTGACTTG TTTGGCCTCACCTGGTGACTTG 11: 4,890,530 (GRCm39) probably benign Het
Nlgn2 A G 11: 69,719,220 (GRCm39) V210A possibly damaging Het
Nlrp1a C G 11: 71,033,355 (GRCm39) probably null Het
Nlrp1a T C 11: 70,983,069 (GRCm39) K1299R probably benign Het
Nlrp1a C T 11: 70,988,077 (GRCm39) R1131Q probably damaging Het
Nlrp1a T C 11: 70,990,442 (GRCm39) I1038V probably benign Het
Nlrp1a T C 11: 71,014,914 (GRCm39) E112G probably benign Het
Nlrp1b C G 11: 71,073,370 (GRCm39) E158Q probably benign Het
Nlrp1b T C 11: 71,073,280 (GRCm39) T188A probably benign Het
Nlrp1b A T 11: 71,073,266 (GRCm39) D192E probably benign Het
Nlrp1b A G 11: 71,073,148 (GRCm39) Y232H probably benign Het
Nlrp1b G C 11: 71,073,135 (GRCm39) T236R probably benign Het
Nlrp1b A G 11: 71,072,625 (GRCm39) I406T probably benign Het
Nlrp1b A C 11: 71,072,539 (GRCm39) S435A probably benign Het
Nlrp1b C A 11: 71,072,534 (GRCm39) M436I probably benign Het
Nlrp1b A T 11: 71,073,378 (GRCm39) M155K probably benign Het
Nlrp1b T A 11: 71,073,396 (GRCm39) Q149L probably benign Het
Nlrp1b T C 11: 71,073,503 (GRCm39) I113M probably benign Het
Nmur2 T C 11: 55,931,104 (GRCm39) I202M probably benign Het
Nphs1 T C 7: 30,159,775 (GRCm39) S43P probably damaging Het
Nrp1 C A 8: 129,224,419 (GRCm39) H727Q probably damaging Het
Obscn C T 11: 58,977,505 (GRCm39) R1865H probably benign Het
Obscn T C 11: 58,977,527 (GRCm39) R1858G probably benign Het
Obscn A G 11: 58,977,565 (GRCm39) V1845A probably benign Het
Obscn A G 11: 58,984,142 (GRCm39) F1771S probably benign Het
Obscn C T 11: 58,984,239 (GRCm39) V1739M possibly damaging Het
Obscn G T 11: 58,984,334 (GRCm39) A1707D possibly damaging Het
Obscn C T 11: 58,984,335 (GRCm39) A1707T probably benign Het
Obscn G A 11: 58,984,385 (GRCm39) A1690V probably benign Het
Obscn C T 11: 58,990,735 (GRCm39) A1613T possibly damaging Het
Obscn T C 11: 58,990,755 (GRCm39) H1606R probably benign Het
Obscn C G 11: 58,994,167 (GRCm39) A1572P probably damaging Het
Obscn T C 11: 58,994,340 (GRCm39) H1514R probably benign Het
Obscn G A 11: 58,994,364 (GRCm39) A1506V probably benign Het
Obscn T C 11: 59,003,380 (GRCm39) E1306G probably benign Het
Obscn T C 11: 59,013,563 (GRCm39) M1095V probably benign Het
Obscn C T 11: 59,018,892 (GRCm39) A949T probably benign Het
Obscn C T 11: 59,018,895 (GRCm39) V973M probably damaging Het
Obscn C T 11: 59,021,449 (GRCm39) R797H probably damaging Het
Obscn C T 11: 59,023,937 (GRCm39) A578T possibly damaging Het
Obscn G A 11: 59,024,066 (GRCm39) P535S probably damaging Het
Obscn C G 11: 59,024,072 (GRCm39) A533P probably benign Het
Obscn T C 11: 59,026,505 (GRCm39) I233V probably benign Het
Obscn C T 11: 58,940,306 (GRCm39) D5354N Het
Obscn C A 11: 58,940,614 (GRCm39) R4593S possibly damaging Het
Obscn T C 11: 58,940,623 (GRCm39) T5307A Het
Obscn G A 11: 58,942,383 (GRCm39) T4372M probably benign Het
Obscn T C 11: 58,943,439 (GRCm39) M4237V probably benign Het
Obscn C T 11: 58,944,594 (GRCm39) R4700Q probably benign Het
Obscn T C 11: 58,944,651 (GRCm39) K4681R probably benign Het
Obscn T C 11: 58,945,044 (GRCm39) E4658G probably benign Het
Obscn C T 11: 58,945,176 (GRCm39) R4614Q probably benign Het
Obscn T C 11: 58,946,331 (GRCm39) D4458G probably damaging Het
Obscn C T 11: 58,946,340 (GRCm39) R4455K probably benign Het
Obscn G T 11: 58,946,936 (GRCm39) A4066E possibly damaging Het
Obscn A G 11: 58,947,595 (GRCm39) M4478T Het
Obscn C T 11: 58,952,388 (GRCm39) G3894R probably benign Het
Obscn CCACACACACACAC CCACACACACAC 11: 58,954,279 (GRCm39) probably null Het
Obscn T C 11: 58,954,300 (GRCm39) T4037A Het
Obscn T C 11: 58,954,402 (GRCm39) K3727E probably damaging Het
Obscn G A 11: 58,957,973 (GRCm39) R3576C probably benign Het
Obscn C T 11: 58,958,655 (GRCm39) V3433I probably benign Het
Obscn C A 11: 58,960,757 (GRCm39) A3185S probably benign Het
Obscn C T 11: 58,967,334 (GRCm39) V2792I possibly damaging Het
Obscn G A 11: 58,969,984 (GRCm39) R53C probably damaging Het
Obscn C G 11: 58,970,722 (GRCm39) V2328L probably benign Het
Obscn G A 11: 58,891,715 (GRCm39) A6939V probably benign Het
Obscn C G 11: 58,900,019 (GRCm39) G938A probably benign Het
Obscn G C 11: 58,904,014 (GRCm39) T7320S probably benign Het
Obscn C T 11: 58,921,934 (GRCm39) R5954Q probably damaging Het
Obscn G C 11: 58,929,976 (GRCm39) P5080A probably benign Het
Obscn T A 11: 58,929,990 (GRCm39) Q5075L probably damaging Het
Obscn T C 11: 58,932,601 (GRCm39) I4869V probably benign Het
Obscn T C 11: 58,933,776 (GRCm39) T5363A probably benign Het
Obscn G A 11: 58,933,853 (GRCm39) A5337V probably benign Het
Obscn G A 11: 58,933,878 (GRCm39) R5329C probably benign Het
Obscn C A 11: 58,972,698 (GRCm39) G2116V possibly damaging Het
Or10a49 A C 7: 108,468,143 (GRCm39) F73V possibly damaging Het
Or11l3 C G 11: 58,516,130 (GRCm39) G61R probably benign Het
Or11l3 G A 11: 58,516,588 (GRCm39) P95S probably benign Het
Or11l3 T G 11: 58,516,619 (GRCm39) K84N probably benign Het
Or11l3 A C 11: 58,516,732 (GRCm39) C46G possibly damaging Het
Or11l3 G A 11: 58,516,075 (GRCm39) S79F probably benign Het
Or14a258 G T 7: 86,035,487 (GRCm39) P127H probably damaging Het
Or2ab1 A G 11: 58,488,356 (GRCm39) I39V probably benign Het
Or2ab1 A C 11: 58,488,344 (GRCm39) I35L probably benign Het
Or2ab1 A G 11: 58,488,776 (GRCm39) S179G probably benign Het
Or2ab1 A G 11: 58,488,491 (GRCm39) S84G possibly damaging Het
Or2ak4 C T 11: 58,648,895 (GRCm39) L135F probably benign Het
Or2ak4 G A 11: 58,648,793 (GRCm39) A101T probably benign Het
Or2ak4 A C 11: 58,649,186 (GRCm39) K232Q probably benign Het
Or2ak4 A C 11: 58,649,168 (GRCm39) I226L probably benign Het
Or2ak4 G A 11: 58,649,153 (GRCm39) V221M probably damaging Het
Or2ak4 A G 11: 58,648,931 (GRCm39) S147G probably benign Het
Or2ak5 G A 11: 58,611,922 (GRCm39) probably benign Het
Or2ak6 C T 11: 58,593,153 (GRCm39) L209F possibly damaging Het
Or2ak6 A C 11: 58,592,784 (GRCm39) I86L probably benign Het
Or2ak6 C A 11: 58,593,222 (GRCm39) Q232K probably benign Het
Or2ak7 T C 11: 58,574,815 (GRCm39) F39L probably benign Het
Or2ak7 G T 11: 58,574,758 (GRCm39) D20Y probably benign Het
Or2ak7 C T 11: 58,575,289 (GRCm39) H197Y probably benign Het
Or2ak7 G A 11: 58,575,083 (GRCm39) R128Q probably benign Het
Or2av9 C T 11: 58,381,123 (GRCm39) A153T probably benign Het
Or2av9 C A 11: 58,380,574 (GRCm39) E336* probably null Het
Or2av9 T C 11: 58,381,314 (GRCm39) Q89R probably benign Het
Or2t29 G T 11: 58,434,272 (GRCm39) S23Y probably benign Het
Or2t43 A T 11: 58,457,521 (GRCm39) S217T probably benign Het
Or2t43 G A 11: 58,457,388 (GRCm39) A261V probably benign Het
Or2t43 C T 11: 58,457,920 (GRCm39) V84I probably benign Het
Or2t44 A G 11: 58,677,773 (GRCm39) T238A probably damaging Het
Or2t46 T C 11: 58,471,757 (GRCm39) V29A probably benign Het
Or2t46 C T 11: 58,471,750 (GRCm39) H27Y probably benign Het
Or2t46 G C 11: 58,472,483 (GRCm39) S271T probably benign Het
Or2t46 T G 11: 58,472,122 (GRCm39) L151V probably benign Het
Or2t46 G A 11: 58,471,828 (GRCm39) V53I probably benign Het
Or2t47 C T 11: 58,442,801 (GRCm39) S88N probably benign Het
Or2t47 T C 11: 58,442,387 (GRCm39) K226R probably benign Het
Or2t47 C T 11: 58,442,940 (GRCm39) A42T probably benign Het
Or2t49 C G 11: 58,393,287 (GRCm39) V38L probably benign Het
Or2t49 GGTGGATTGGTATGTGGAT GGTGGAT 11: 58,393,212 (GRCm39) probably benign Het
Or2t49 GAGGTGGATTGGTA GA 11: 58,393,210 (GRCm39) probably benign Het
Or2t49 C T 11: 58,393,396 (GRCm39) M1I probably null Het
Or2w3 T G 11: 58,557,342 (GRCm39) I319R probably benign Het
Or2w3b T G 11: 58,623,200 (GRCm39) N264H probably benign Het
Or2w3b C A 11: 58,624,048 (GRCm39) probably benign Het
Or2w3b T C 11: 58,623,475 (GRCm39) H172R probably benign Het
Or5af2 A G 11: 58,707,887 (GRCm39) I18V probably benign Het
Or5af2 C G 11: 58,708,644 (GRCm39) P270R probably benign Het
Or5af2 T C 11: 58,708,508 (GRCm39) C225R probably benign Het
Or5af2 A C 11: 58,708,220 (GRCm39) I129L probably benign Het
Or5af2 T C 11: 58,708,122 (GRCm39) V96A probably benign Het
Or9e1 G C 11: 58,731,907 (GRCm39) probably benign Het
Or9e1 A G 11: 58,732,615 (GRCm39) H225R probably benign Het
Or9e1 G A 11: 58,732,569 (GRCm39) A210T probably benign Het
Or9e1 C T 11: 58,732,032 (GRCm39) L31F probably benign Het
Or9e1 G T 11: 58,731,945 (GRCm39) A2S probably benign Het
Ovca2 T C 11: 75,069,528 (GRCm39) T32A probably benign Het
Pimreg TCACA TCA 11: 71,935,801 (GRCm39) probably benign Het
Pimreg G A 11: 71,935,979 (GRCm39) R154H probably damaging Het
Pitpnm3 T C 11: 71,954,955 (GRCm39) K520E probably benign Het
Pitpnm3 C T 11: 72,010,969 (GRCm39) R21Q probably benign Het
Plekhg2 G A 7: 28,062,360 (GRCm39) P520L possibly damaging Het
Plekhg2 T A 7: 28,070,727 (GRCm39) probably benign Het
Prodh2 G A 7: 30,206,069 (GRCm39) A290T probably benign Het
Prpsap2 A C 11: 61,647,078 (GRCm39) V21G possibly damaging Het
Psmd8 T C 7: 28,879,745 (GRCm39) N109S probably benign Het
Psmd8 A C 7: 28,879,808 (GRCm39) V88G probably benign Het
Rabep1 C CT 11: 70,830,910 (GRCm39) probably null Het
Rai1 A G 11: 60,078,389 (GRCm39) N818D probably benign Het
Rap1gap2 C T 11: 74,487,721 (GRCm39) E52K probably benign Het
Rasgrp4 G A 7: 28,845,302 (GRCm39) G342S probably benign Het
Rasgrp4 A G 7: 28,847,985 (GRCm39) K443R probably benign Het
Rasgrp4 A G 7: 28,848,060 (GRCm39) E468G probably damaging Het
Rasgrp4 TGGCTTCCT TGGCTTCCTCGGCTTCCT 7: 28,850,017 (GRCm39) probably benign Het
Rasgrp4 TTCCT TTCCTCGTCGTCCT 7: 28,850,021 (GRCm39) probably benign Het
Rasgrp4 T C 7: 28,837,012 (GRCm39) S24P probably benign Het
Rasgrp4 G T 7: 28,838,241 (GRCm39) A72S probably benign Het
Rbm42 C A 7: 30,349,578 (GRCm39) probably benign Het
Rhpn2 G T 7: 35,084,826 (GRCm39) E573D probably benign Het
Rims1 C A 1: 22,449,706 (GRCm39) K339N Het
Rnf112 A G 11: 61,341,775 (GRCm39) L343P unknown Het
Rnf167 C CACAGGGA 11: 70,541,646 (GRCm39) probably null Het
Rtn4rl1 C T 11: 75,156,863 (GRCm39) P432S probably benign Het
Ryr1 C T 7: 28,781,902 (GRCm39) R2036Q possibly damaging Het
Safb2 A T 17: 56,870,246 (GRCm39) probably null Het
Sbsn G A 7: 30,451,273 (GRCm39) S96N probably benign Het
Sbsn G A 7: 30,452,317 (GRCm39) R444H probably benign Het
Scart1 G T 7: 139,804,403 (GRCm39) A493S possibly damaging Het
Scgb1b19 G T 7: 32,987,073 (GRCm39) E75* probably null Het
Scgb1b19 G A 7: 32,986,790 (GRCm39) G20E probably damaging Het
Scgb1b19 A T 7: 32,986,990 (GRCm39) Y47F probably damaging Het
Scgb2b11 TCCAGTCACCAGCAAGCCCAG TCCAG 7: 31,910,507 (GRCm39) probably null Het
Scgb2b2 A G 7: 31,004,240 (GRCm39) R113G unknown Het
Scgb2b3 T C 7: 31,059,592 (GRCm39) K61E probably benign Het
Scgb2b3 A G 7: 31,058,546 (GRCm39) F86L probably benign Het
Scgb2b7 G C 7: 31,404,547 (GRCm39) A51G probably benign Het
Scgb2b7 A T 7: 31,404,489 (GRCm39) S70R probably benign Het
Sfi1 ACA ACATCTTCCCAAAGCCAGTCA 11: 3,103,382 (GRCm39) probably benign Het
Sipa1l3 CCGCACGCACGCAC CCGCACGCAC 7: 29,031,636 (GRCm39) probably benign Het
Sipa1l3 C A 7: 29,031,372 (GRCm39) probably null Het
Slc2a4 GGCCG GG 11: 69,834,818 (GRCm39) probably benign Het
Slc2a4 GGGCCGG GGG 11: 69,834,817 (GRCm39) probably null Het
Slc2a4 GCC G 11: 69,834,819 (GRCm39) probably null Het
Slc6a4 A G 11: 76,903,858 (GRCm39) K152R probably benign Het
Slc6a4 G A 11: 76,901,382 (GRCm39) G39E probably benign Het
Slc7a10 A G 7: 34,885,956 (GRCm39) H17R probably benign Het
Slc8a1 C G 17: 81,955,311 (GRCm39) G576R probably damaging Het
Smcr8 A G 11: 60,668,806 (GRCm39) probably benign Het
Smcr8 C A 11: 60,670,699 (GRCm39) R616S probably benign Het
Smcr8 T C 11: 60,669,932 (GRCm39) V360A probably benign Het
Smg6 G T 11: 75,047,092 (GRCm39) A1262S probably benign Het
Spns3 T C 11: 72,440,986 (GRCm39) S17G probably benign Het
Spns3 T C 11: 72,440,863 (GRCm39) I58V probably benign Het
Spns3 G A 11: 72,440,917 (GRCm39) P40S probably benign Het
Srebf1 C T 11: 60,097,061 (GRCm39) V256M probably benign Het
Sspo A C 6: 48,445,441 (GRCm39) K2294T probably benign Het
Tekt1 T C 11: 72,250,597 (GRCm39) Q33R probably benign Het
Timm22 T G 11: 76,297,943 (GRCm39) V18G probably benign Het
Tmem102 C G 11: 69,695,902 (GRCm39) G53A possibly damaging Het
Tmem102 G C 11: 69,695,927 (GRCm39) R45G probably benign Het
Tmem11 A G 11: 60,766,658 (GRCm39) probably benign Het
Tom1l2 C T 11: 60,132,682 (GRCm39) A414T probably benign Het
Top3a C T 11: 60,641,410 (GRCm39) G425S probably benign Het
Trim16 T C 11: 62,731,572 (GRCm39) V481A probably benign Het
Trim16 C A 11: 62,731,675 (GRCm39) D515E probably benign Het
Trim16 C T 11: 62,711,428 (GRCm39) A33V probably benign Het
Trim16 G C 11: 62,711,502 (GRCm39) V58L probably benign Het
Trim16 TGAAGA TGAAGAAGA 11: 62,711,516 (GRCm39) probably benign Het
Trim16 AAG AAGCAG 11: 62,711,518 (GRCm39) probably benign Het
Trim16 G A 11: 62,727,643 (GRCm39) E322K probably benign Het
Trim17 G A 11: 58,856,331 (GRCm39) M129I probably benign Het
Trim17 A G 11: 58,861,272 (GRCm39) N259S probably benign Het
Trim58 A G 11: 58,542,486 (GRCm39) N482S probably benign Het
Trim58 C A 11: 58,531,684 (GRCm39) L131M possibly damaging Het
Trpv1 C A 11: 73,145,117 (GRCm39) D734E probably benign Het
Trpv1 C G 11: 73,131,427 (GRCm39) P322A possibly damaging Het
Trpv3 A G 11: 73,174,502 (GRCm39) T290A probably benign Het
Trpv3 G A 11: 73,169,803 (GRCm39) A125T probably benign Het
Trpv3 C T 11: 73,160,513 (GRCm39) A9V probably benign Het
Tsc22d4 C T 5: 137,756,611 (GRCm39) S13L possibly damaging Het
Tshz3 T C 7: 36,468,341 (GRCm39) I110T probably benign Het
Tshz3 A G 7: 36,469,999 (GRCm39) S663G probably benign Het
Tvp23b A C 11: 62,772,769 (GRCm39) N7H possibly damaging Het
Ubap2l G T 3: 89,916,543 (GRCm39) H915Q unknown Het
Ubr4 C G 4: 139,137,964 (GRCm39) A1107G probably benign Het
Usp43 C T 11: 67,747,332 (GRCm39) G792S probably benign Het
Usp43 AGGGC AGGGCAGGGGATGAACCTCGGGC 11: 67,746,545 (GRCm39) probably benign Het
Utrn C T 10: 12,545,491 (GRCm39) R1718H probably damaging Het
Vamp2 G A 11: 68,980,889 (GRCm39) G124R possibly damaging Het
Vamp2 C T 11: 68,979,411 (GRCm39) probably benign Het
Vmn2r71 G T 7: 85,273,094 (GRCm39) C636F probably damaging Het
Wdr62 C T 7: 29,950,184 (GRCm39) C752Y probably damaging Het
Xaf1 T C 11: 72,199,881 (GRCm39) L206S unknown Het
Xaf1 G C 11: 72,199,856 (GRCm39) V198L unknown Het
Xaf1 T TGGCCCGCC 11: 72,199,849 (GRCm39) probably null Het
Xaf1 GGCT GGCTGGCCAGCT 11: 72,199,846 (GRCm39) probably null Het
Xaf1 T G 11: 72,199,792 (GRCm39) C176W unknown Het
Xaf1 A G 11: 72,199,476 (GRCm39) E71G probably benign Het
Xaf1 C A 11: 72,197,434 (GRCm39) L137I probably benign Het
Xaf1 G A 11: 72,197,426 (GRCm39) R134H probably benign Het
Xaf1 G C 11: 72,197,429 (GRCm39) C135S probably damaging Het
Zbtb32 G C 7: 30,290,102 (GRCm39) T304S probably benign Het
Zfp14 C T 7: 29,738,577 (GRCm39) G136E probably damaging Het
Zfp260 G A 7: 29,804,463 (GRCm39) R121K probably benign Het
Zfp286 G A 11: 62,675,782 (GRCm39) T60M probably damaging Het
Zfp286 A G 11: 62,678,795 (GRCm39) V44A probably benign Het
Zfp287 C G 11: 62,606,175 (GRCm39) C244S probably benign Het
Zfp287 G A 11: 62,613,757 (GRCm39) R225* probably null Het
Zfp287 C T 11: 62,604,633 (GRCm39) R758H probably benign Het
Zfp30 T C 7: 29,491,902 (GRCm39) L133P possibly damaging Het
Zfp30 G A 7: 29,492,196 (GRCm39) S231N probably benign Het
Zfp30 C T 7: 29,492,021 (GRCm39) P173S probably benign Het
Zfp30 G C 7: 29,492,004 (GRCm39) R167P probably benign Het
Zfp30 A T 7: 29,491,932 (GRCm39) Y143F probably benign Het
Zfp383 A G 7: 29,614,140 (GRCm39) S132G probably benign Het
Zfp383 A C 7: 29,615,190 (GRCm39) S482R probably benign Het
Zfp383 T C 7: 29,614,146 (GRCm39) S134P probably benign Het
Zfp39 T A 11: 58,781,967 (GRCm39) H265L probably damaging Het
Zfp39 T A 11: 58,781,751 (GRCm39) K337M probably benign Het
Zfp39 A G 11: 58,781,724 (GRCm39) V346A probably benign Het
Zfp39 A G 11: 58,781,605 (GRCm39) S386P probably benign Het
Zfp39 G T 11: 58,781,597 (GRCm39) N388K probably benign Het
Zfp39 T C 11: 58,781,526 (GRCm39) N412S possibly damaging Het
Zfp39 T C 11: 58,781,274 (GRCm39) D496G possibly damaging Het
Zfp39 G C 11: 58,781,273 (GRCm39) D496E probably benign Het
Zfp39 G C 11: 58,781,130 (GRCm39) T544R possibly damaging Het
Zfp39 A C 11: 58,780,873 (GRCm39) Y630D probably benign Het
Zfp39 G C 11: 58,780,871 (GRCm39) Y630* probably null Het
Zfp39 T G 11: 58,791,409 (GRCm39) S93R probably benign Het
Zfp39 G T 11: 58,791,407 (GRCm39) S93R probably benign Het
Zfp39 T C 11: 58,782,142 (GRCm39) K207E probably benign Het
Zfp39 A G 11: 58,782,123 (GRCm39) I213T probably benign Het
Zfp420 G A 7: 29,574,949 (GRCm39) E390K probably damaging Het
Zfp536 T C 7: 37,179,498 (GRCm39) T1036A probably benign Het
Zfp536 C T 7: 37,178,985 (GRCm39) G1207S probably benign Het
Zfp536 T A 7: 37,179,908 (GRCm39) Y899F probably benign Het
Zfp672 G T 11: 58,220,452 (GRCm39) T49K unknown Het
Zfp672 C A 11: 58,220,786 (GRCm39) probably benign Het
Zfp692 G T 11: 58,199,859 (GRCm39) E149D probably benign Het
Zfp692 G A 11: 58,200,844 (GRCm39) V242I probably benign Het
Zfp780b C T 7: 27,663,250 (GRCm39) S435N probably benign Het
Zfp780b T C 7: 27,674,203 (GRCm39) N3S probably benign Het
Zfp780b G A 7: 27,664,082 (GRCm39) H158Y probably benign Het
Zfp780b C T 7: 27,663,968 (GRCm39) E196K possibly damaging Het
Zfp790 A G 7: 29,529,109 (GRCm39) H598R possibly damaging Het
Zfp790 G A 7: 29,529,258 (GRCm39) A648T possibly damaging Het
Zfp790 A C 7: 29,529,208 (GRCm39) K631T possibly damaging Het
Zfp82 A G 7: 29,756,260 (GRCm39) V274A probably benign Het
Zfp82 C T 7: 29,756,450 (GRCm39) A211T possibly damaging Het
Zfp84 G A 7: 29,470,805 (GRCm39) V4M probably damaging Het
Zfp850 C T 7: 27,688,549 (GRCm39) S553N probably benign Het
Zfp850 G A 7: 27,689,704 (GRCm39) T168I probably benign Het
Zfp940 C T 7: 29,545,361 (GRCm39) R182H probably benign Het
Zfp940 T C 7: 29,535,031 (GRCm39) T112A unknown Het
Zfp940 T C 7: 29,545,404 (GRCm39) T168A probably benign Het
Zic1 G T 9: 91,243,783 (GRCm39) P395T probably damaging Het
Zzef1 G A 11: 72,780,008 (GRCm39) R1927H probably benign Het
Other mutations in Atp4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Atp4a APN 7 30,412,629 (GRCm39) missense possibly damaging 0.95
IGL01327:Atp4a APN 7 30,412,675 (GRCm39) missense possibly damaging 0.96
IGL01510:Atp4a APN 7 30,420,216 (GRCm39) missense probably benign 0.02
IGL01763:Atp4a APN 7 30,414,943 (GRCm39) missense probably benign 0.20
IGL02061:Atp4a APN 7 30,414,454 (GRCm39) missense probably damaging 1.00
IGL02435:Atp4a APN 7 30,416,482 (GRCm39) missense probably benign
IGL02903:Atp4a APN 7 30,415,344 (GRCm39) missense probably benign 0.00
IGL03181:Atp4a APN 7 30,424,129 (GRCm39) missense probably benign 0.02
IGL03350:Atp4a APN 7 30,420,292 (GRCm39) missense probably damaging 1.00
atypical UTSW 7 30,414,781 (GRCm39) missense possibly damaging 0.84
sublytic UTSW 7 30,415,225 (GRCm39) missense probably benign 0.32
IGL03097:Atp4a UTSW 7 30,422,462 (GRCm39) missense probably benign 0.14
R0095:Atp4a UTSW 7 30,420,160 (GRCm39) missense probably damaging 0.99
R0121:Atp4a UTSW 7 30,419,526 (GRCm39) missense probably benign 0.00
R0140:Atp4a UTSW 7 30,419,526 (GRCm39) missense probably benign 0.00
R0241:Atp4a UTSW 7 30,416,560 (GRCm39) missense probably benign 0.00
R0437:Atp4a UTSW 7 30,419,526 (GRCm39) missense probably benign 0.00
R0624:Atp4a UTSW 7 30,418,424 (GRCm39) missense probably benign
R1164:Atp4a UTSW 7 30,417,117 (GRCm39) missense probably benign 0.00
R2105:Atp4a UTSW 7 30,419,793 (GRCm39) critical splice donor site probably null
R2272:Atp4a UTSW 7 30,414,925 (GRCm39) nonsense probably null
R2327:Atp4a UTSW 7 30,419,666 (GRCm39) missense probably benign 0.16
R2881:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R2990:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R2992:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R2993:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R3123:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R3125:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R3441:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R3442:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R3686:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R3687:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R3845:Atp4a UTSW 7 30,416,540 (GRCm39) missense probably null 0.99
R4027:Atp4a UTSW 7 30,424,377 (GRCm39) splice site probably null
R4072:Atp4a UTSW 7 30,414,757 (GRCm39) missense probably benign 0.09
R4433:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R4454:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R4457:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R4458:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R4510:Atp4a UTSW 7 30,423,678 (GRCm39) nonsense probably null
R4511:Atp4a UTSW 7 30,423,678 (GRCm39) nonsense probably null
R4576:Atp4a UTSW 7 30,417,147 (GRCm39) missense probably benign 0.25
R4656:Atp4a UTSW 7 30,419,373 (GRCm39) intron probably benign
R4661:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R4662:Atp4a UTSW 7 30,419,650 (GRCm39) missense probably benign 0.16
R4852:Atp4a UTSW 7 30,423,693 (GRCm39) missense probably benign 0.10
R4892:Atp4a UTSW 7 30,411,899 (GRCm39) missense probably benign 0.07
R4907:Atp4a UTSW 7 30,418,517 (GRCm39) missense possibly damaging 0.66
R5024:Atp4a UTSW 7 30,415,289 (GRCm39) missense possibly damaging 0.82
R5254:Atp4a UTSW 7 30,414,955 (GRCm39) missense probably damaging 1.00
R5318:Atp4a UTSW 7 30,414,754 (GRCm39) missense probably damaging 1.00
R5340:Atp4a UTSW 7 30,420,231 (GRCm39) missense probably benign
R5484:Atp4a UTSW 7 30,420,097 (GRCm39) unclassified probably benign
R5729:Atp4a UTSW 7 30,411,851 (GRCm39) missense possibly damaging 0.48
R5762:Atp4a UTSW 7 30,418,521 (GRCm39) missense probably damaging 0.99
R5797:Atp4a UTSW 7 30,412,074 (GRCm39) missense probably damaging 1.00
R6030:Atp4a UTSW 7 30,421,941 (GRCm39) missense probably damaging 0.99
R6030:Atp4a UTSW 7 30,421,941 (GRCm39) missense probably damaging 0.99
R6077:Atp4a UTSW 7 30,415,344 (GRCm39) missense probably benign 0.00
R6243:Atp4a UTSW 7 30,415,382 (GRCm39) missense possibly damaging 0.68
R6346:Atp4a UTSW 7 30,414,781 (GRCm39) missense possibly damaging 0.84
R6459:Atp4a UTSW 7 30,411,887 (GRCm39) missense probably benign 0.00
R6515:Atp4a UTSW 7 30,411,903 (GRCm39) missense possibly damaging 0.78
R6773:Atp4a UTSW 7 30,414,802 (GRCm39) missense probably damaging 0.98
R6854:Atp4a UTSW 7 30,414,433 (GRCm39) missense probably benign 0.29
R7215:Atp4a UTSW 7 30,416,785 (GRCm39) missense possibly damaging 0.61
R7271:Atp4a UTSW 7 30,421,944 (GRCm39) missense probably benign 0.16
R7340:Atp4a UTSW 7 30,416,155 (GRCm39) missense possibly damaging 0.94
R7457:Atp4a UTSW 7 30,420,192 (GRCm39) missense probably benign 0.08
R7593:Atp4a UTSW 7 30,424,105 (GRCm39) missense probably benign 0.08
R7712:Atp4a UTSW 7 30,414,978 (GRCm39) missense probably damaging 0.96
R7762:Atp4a UTSW 7 30,419,461 (GRCm39) missense probably damaging 0.96
R8714:Atp4a UTSW 7 30,420,013 (GRCm39) missense probably damaging 0.99
R9324:Atp4a UTSW 7 30,415,207 (GRCm39) missense probably benign 0.02
Z1177:Atp4a UTSW 7 30,417,265 (GRCm39) missense possibly damaging 0.47
Predicted Primers
Posted On 2021-03-08