Incidental Mutation 'Z1186:Kndc1'
ID 664940
Institutional Source Beutler Lab
Gene Symbol Kndc1
Ensembl Gene ENSMUSG00000066129
Gene Name kinase non-catalytic C-lobe domain (KIND) containing 1
Synonyms B830014K08Rik, VKIND, very-kind, 2410012C07Rik
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # Z1186 ()
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 139474612-139521450 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to C at 139490729 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Histidine at position 410 (Q410H)
Ref Sequence ENSEMBL: ENSMUSP00000113856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053445] [ENSMUST00000121839]
AlphaFold Q0KK55
Predicted Effect possibly damaging
Transcript: ENSMUST00000053445
AA Change: Q410H

PolyPhen 2 Score 0.821 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000050586
Gene: ENSMUSG00000066129
AA Change: Q410H

DomainStartEndE-ValueType
KIND 37 217 4.66e-65 SMART
Blast:KIND 381 454 2e-10 BLAST
KIND 456 620 1.22e-50 SMART
low complexity region 658 670 N/A INTRINSIC
low complexity region 755 771 N/A INTRINSIC
low complexity region 792 801 N/A INTRINSIC
low complexity region 949 965 N/A INTRINSIC
coiled coil region 1121 1151 N/A INTRINSIC
Pfam:RasGEF_N 1242 1341 2.2e-17 PFAM
Pfam:RasGEF 1464 1672 3.8e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121839
AA Change: Q410H

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113856
Gene: ENSMUSG00000066129
AA Change: Q410H

DomainStartEndE-ValueType
KIND 37 217 4.66e-65 SMART
Blast:KIND 381 454 2e-10 BLAST
low complexity region 455 465 N/A INTRINSIC
Blast:KIND 466 539 7e-32 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a Ras guanine nucleotide exchange factor that appears to negatively regulate dendritic growth in the brain. Knockdown of this gene in senescent umbilical vein endothelial cells partially reversed the senescence, showing that this gene could potentially be targeted by anti-aging therapies. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 532 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700086D15Rik A G 11: 65,044,114 (GRCm39) W27R unknown Het
1700086D15Rik A G 11: 65,044,080 (GRCm39) F38S unknown Het
1700086D15Rik A C 11: 65,043,809 (GRCm39) V84G unknown Het
1700086D15Rik T A 11: 65,043,794 (GRCm39) Q89L unknown Het
1700086D15Rik A G 11: 65,044,128 (GRCm39) L22P unknown Het
1810065E05Rik C T 11: 58,313,027 (GRCm39) L27F probably benign Het
1810065E05Rik C T 11: 58,316,625 (GRCm39) L202F probably benign Het
1810065E05Rik C T 11: 58,313,060 (GRCm39) L38F possibly damaging Het
2200002D01Rik GCCTTCTTCTCCTTCTTCTCCTTCT GCCTTCTTCTCCTTCT 7: 28,947,029 (GRCm39) probably benign Het
2200002J24Rik T C 7: 30,399,215 (GRCm39) V3A probably benign Het
2810021J22Rik C T 11: 58,771,361 (GRCm39) A281V probably benign Het
4930438A08Rik A G 11: 58,184,844 (GRCm39) T521A unknown Het
4933427D14Rik G A 11: 72,067,535 (GRCm39) T585I possibly damaging Het
4933427D14Rik T G 11: 72,089,750 (GRCm39) S45R probably damaging Het
4933427D14Rik C A 11: 72,089,360 (GRCm39) A175S probably benign Het
4933427D14Rik G A 11: 72,089,308 (GRCm39) P192L probably benign Het
4933427D14Rik T C 11: 72,086,595 (GRCm39) Q272R probably damaging Het
4933427D14Rik T TCCCCAGC 11: 72,086,590 (GRCm39) probably null Het
4933427D14Rik T G 11: 72,086,580 (GRCm39) K277T probably damaging Het
4933427D14Rik A G 11: 72,086,569 (GRCm39) C281R possibly damaging Het
4933427D14Rik AAAAGTAA AAA 11: 72,086,538 (GRCm39) probably null Het
4933427D14Rik G T 11: 72,080,442 (GRCm39) P408H probably damaging Het
Akap10 T A 11: 61,806,096 (GRCm39) S211C probably benign Het
Alkbh6 G A 7: 30,011,719 (GRCm39) R81H probably damaging Het
Alox8 C T 11: 69,076,873 (GRCm39) R536Q probably benign Het
Alox8 A G 11: 69,088,322 (GRCm39) V76A probably benign Het
Aloxe3 A G 11: 69,019,501 (GRCm39) Q138R probably benign Het
Aloxe3 C T 11: 69,039,429 (GRCm39) A667V probably benign Het
Arhgap33 AGAGGA AGAGGAGGA 7: 30,223,904 (GRCm39) probably benign Het
Arhgap33 C G 7: 30,223,076 (GRCm39) R952P possibly damaging Het
Arhgap33 C G 7: 30,223,860 (GRCm39) G723A probably benign Het
Arhgef12 A G 9: 42,911,311 (GRCm39) V558A probably damaging Het
Art1 T C 7: 101,756,066 (GRCm39) W86R probably damaging Het
Aspa G T 11: 73,213,013 (GRCm39) L110I probably benign Het
Atp4a T C 7: 30,416,782 (GRCm39) I495T probably benign Het
Aurkb T C 11: 68,938,696 (GRCm39) F45S probably benign Het
Aurkb C T 11: 68,938,692 (GRCm39) R44W probably damaging Het
B9d1 A T 11: 61,396,029 (GRCm39) probably benign Het
Bnc1 G A 7: 81,623,007 (GRCm39) A740V probably benign Het
Borcs6 G A 11: 68,951,453 (GRCm39) R277Q possibly damaging Het
Braf C G 6: 39,702,189 (GRCm39) G14A unknown Het
Braf C A 6: 39,702,187 (GRCm39) G15C unknown Het
Brca2 G T 5: 150,460,048 (GRCm39) S441I probably damaging Het
Btnl10 AAAGA AAAGAAGA 11: 58,814,753 (GRCm39) probably benign Het
Btnl10 C T 11: 58,817,650 (GRCm39) T250I unknown Het
Btnl10 T C 11: 58,810,138 (GRCm39) V93A probably benign Het
Catsperg1 T C 7: 28,881,287 (GRCm39) H1089R possibly damaging Het
Catsperg1 G T 7: 28,881,286 (GRCm39) H1089Q possibly damaging Het
Catsperg1 C G 7: 28,881,297 (GRCm39) V1086L probably benign Het
Catsperg1 C T 7: 28,881,477 (GRCm39) R1061Q probably damaging Het
Catsperg1 T C 7: 28,881,547 (GRCm39) N1038D probably benign Het
Catsperg1 C T 7: 28,889,675 (GRCm39) R809Q probably benign Het
Ccdc42 C T 11: 68,478,017 (GRCm39) probably benign Het
Ccdc92b A G 11: 74,520,880 (GRCm39) M61V possibly damaging Het
Ccer2 G C 7: 28,456,593 (GRCm39) E112D possibly damaging Het
Ccer2 A C 7: 28,456,915 (GRCm39) S220R probably benign Het
Cd22 C T 7: 30,575,292 (GRCm39) R250H probably damaging Het
Cd22 A T 7: 30,566,478 (GRCm39) S814T probably benign Het
Cd22 T C 7: 30,566,891 (GRCm39) T796A probably benign Het
Chd3 C A 11: 69,239,271 (GRCm39) E1753D probably benign Het
Chd3 A G 11: 69,252,277 (GRCm39) W42R probably benign Het
Chst8 C T 7: 34,447,606 (GRCm39) R4Q probably damaging Het
Cluh CGAGCCTGAGCCTGAGCC CGAGCCTGAGCCTGAGCCTGAGCC 11: 74,560,343 (GRCm39) probably benign Het
Cluh AGCC AGCCTGGGCC 11: 74,560,357 (GRCm39) probably benign Het
Cntnap4 C A 8: 113,479,002 (GRCm39) L243I probably damaging Het
Cntrob G A 11: 69,198,882 (GRCm39) P622L probably benign Het
Cntrob C T 11: 69,196,404 (GRCm39) R677H probably benign Het
Cyb5d1 C A 11: 69,286,098 (GRCm39) A8S probably benign Het
Cyb5d1 A G 11: 69,286,028 (GRCm39) L31P probably benign Het
Cyp2d22 T C 15: 82,260,086 (GRCm39) T6A probably benign Het
Dmkn TGGCAACAGCAACAGTGGCAACAGCGGCAACAGCAACAGTGGCAACAGCGGCAACAGC TGGCAACAGCAACAGTGGCAACAGCGGCAACAGC 7: 30,464,826 (GRCm39) probably benign Het
Dmkn AGCAACAGTGGCAACAGCAACAGTGGCAACAGCGGCAACAGCAACAGTGGCAACAG AGCAACAGCGGCAACAGCAACAGTGGCAACAG 7: 30,464,818 (GRCm39) probably benign Het
Dmkn TGGAAGTGGTGGAAGTGGTGGAAGTGG TGGAAGTGGTGGAAGTGGTGGAAGTGGAGGAAGTGGTGGAAGTGGTGGAAGTGG 7: 30,466,602 (GRCm39) probably benign Het
Dmkn GGGTGGAAGTGGTGGAAGTGGTGGAAGTGGTGG GGGTGGAAGTGGTGGAAGTGGTGGAAGTGGTGGAAGTGGTGGAAGTGGTGGAAGTGGTGG 7: 30,466,599 (GRCm39) probably benign Het
Dmkn CAGGGGTGGAAGTGGTGGAAGTGGTGGAAG CAGGGGTGGAAGTGGTGGAAGTGGTGGAAGGGGTGGAAGTGGTGGAAGTGGTGGAAG 7: 30,466,596 (GRCm39) probably benign Het
Dnah9 G A 11: 66,038,207 (GRCm39) H110Y probably benign Het
Dnah9 A C 11: 65,976,000 (GRCm39) S1350A probably benign Het
Elac2 T C 11: 64,870,015 (GRCm39) S27P probably benign Het
Epn2 C A 11: 61,470,460 (GRCm39) probably benign Het
Fam114a2 G A 11: 57,380,940 (GRCm39) A438V probably benign Het
Fam114a2 A G 11: 57,374,858 (GRCm39) S494P probably benign Het
Fam114a2 C T 11: 57,405,060 (GRCm39) G14E probably benign Het
Fam114a2 T C 11: 57,390,623 (GRCm39) N304D probably benign Het
Fam114a2 C T 11: 57,390,581 (GRCm39) V318I probably benign Het
Fam83g G A 11: 61,594,020 (GRCm39) R518Q probably benign Het
Fam98c G T 7: 28,855,565 (GRCm39) L11M probably damaging Het
Fam98c C A 7: 28,855,192 (GRCm39) W77L probably benign Het
Fam98c G A 7: 28,852,883 (GRCm39) S50F probably benign Het
Fat2 T G 11: 55,200,625 (GRCm39) K816N probably benign Het
Fat2 TGTACCTCACCCCAGTACCT TGTACCT 11: 55,199,796 (GRCm39) probably null Het
Fbxo17 CCGCCGACGCCGACGCCGACGCCGACGCCGACG CCGCCGACGCCGACGCCGACGCCGACG 7: 28,432,169 (GRCm39) probably benign Het
Fbxo27 C T 7: 28,394,438 (GRCm39) R159C probably benign Het
Fbxo27 G A 7: 28,392,347 (GRCm39) probably benign Het
Fbxw10 G A 11: 62,767,671 (GRCm39) V836I probably benign Het
Fbxw10 G C 11: 62,738,118 (GRCm39) R4T probably benign Het
Fcgbp G C 7: 27,791,072 (GRCm39) E778Q probably benign Het
Fcgbp A G 7: 27,792,770 (GRCm39) M925V probably benign Het
Fcgbp C G 7: 27,803,309 (GRCm39) P1638A probably benign Het
Fcgbp T C 7: 27,785,616 (GRCm39) V351A probably benign Het
Fcgbp A C 7: 27,789,180 (GRCm39) D582A probably benign Het
Fcgbpl1 G A 7: 27,846,130 (GRCm39) E941K probably benign Het
Fcgbpl1 A G 7: 27,856,411 (GRCm39) H2066R probably benign Het
Fcgbpl1 A G 7: 27,830,997 (GRCm39) H70R probably benign Het
Ffar3 C T 7: 30,555,495 (GRCm39) probably benign Het
Fxyd1 T C 7: 30,751,377 (GRCm39) D61G Het
Fxyd5 G A 7: 30,737,356 (GRCm39) A65V possibly damaging Het
Fxyd5 C T 7: 30,734,588 (GRCm39) R179Q unknown Het
Galnt10 G A 11: 57,656,514 (GRCm39) V233I probably benign Het
Garre1 G A 7: 33,938,583 (GRCm39) A984V probably benign Het
Garre1 C T 7: 33,938,533 (GRCm39) V1001M probably benign Het
Garre1 C T 7: 33,945,185 (GRCm39) R565K probably benign Het
Gemin5 C G 11: 58,013,115 (GRCm39) S1446T probably benign Het
Gemin5 C G 11: 58,037,345 (GRCm39) E623D probably benign Het
Gemin5 C G 11: 58,030,401 (GRCm39) C808S probably benign Het
Gemin5 C G 11: 58,030,336 (GRCm39) A830P probably benign Het
Gemin5 T C 11: 58,020,897 (GRCm39) M1097V probably benign Het
Gemin5 T C 11: 58,016,044 (GRCm39) S1321G probably benign Het
Ggn TGCGG TGCGGCGGCGG 7: 28,870,900 (GRCm39) probably benign Het
Gjc2 ACCCTCCCT ACCCTCCCTCCCT 11: 59,073,561 (GRCm39) probably benign Het
Gjc2 A G 11: 59,067,318 (GRCm39) V388A unknown Het
Glod4 C A 11: 76,133,819 (GRCm39) probably null Het
Glod4 A G 11: 76,133,836 (GRCm39) V6A probably benign Het
Glp2r C A 11: 67,600,394 (GRCm39) R485L probably damaging Het
Glp2r C G 11: 67,600,472 (GRCm39) G459A probably benign Het
Glp2r A C 11: 67,630,949 (GRCm39) I309M probably benign Het
Glp2r C T 11: 67,630,993 (GRCm39) V295I probably benign Het
Glp2r A G 11: 67,631,878 (GRCm39) V283A probably benign Het
Glp2r T C 11: 67,631,885 (GRCm39) I281V probably benign Het
Glp2r T C 11: 67,633,129 (GRCm39) T235A probably benign Het
Glp2r A G 11: 67,635,773 (GRCm39) V189A probably benign Het
Glp2r C A 11: 67,661,662 (GRCm39) A13S probably benign Het
Glp2r C A 11: 67,600,470 (GRCm39) V460F probably benign Het
Gm12253 A C 11: 58,325,686 (GRCm39) E52D probably benign Het
Gm12253 A C 11: 58,326,237 (GRCm39) E84A probably benign Het
Gm12253 G A 11: 58,326,309 (GRCm39) S108N probably benign Het
Gm12253 G A 11: 58,331,835 (GRCm39) A215T possibly damaging Het
Gm12253 G C 11: 58,325,367 (GRCm39) S13T possibly damaging Het
Gm12253 A G 11: 58,325,658 (GRCm39) E43G probably benign Het
Gm12258 G A 11: 58,749,764 (GRCm39) R313H unknown Het
Gm12258 G A 11: 58,749,776 (GRCm39) G317E unknown Het
Gm12258 A T 11: 58,749,833 (GRCm39) E336V unknown Het
Gm12258 A G 11: 58,750,013 (GRCm39) probably benign Het
Gm12258 T A 11: 58,750,014 (GRCm39) probably benign Het
Gm12258 G C 11: 58,750,690 (GRCm39) G622R unknown Het
Gm12258 T G 11: 58,749,126 (GRCm39) S100R Het
Gm12258 C T 11: 58,749,262 (GRCm39) R146W Het
Gm6096 G A 7: 33,950,811 (GRCm39) A117T possibly damaging Het
Gm6096 G A 7: 33,950,817 (GRCm39) V119I possibly damaging Het
Gpatch1 G C 7: 35,017,770 (GRCm39) D23E probably benign Het
Gpatch1 C T 7: 34,980,797 (GRCm39) G908R unknown Het
Gpatch1 C T 7: 34,997,079 (GRCm39) R373Q possibly damaging Het
Gpi1 T C 7: 33,926,662 (GRCm39) N95D probably benign Het
Gps2 C T 11: 69,807,130 (GRCm39) A60V probably benign Het
Gramd1a G A 7: 30,843,198 (GRCm39) P37S possibly damaging Het
Gucy2e C G 11: 69,127,429 (GRCm39) G15R unknown Het
Gucy2e C A 11: 69,114,431 (GRCm39) A1033S probably benign Het
Guk1 G A 11: 59,082,747 (GRCm39) probably benign Het
Haspin T C 11: 73,028,174 (GRCm39) Q305R probably benign Het
Haspin A G 11: 73,028,777 (GRCm39) L104P probably benign Het
Haus5 C T 7: 30,357,052 (GRCm39) G460S probably damaging Het
Haus5 T G 7: 30,362,541 (GRCm39) K58T probably benign Het
Haus5 C T 7: 30,361,300 (GRCm39) A107T probably damaging Het
Haus5 T C 7: 30,361,072 (GRCm39) H156R probably benign Het
Haus5 C T 7: 30,358,332 (GRCm39) R321H probably damaging Het
Hes7 T C 11: 69,013,782 (GRCm39) S214P probably benign Het
Hic1 G A 11: 75,058,352 (GRCm39) T179M probably damaging Het
Hnrnpu G T 1: 178,164,591 (GRCm39) S182R probably benign Het
Iba57 CAGA CAGAGA 11: 59,052,329 (GRCm39) probably null Het
Iba57 C G 11: 59,053,865 (GRCm39) G36R unknown Het
Iba57 T C 11: 59,052,384 (GRCm39) T86A unknown Het
Iba57 T C 11: 59,052,381 (GRCm39) T87A unknown Het
Iba57 A AGC 11: 59,052,332 (GRCm39) probably null Het
Ifnl2 T C 7: 28,208,305 (GRCm39) N188S probably benign Het
Ifnl2 A T 7: 28,209,094 (GRCm39) F74I probably benign Het
Ifnl2 G A 7: 28,209,091 (GRCm39) P75S probably benign Het
Ifnl2 A G 7: 28,208,523 (GRCm39) S143P probably benign Het
Ifnl2 G T 7: 28,208,362 (GRCm39) A169D probably benign Het
Ifnl3 A G 7: 28,222,929 (GRCm39) M67V probably benign Het
Iftap T C 2: 101,440,950 (GRCm39) K18E probably benign Het
Igf1r GAGGAGCTGGAGA GAGGAGCTGGAGAAGGAGCTGGAGA 7: 67,875,916 (GRCm39) probably benign Het
Igf1r AGGAGCTGGAGATGGAGC AGGAGCTGGAGATGGAGCTGGAGATGGAGC 7: 67,875,917 (GRCm39) probably benign Het
Igf1r CTGGAGATGGAG CTGGAGATGGAGGTGGAGATGGAG 7: 67,875,922 (GRCm39) probably benign Het
Igf1r ATGGAGC ATGGAGCTGGAGCTGGAGC 7: 67,875,928 (GRCm39) probably benign Het
Igf1r GGAGC GGAGCTGGAGATCGAGC 7: 67,875,930 (GRCm39) probably benign Het
Igtp C G 11: 58,097,791 (GRCm39) L321V possibly damaging Het
Igtp T G 11: 58,097,169 (GRCm39) D113E probably damaging Het
Igtp C G 11: 58,097,944 (GRCm39) L372V probably benign Het
Irgm2 A G 11: 58,110,389 (GRCm39) N27D probably benign Het
Irgm2 T A 11: 58,110,339 (GRCm39) V10D probably benign Het
Irgm2 C G 11: 58,111,389 (GRCm39) T360S probably benign Het
Irgm2 G T 11: 58,111,238 (GRCm39) A310S possibly damaging Het
Irgm2 A C 11: 58,110,951 (GRCm39) H214P probably benign Het
Irgm2 G A 11: 58,110,924 (GRCm39) S205N probably benign Het
Irgm2 G A 11: 58,110,833 (GRCm39) V175I probably benign Het
Irgm2 T C 11: 58,110,780 (GRCm39) L157S probably benign Het
Irgm2 T C 11: 58,110,738 (GRCm39) I143T probably benign Het
Itgae T A 11: 72,994,713 (GRCm39) L22M possibly damaging Het
Itgae C G 11: 73,024,953 (GRCm39) S1028W probably benign Het
Itgae G T 11: 73,012,783 (GRCm39) G705V probably benign Het
Itgae A T 11: 73,012,757 (GRCm39) K696N probably benign Het
Itgae G A 11: 73,008,913 (GRCm39) V465I probably benign Het
Itgae A G 11: 73,006,466 (GRCm39) H378R probably benign Het
Itgae A T 11: 72,994,786 (GRCm39) Q46L probably damaging Het
Kif1c C T 11: 70,614,940 (GRCm39) P578L probably benign Het
Kirrel2 T A 7: 30,147,622 (GRCm39) E675D probably benign Het
Kmt2b C G 7: 30,284,732 (GRCm39) S720T probably benign Het
Kmt2b T C 7: 30,274,404 (GRCm39) Q2100R probably benign Het
Krt26 C T 11: 99,228,643 (GRCm39) G30R probably damaging Het
Larp1 G A 11: 57,933,166 (GRCm39) V257I probably benign Het
Lgals4 T A 7: 28,535,353 (GRCm39) M79K probably benign Het
Lgi4 G A 7: 30,768,596 (GRCm39) E532K probably benign Het
Llgl1 ACCCCAGCCCTTCTGATTACTGCCCTCCCCAGC ACCCCAGC 11: 60,603,923 (GRCm39) probably null Het
Lypd8 C A 11: 58,275,475 (GRCm39) A70E possibly damaging Het
Lypd8 T C 11: 58,273,601 (GRCm39) Y27H probably benign Het
Lypd8 A AGTTCCCTCGCCTCTGTTACCCCACAAATCCCCAACC 11: 58,281,070 (GRCm39) probably benign Het
Lypd8 ACCAACA ACCAACAGTTCCCTCGCCTCTGTTACCCCACAAATCCCCAACA 11: 58,281,064 (GRCm39) probably benign Het
Lypd8 CAATCACCAACA CAATCACCAACAGTTCCCTCGCCTCTGTTACCCCACAAATCACCAACA 11: 58,281,059 (GRCm39) probably benign Het
Lypd8 G A 11: 58,275,489 (GRCm39) E75K probably benign Het
Lypd8l G A 11: 58,499,335 (GRCm39) P161L probably benign Het
Lypd8l T G 11: 58,503,397 (GRCm39) S44R probably benign Het
Lypd8l A G 11: 58,503,387 (GRCm39) L47P probably benign Het
Mapk7 GGTGCT GGTGCTTGTGCT 11: 61,381,042 (GRCm39) probably benign Het
Mapk7 CGCTGGTGCTGG CGCTGGTGCTGGTGCTGG 11: 61,381,038 (GRCm39) probably benign Het
Mapk7 TGGGGCAGGGGCAGGGGCAGG TGGCGCTGGGGCAGGGGCAGGGGCAGGGGCAGG 11: 61,381,053 (GRCm39) probably benign Het
Mdga2 T G 12: 66,615,727 (GRCm39) T627P possibly damaging Het
Mfap3 A T 11: 57,418,866 (GRCm39) I9F possibly damaging Het
Mfap3 G A 11: 57,418,902 (GRCm39) G21S probably benign Het
Mrm3 C T 11: 76,138,221 (GRCm39) P203L probably benign Het
Mrpl22 G A 11: 58,062,521 (GRCm39) A4T unknown Het
Mrpl55 A G 11: 59,094,999 (GRCm39) probably null Het
Mrpl55 A T 11: 59,095,415 (GRCm39) L26F probably benign Het
Mrps33 T C 6: 39,779,449 (GRCm39) Q82R possibly damaging Het
Myocd A G 11: 65,075,418 (GRCm39) S697P probably benign Het
Naalad2 A C 9: 18,297,110 (GRCm39) F59V possibly damaging Het
Nccrp1 T C 7: 28,246,461 (GRCm39) T34A probably benign Het
Nefh TTTGGCCTCAGCTGGTGACTTGGGCTCAGCTGGAGACTTGGCCTCACCTGGTGACTTG TTTGGCCTCACCTGGTGACTTG 11: 4,890,530 (GRCm39) probably benign Het
Nlgn2 A G 11: 69,719,220 (GRCm39) V210A possibly damaging Het
Nlrp1a T C 11: 71,014,914 (GRCm39) E112G probably benign Het
Nlrp1a T C 11: 70,990,442 (GRCm39) I1038V probably benign Het
Nlrp1a C T 11: 70,988,077 (GRCm39) R1131Q probably damaging Het
Nlrp1a T C 11: 70,983,069 (GRCm39) K1299R probably benign Het
Nlrp1a C G 11: 71,033,355 (GRCm39) probably null Het
Nlrp1b T C 11: 71,073,503 (GRCm39) I113M probably benign Het
Nlrp1b T A 11: 71,073,396 (GRCm39) Q149L probably benign Het
Nlrp1b A T 11: 71,073,378 (GRCm39) M155K probably benign Het
Nlrp1b C G 11: 71,073,370 (GRCm39) E158Q probably benign Het
Nlrp1b T C 11: 71,073,280 (GRCm39) T188A probably benign Het
Nlrp1b A T 11: 71,073,266 (GRCm39) D192E probably benign Het
Nlrp1b A G 11: 71,073,148 (GRCm39) Y232H probably benign Het
Nlrp1b G C 11: 71,073,135 (GRCm39) T236R probably benign Het
Nlrp1b A G 11: 71,072,625 (GRCm39) I406T probably benign Het
Nlrp1b A C 11: 71,072,539 (GRCm39) S435A probably benign Het
Nlrp1b C A 11: 71,072,534 (GRCm39) M436I probably benign Het
Nmur2 T C 11: 55,931,104 (GRCm39) I202M probably benign Het
Nphs1 T C 7: 30,159,775 (GRCm39) S43P probably damaging Het
Nrp1 C A 8: 129,224,419 (GRCm39) H727Q probably damaging Het
Obscn C T 11: 58,977,505 (GRCm39) R1865H probably benign Het
Obscn T C 11: 58,977,527 (GRCm39) R1858G probably benign Het
Obscn A G 11: 58,977,565 (GRCm39) V1845A probably benign Het
Obscn A G 11: 58,984,142 (GRCm39) F1771S probably benign Het
Obscn C T 11: 58,984,239 (GRCm39) V1739M possibly damaging Het
Obscn G T 11: 58,984,334 (GRCm39) A1707D possibly damaging Het
Obscn C T 11: 58,984,335 (GRCm39) A1707T probably benign Het
Obscn G A 11: 58,984,385 (GRCm39) A1690V probably benign Het
Obscn C T 11: 58,990,735 (GRCm39) A1613T possibly damaging Het
Obscn T C 11: 58,990,755 (GRCm39) H1606R probably benign Het
Obscn C G 11: 58,994,167 (GRCm39) A1572P probably damaging Het
Obscn T C 11: 58,994,340 (GRCm39) H1514R probably benign Het
Obscn G A 11: 58,994,364 (GRCm39) A1506V probably benign Het
Obscn T C 11: 59,003,380 (GRCm39) E1306G probably benign Het
Obscn T C 11: 59,013,563 (GRCm39) M1095V probably benign Het
Obscn C T 11: 59,018,892 (GRCm39) A949T probably benign Het
Obscn C T 11: 59,018,895 (GRCm39) V973M probably damaging Het
Obscn C T 11: 59,021,449 (GRCm39) R797H probably damaging Het
Obscn C T 11: 59,023,937 (GRCm39) A578T possibly damaging Het
Obscn G A 11: 59,024,066 (GRCm39) P535S probably damaging Het
Obscn C G 11: 59,024,072 (GRCm39) A533P probably benign Het
Obscn T C 11: 59,026,505 (GRCm39) I233V probably benign Het
Obscn C T 11: 58,940,306 (GRCm39) D5354N Het
Obscn C A 11: 58,940,614 (GRCm39) R4593S possibly damaging Het
Obscn T C 11: 58,940,623 (GRCm39) T5307A Het
Obscn G A 11: 58,942,383 (GRCm39) T4372M probably benign Het
Obscn T C 11: 58,943,439 (GRCm39) M4237V probably benign Het
Obscn C T 11: 58,944,594 (GRCm39) R4700Q probably benign Het
Obscn T C 11: 58,944,651 (GRCm39) K4681R probably benign Het
Obscn T C 11: 58,945,044 (GRCm39) E4658G probably benign Het
Obscn C T 11: 58,945,176 (GRCm39) R4614Q probably benign Het
Obscn T C 11: 58,946,331 (GRCm39) D4458G probably damaging Het
Obscn C T 11: 58,946,340 (GRCm39) R4455K probably benign Het
Obscn G T 11: 58,946,936 (GRCm39) A4066E possibly damaging Het
Obscn A G 11: 58,947,595 (GRCm39) M4478T Het
Obscn C T 11: 58,952,388 (GRCm39) G3894R probably benign Het
Obscn CCACACACACACAC CCACACACACAC 11: 58,954,279 (GRCm39) probably null Het
Obscn T C 11: 58,954,300 (GRCm39) T4037A Het
Obscn T C 11: 58,954,402 (GRCm39) K3727E probably damaging Het
Obscn G A 11: 58,957,973 (GRCm39) R3576C probably benign Het
Obscn C T 11: 58,958,655 (GRCm39) V3433I probably benign Het
Obscn C A 11: 58,960,757 (GRCm39) A3185S probably benign Het
Obscn C T 11: 58,967,334 (GRCm39) V2792I possibly damaging Het
Obscn G A 11: 58,969,984 (GRCm39) R53C probably damaging Het
Obscn C G 11: 58,970,722 (GRCm39) V2328L probably benign Het
Obscn G A 11: 58,891,715 (GRCm39) A6939V probably benign Het
Obscn C G 11: 58,900,019 (GRCm39) G938A probably benign Het
Obscn G C 11: 58,904,014 (GRCm39) T7320S probably benign Het
Obscn C T 11: 58,921,934 (GRCm39) R5954Q probably damaging Het
Obscn G C 11: 58,929,976 (GRCm39) P5080A probably benign Het
Obscn T A 11: 58,929,990 (GRCm39) Q5075L probably damaging Het
Obscn T C 11: 58,932,601 (GRCm39) I4869V probably benign Het
Obscn T C 11: 58,933,776 (GRCm39) T5363A probably benign Het
Obscn G A 11: 58,933,853 (GRCm39) A5337V probably benign Het
Obscn G A 11: 58,933,878 (GRCm39) R5329C probably benign Het
Obscn C A 11: 58,972,698 (GRCm39) G2116V possibly damaging Het
Or10a49 A C 7: 108,468,143 (GRCm39) F73V possibly damaging Het
Or11l3 C G 11: 58,516,130 (GRCm39) G61R probably benign Het
Or11l3 G A 11: 58,516,588 (GRCm39) P95S probably benign Het
Or11l3 T G 11: 58,516,619 (GRCm39) K84N probably benign Het
Or11l3 A C 11: 58,516,732 (GRCm39) C46G possibly damaging Het
Or11l3 G A 11: 58,516,075 (GRCm39) S79F probably benign Het
Or14a258 G T 7: 86,035,487 (GRCm39) P127H probably damaging Het
Or2ab1 A G 11: 58,488,356 (GRCm39) I39V probably benign Het
Or2ab1 A C 11: 58,488,344 (GRCm39) I35L probably benign Het
Or2ab1 A G 11: 58,488,776 (GRCm39) S179G probably benign Het
Or2ab1 A G 11: 58,488,491 (GRCm39) S84G possibly damaging Het
Or2ak4 C T 11: 58,648,895 (GRCm39) L135F probably benign Het
Or2ak4 G A 11: 58,648,793 (GRCm39) A101T probably benign Het
Or2ak4 A C 11: 58,649,186 (GRCm39) K232Q probably benign Het
Or2ak4 A C 11: 58,649,168 (GRCm39) I226L probably benign Het
Or2ak4 G A 11: 58,649,153 (GRCm39) V221M probably damaging Het
Or2ak4 A G 11: 58,648,931 (GRCm39) S147G probably benign Het
Or2ak5 G A 11: 58,611,922 (GRCm39) probably benign Het
Or2ak6 C T 11: 58,593,153 (GRCm39) L209F possibly damaging Het
Or2ak6 A C 11: 58,592,784 (GRCm39) I86L probably benign Het
Or2ak6 C A 11: 58,593,222 (GRCm39) Q232K probably benign Het
Or2ak7 T C 11: 58,574,815 (GRCm39) F39L probably benign Het
Or2ak7 G T 11: 58,574,758 (GRCm39) D20Y probably benign Het
Or2ak7 C T 11: 58,575,289 (GRCm39) H197Y probably benign Het
Or2ak7 G A 11: 58,575,083 (GRCm39) R128Q probably benign Het
Or2av9 C T 11: 58,381,123 (GRCm39) A153T probably benign Het
Or2av9 C A 11: 58,380,574 (GRCm39) E336* probably null Het
Or2av9 T C 11: 58,381,314 (GRCm39) Q89R probably benign Het
Or2t29 G T 11: 58,434,272 (GRCm39) S23Y probably benign Het
Or2t43 A T 11: 58,457,521 (GRCm39) S217T probably benign Het
Or2t43 G A 11: 58,457,388 (GRCm39) A261V probably benign Het
Or2t43 C T 11: 58,457,920 (GRCm39) V84I probably benign Het
Or2t44 A G 11: 58,677,773 (GRCm39) T238A probably damaging Het
Or2t46 T C 11: 58,471,757 (GRCm39) V29A probably benign Het
Or2t46 C T 11: 58,471,750 (GRCm39) H27Y probably benign Het
Or2t46 G C 11: 58,472,483 (GRCm39) S271T probably benign Het
Or2t46 T G 11: 58,472,122 (GRCm39) L151V probably benign Het
Or2t46 G A 11: 58,471,828 (GRCm39) V53I probably benign Het
Or2t47 C T 11: 58,442,801 (GRCm39) S88N probably benign Het
Or2t47 T C 11: 58,442,387 (GRCm39) K226R probably benign Het
Or2t47 C T 11: 58,442,940 (GRCm39) A42T probably benign Het
Or2t49 C G 11: 58,393,287 (GRCm39) V38L probably benign Het
Or2t49 GGTGGATTGGTATGTGGAT GGTGGAT 11: 58,393,212 (GRCm39) probably benign Het
Or2t49 GAGGTGGATTGGTA GA 11: 58,393,210 (GRCm39) probably benign Het
Or2t49 C T 11: 58,393,396 (GRCm39) M1I probably null Het
Or2w3 T G 11: 58,557,342 (GRCm39) I319R probably benign Het
Or2w3b T G 11: 58,623,200 (GRCm39) N264H probably benign Het
Or2w3b C A 11: 58,624,048 (GRCm39) probably benign Het
Or2w3b T C 11: 58,623,475 (GRCm39) H172R probably benign Het
Or5af2 A G 11: 58,707,887 (GRCm39) I18V probably benign Het
Or5af2 C G 11: 58,708,644 (GRCm39) P270R probably benign Het
Or5af2 T C 11: 58,708,508 (GRCm39) C225R probably benign Het
Or5af2 A C 11: 58,708,220 (GRCm39) I129L probably benign Het
Or5af2 T C 11: 58,708,122 (GRCm39) V96A probably benign Het
Or9e1 G C 11: 58,731,907 (GRCm39) probably benign Het
Or9e1 A G 11: 58,732,615 (GRCm39) H225R probably benign Het
Or9e1 G A 11: 58,732,569 (GRCm39) A210T probably benign Het
Or9e1 C T 11: 58,732,032 (GRCm39) L31F probably benign Het
Or9e1 G T 11: 58,731,945 (GRCm39) A2S probably benign Het
Ovca2 T C 11: 75,069,528 (GRCm39) T32A probably benign Het
Pimreg TCACA TCA 11: 71,935,801 (GRCm39) probably benign Het
Pimreg G A 11: 71,935,979 (GRCm39) R154H probably damaging Het
Pitpnm3 T C 11: 71,954,955 (GRCm39) K520E probably benign Het
Pitpnm3 C T 11: 72,010,969 (GRCm39) R21Q probably benign Het
Plekhg2 G A 7: 28,062,360 (GRCm39) P520L possibly damaging Het
Plekhg2 T A 7: 28,070,727 (GRCm39) probably benign Het
Prodh2 G A 7: 30,206,069 (GRCm39) A290T probably benign Het
Prpsap2 A C 11: 61,647,078 (GRCm39) V21G possibly damaging Het
Psmd8 T C 7: 28,879,745 (GRCm39) N109S probably benign Het
Psmd8 A C 7: 28,879,808 (GRCm39) V88G probably benign Het
Rabep1 C CT 11: 70,830,910 (GRCm39) probably null Het
Rai1 A G 11: 60,078,389 (GRCm39) N818D probably benign Het
Rap1gap2 C T 11: 74,487,721 (GRCm39) E52K probably benign Het
Rasgrp4 G A 7: 28,845,302 (GRCm39) G342S probably benign Het
Rasgrp4 A G 7: 28,847,985 (GRCm39) K443R probably benign Het
Rasgrp4 A G 7: 28,848,060 (GRCm39) E468G probably damaging Het
Rasgrp4 TGGCTTCCT TGGCTTCCTCGGCTTCCT 7: 28,850,017 (GRCm39) probably benign Het
Rasgrp4 TTCCT TTCCTCGTCGTCCT 7: 28,850,021 (GRCm39) probably benign Het
Rasgrp4 T C 7: 28,837,012 (GRCm39) S24P probably benign Het
Rasgrp4 G T 7: 28,838,241 (GRCm39) A72S probably benign Het
Rbm42 C A 7: 30,349,578 (GRCm39) probably benign Het
Rhpn2 G T 7: 35,084,826 (GRCm39) E573D probably benign Het
Rims1 C A 1: 22,449,706 (GRCm39) K339N Het
Rnf112 A G 11: 61,341,775 (GRCm39) L343P unknown Het
Rnf167 C CACAGGGA 11: 70,541,646 (GRCm39) probably null Het
Rtn4rl1 C T 11: 75,156,863 (GRCm39) P432S probably benign Het
Ryr1 C T 7: 28,781,902 (GRCm39) R2036Q possibly damaging Het
Safb2 A T 17: 56,870,246 (GRCm39) probably null Het
Sbsn G A 7: 30,451,273 (GRCm39) S96N probably benign Het
Sbsn G A 7: 30,452,317 (GRCm39) R444H probably benign Het
Scart1 G T 7: 139,804,403 (GRCm39) A493S possibly damaging Het
Scgb1b19 G T 7: 32,987,073 (GRCm39) E75* probably null Het
Scgb1b19 G A 7: 32,986,790 (GRCm39) G20E probably damaging Het
Scgb1b19 A T 7: 32,986,990 (GRCm39) Y47F probably damaging Het
Scgb2b11 TCCAGTCACCAGCAAGCCCAG TCCAG 7: 31,910,507 (GRCm39) probably null Het
Scgb2b2 A G 7: 31,004,240 (GRCm39) R113G unknown Het
Scgb2b3 T C 7: 31,059,592 (GRCm39) K61E probably benign Het
Scgb2b3 A G 7: 31,058,546 (GRCm39) F86L probably benign Het
Scgb2b7 G C 7: 31,404,547 (GRCm39) A51G probably benign Het
Scgb2b7 A T 7: 31,404,489 (GRCm39) S70R probably benign Het
Sfi1 ACA ACATCTTCCCAAAGCCAGTCA 11: 3,103,382 (GRCm39) probably benign Het
Sipa1l3 CCGCACGCACGCAC CCGCACGCAC 7: 29,031,636 (GRCm39) probably benign Het
Sipa1l3 C A 7: 29,031,372 (GRCm39) probably null Het
Slc2a4 GGCCG GG 11: 69,834,818 (GRCm39) probably benign Het
Slc2a4 GGGCCGG GGG 11: 69,834,817 (GRCm39) probably null Het
Slc2a4 GCC G 11: 69,834,819 (GRCm39) probably null Het
Slc6a4 A G 11: 76,903,858 (GRCm39) K152R probably benign Het
Slc6a4 G A 11: 76,901,382 (GRCm39) G39E probably benign Het
Slc7a10 A G 7: 34,885,956 (GRCm39) H17R probably benign Het
Slc8a1 C G 17: 81,955,311 (GRCm39) G576R probably damaging Het
Smcr8 A G 11: 60,668,806 (GRCm39) probably benign Het
Smcr8 C A 11: 60,670,699 (GRCm39) R616S probably benign Het
Smcr8 T C 11: 60,669,932 (GRCm39) V360A probably benign Het
Smg6 G T 11: 75,047,092 (GRCm39) A1262S probably benign Het
Spns3 T C 11: 72,440,986 (GRCm39) S17G probably benign Het
Spns3 T C 11: 72,440,863 (GRCm39) I58V probably benign Het
Spns3 G A 11: 72,440,917 (GRCm39) P40S probably benign Het
Srebf1 C T 11: 60,097,061 (GRCm39) V256M probably benign Het
Sspo A C 6: 48,445,441 (GRCm39) K2294T probably benign Het
Tekt1 T C 11: 72,250,597 (GRCm39) Q33R probably benign Het
Timm22 T G 11: 76,297,943 (GRCm39) V18G probably benign Het
Tmem102 C G 11: 69,695,902 (GRCm39) G53A possibly damaging Het
Tmem102 G C 11: 69,695,927 (GRCm39) R45G probably benign Het
Tmem11 A G 11: 60,766,658 (GRCm39) probably benign Het
Tom1l2 C T 11: 60,132,682 (GRCm39) A414T probably benign Het
Top3a C T 11: 60,641,410 (GRCm39) G425S probably benign Het
Trim16 T C 11: 62,731,572 (GRCm39) V481A probably benign Het
Trim16 C A 11: 62,731,675 (GRCm39) D515E probably benign Het
Trim16 C T 11: 62,711,428 (GRCm39) A33V probably benign Het
Trim16 G C 11: 62,711,502 (GRCm39) V58L probably benign Het
Trim16 TGAAGA TGAAGAAGA 11: 62,711,516 (GRCm39) probably benign Het
Trim16 AAG AAGCAG 11: 62,711,518 (GRCm39) probably benign Het
Trim16 G A 11: 62,727,643 (GRCm39) E322K probably benign Het
Trim17 G A 11: 58,856,331 (GRCm39) M129I probably benign Het
Trim17 A G 11: 58,861,272 (GRCm39) N259S probably benign Het
Trim58 A G 11: 58,542,486 (GRCm39) N482S probably benign Het
Trim58 C A 11: 58,531,684 (GRCm39) L131M possibly damaging Het
Trpv1 C A 11: 73,145,117 (GRCm39) D734E probably benign Het
Trpv1 C G 11: 73,131,427 (GRCm39) P322A possibly damaging Het
Trpv3 A G 11: 73,174,502 (GRCm39) T290A probably benign Het
Trpv3 G A 11: 73,169,803 (GRCm39) A125T probably benign Het
Trpv3 C T 11: 73,160,513 (GRCm39) A9V probably benign Het
Tsc22d4 C T 5: 137,756,611 (GRCm39) S13L possibly damaging Het
Tshz3 T C 7: 36,468,341 (GRCm39) I110T probably benign Het
Tshz3 A G 7: 36,469,999 (GRCm39) S663G probably benign Het
Tvp23b A C 11: 62,772,769 (GRCm39) N7H possibly damaging Het
Ubap2l G T 3: 89,916,543 (GRCm39) H915Q unknown Het
Ubr4 C G 4: 139,137,964 (GRCm39) A1107G probably benign Het
Usp43 C T 11: 67,747,332 (GRCm39) G792S probably benign Het
Usp43 AGGGC AGGGCAGGGGATGAACCTCGGGC 11: 67,746,545 (GRCm39) probably benign Het
Utrn C T 10: 12,545,491 (GRCm39) R1718H probably damaging Het
Vamp2 G A 11: 68,980,889 (GRCm39) G124R possibly damaging Het
Vamp2 C T 11: 68,979,411 (GRCm39) probably benign Het
Vmn2r71 G T 7: 85,273,094 (GRCm39) C636F probably damaging Het
Wdr62 C T 7: 29,950,184 (GRCm39) C752Y probably damaging Het
Xaf1 T C 11: 72,199,881 (GRCm39) L206S unknown Het
Xaf1 G C 11: 72,199,856 (GRCm39) V198L unknown Het
Xaf1 T TGGCCCGCC 11: 72,199,849 (GRCm39) probably null Het
Xaf1 GGCT GGCTGGCCAGCT 11: 72,199,846 (GRCm39) probably null Het
Xaf1 T G 11: 72,199,792 (GRCm39) C176W unknown Het
Xaf1 A G 11: 72,199,476 (GRCm39) E71G probably benign Het
Xaf1 C A 11: 72,197,434 (GRCm39) L137I probably benign Het
Xaf1 G A 11: 72,197,426 (GRCm39) R134H probably benign Het
Xaf1 G C 11: 72,197,429 (GRCm39) C135S probably damaging Het
Zbtb32 G C 7: 30,290,102 (GRCm39) T304S probably benign Het
Zfp14 C T 7: 29,738,577 (GRCm39) G136E probably damaging Het
Zfp260 G A 7: 29,804,463 (GRCm39) R121K probably benign Het
Zfp286 G A 11: 62,675,782 (GRCm39) T60M probably damaging Het
Zfp286 A G 11: 62,678,795 (GRCm39) V44A probably benign Het
Zfp287 C G 11: 62,606,175 (GRCm39) C244S probably benign Het
Zfp287 G A 11: 62,613,757 (GRCm39) R225* probably null Het
Zfp287 C T 11: 62,604,633 (GRCm39) R758H probably benign Het
Zfp30 T C 7: 29,491,902 (GRCm39) L133P possibly damaging Het
Zfp30 G A 7: 29,492,196 (GRCm39) S231N probably benign Het
Zfp30 C T 7: 29,492,021 (GRCm39) P173S probably benign Het
Zfp30 G C 7: 29,492,004 (GRCm39) R167P probably benign Het
Zfp30 A T 7: 29,491,932 (GRCm39) Y143F probably benign Het
Zfp383 A G 7: 29,614,140 (GRCm39) S132G probably benign Het
Zfp383 A C 7: 29,615,190 (GRCm39) S482R probably benign Het
Zfp383 T C 7: 29,614,146 (GRCm39) S134P probably benign Het
Zfp39 T A 11: 58,781,967 (GRCm39) H265L probably damaging Het
Zfp39 T A 11: 58,781,751 (GRCm39) K337M probably benign Het
Zfp39 A G 11: 58,781,724 (GRCm39) V346A probably benign Het
Zfp39 A G 11: 58,781,605 (GRCm39) S386P probably benign Het
Zfp39 G T 11: 58,781,597 (GRCm39) N388K probably benign Het
Zfp39 T C 11: 58,781,526 (GRCm39) N412S possibly damaging Het
Zfp39 T C 11: 58,781,274 (GRCm39) D496G possibly damaging Het
Zfp39 G C 11: 58,781,273 (GRCm39) D496E probably benign Het
Zfp39 G C 11: 58,781,130 (GRCm39) T544R possibly damaging Het
Zfp39 A C 11: 58,780,873 (GRCm39) Y630D probably benign Het
Zfp39 G C 11: 58,780,871 (GRCm39) Y630* probably null Het
Zfp39 T G 11: 58,791,409 (GRCm39) S93R probably benign Het
Zfp39 G T 11: 58,791,407 (GRCm39) S93R probably benign Het
Zfp39 T C 11: 58,782,142 (GRCm39) K207E probably benign Het
Zfp39 A G 11: 58,782,123 (GRCm39) I213T probably benign Het
Zfp420 G A 7: 29,574,949 (GRCm39) E390K probably damaging Het
Zfp536 T C 7: 37,179,498 (GRCm39) T1036A probably benign Het
Zfp536 C T 7: 37,178,985 (GRCm39) G1207S probably benign Het
Zfp536 T A 7: 37,179,908 (GRCm39) Y899F probably benign Het
Zfp672 G T 11: 58,220,452 (GRCm39) T49K unknown Het
Zfp672 C A 11: 58,220,786 (GRCm39) probably benign Het
Zfp692 G T 11: 58,199,859 (GRCm39) E149D probably benign Het
Zfp692 G A 11: 58,200,844 (GRCm39) V242I probably benign Het
Zfp780b C T 7: 27,663,250 (GRCm39) S435N probably benign Het
Zfp780b T C 7: 27,674,203 (GRCm39) N3S probably benign Het
Zfp780b G A 7: 27,664,082 (GRCm39) H158Y probably benign Het
Zfp780b C T 7: 27,663,968 (GRCm39) E196K possibly damaging Het
Zfp790 A G 7: 29,529,109 (GRCm39) H598R possibly damaging Het
Zfp790 G A 7: 29,529,258 (GRCm39) A648T possibly damaging Het
Zfp790 A C 7: 29,529,208 (GRCm39) K631T possibly damaging Het
Zfp82 A G 7: 29,756,260 (GRCm39) V274A probably benign Het
Zfp82 C T 7: 29,756,450 (GRCm39) A211T possibly damaging Het
Zfp84 G A 7: 29,470,805 (GRCm39) V4M probably damaging Het
Zfp850 C T 7: 27,688,549 (GRCm39) S553N probably benign Het
Zfp850 G A 7: 27,689,704 (GRCm39) T168I probably benign Het
Zfp940 C T 7: 29,545,361 (GRCm39) R182H probably benign Het
Zfp940 T C 7: 29,535,031 (GRCm39) T112A unknown Het
Zfp940 T C 7: 29,545,404 (GRCm39) T168A probably benign Het
Zic1 G T 9: 91,243,783 (GRCm39) P395T probably damaging Het
Zzef1 G A 11: 72,780,008 (GRCm39) R1927H probably benign Het
Other mutations in Kndc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Kndc1 APN 7 139,481,904 (GRCm39) splice site probably benign
IGL01061:Kndc1 APN 7 139,502,610 (GRCm39) missense probably benign 0.00
IGL01099:Kndc1 APN 7 139,500,700 (GRCm39) missense probably damaging 1.00
IGL01522:Kndc1 APN 7 139,493,888 (GRCm39) splice site probably benign
IGL01767:Kndc1 APN 7 139,509,959 (GRCm39) missense probably damaging 1.00
IGL01884:Kndc1 APN 7 139,494,110 (GRCm39) missense probably damaging 1.00
IGL01932:Kndc1 APN 7 139,503,705 (GRCm39) missense probably damaging 0.98
IGL02133:Kndc1 APN 7 139,500,683 (GRCm39) missense probably benign 0.19
IGL02411:Kndc1 APN 7 139,501,829 (GRCm39) critical splice donor site probably null
IGL02472:Kndc1 APN 7 139,490,817 (GRCm39) missense probably benign 0.01
IGL02537:Kndc1 APN 7 139,490,326 (GRCm39) missense probably benign 0.01
IGL02708:Kndc1 APN 7 139,481,097 (GRCm39) missense probably damaging 1.00
IGL03115:Kndc1 APN 7 139,501,425 (GRCm39) missense probably benign 0.28
IGL03160:Kndc1 APN 7 139,500,605 (GRCm39) nonsense probably null
IGL03138:Kndc1 UTSW 7 139,519,791 (GRCm39) missense possibly damaging 0.89
PIT4142001:Kndc1 UTSW 7 139,503,692 (GRCm39) frame shift probably null
PIT4696001:Kndc1 UTSW 7 139,512,830 (GRCm39) missense probably damaging 1.00
R0349:Kndc1 UTSW 7 139,490,220 (GRCm39) missense probably benign 0.00
R0384:Kndc1 UTSW 7 139,490,515 (GRCm39) missense possibly damaging 0.85
R0415:Kndc1 UTSW 7 139,510,037 (GRCm39) missense probably damaging 1.00
R0421:Kndc1 UTSW 7 139,488,912 (GRCm39) missense probably damaging 1.00
R0487:Kndc1 UTSW 7 139,493,939 (GRCm39) missense probably null 0.19
R0530:Kndc1 UTSW 7 139,481,153 (GRCm39) missense probably damaging 1.00
R0905:Kndc1 UTSW 7 139,503,651 (GRCm39) missense possibly damaging 0.94
R1434:Kndc1 UTSW 7 139,502,600 (GRCm39) missense probably damaging 1.00
R1608:Kndc1 UTSW 7 139,507,321 (GRCm39) missense possibly damaging 0.80
R1644:Kndc1 UTSW 7 139,510,669 (GRCm39) missense probably damaging 1.00
R1835:Kndc1 UTSW 7 139,507,624 (GRCm39) missense probably damaging 0.99
R2012:Kndc1 UTSW 7 139,501,196 (GRCm39) missense possibly damaging 0.90
R2102:Kndc1 UTSW 7 139,510,674 (GRCm39) missense probably benign 0.02
R2103:Kndc1 UTSW 7 139,501,150 (GRCm39) missense probably benign 0.01
R2128:Kndc1 UTSW 7 139,510,025 (GRCm39) missense probably damaging 1.00
R2516:Kndc1 UTSW 7 139,501,738 (GRCm39) missense probably damaging 1.00
R3030:Kndc1 UTSW 7 139,481,123 (GRCm39) missense probably damaging 1.00
R3617:Kndc1 UTSW 7 139,481,976 (GRCm39) splice site probably benign
R3747:Kndc1 UTSW 7 139,507,817 (GRCm39) critical splice donor site probably null
R3848:Kndc1 UTSW 7 139,488,893 (GRCm39) missense probably damaging 1.00
R4028:Kndc1 UTSW 7 139,509,941 (GRCm39) missense probably damaging 0.98
R4043:Kndc1 UTSW 7 139,504,044 (GRCm39) missense probably benign 0.06
R4044:Kndc1 UTSW 7 139,504,044 (GRCm39) missense probably benign 0.06
R4095:Kndc1 UTSW 7 139,516,938 (GRCm39) missense possibly damaging 0.49
R4289:Kndc1 UTSW 7 139,490,798 (GRCm39) missense probably benign 0.01
R4478:Kndc1 UTSW 7 139,500,600 (GRCm39) missense probably damaging 1.00
R4514:Kndc1 UTSW 7 139,490,202 (GRCm39) missense probably benign 0.00
R4540:Kndc1 UTSW 7 139,501,343 (GRCm39) nonsense probably null
R4584:Kndc1 UTSW 7 139,481,159 (GRCm39) missense probably damaging 1.00
R4693:Kndc1 UTSW 7 139,501,695 (GRCm39) missense probably benign 0.02
R4705:Kndc1 UTSW 7 139,510,036 (GRCm39) missense possibly damaging 0.81
R4773:Kndc1 UTSW 7 139,503,946 (GRCm39) nonsense probably null
R4859:Kndc1 UTSW 7 139,501,821 (GRCm39) missense probably benign 0.03
R5004:Kndc1 UTSW 7 139,512,792 (GRCm39) nonsense probably null
R5037:Kndc1 UTSW 7 139,490,371 (GRCm39) missense possibly damaging 0.52
R5322:Kndc1 UTSW 7 139,516,722 (GRCm39) missense probably damaging 1.00
R5428:Kndc1 UTSW 7 139,488,878 (GRCm39) missense probably damaging 0.99
R5503:Kndc1 UTSW 7 139,511,802 (GRCm39) missense probably damaging 1.00
R5506:Kndc1 UTSW 7 139,507,804 (GRCm39) missense probably damaging 1.00
R5525:Kndc1 UTSW 7 139,504,026 (GRCm39) missense probably benign 0.00
R5888:Kndc1 UTSW 7 139,475,133 (GRCm39) missense probably benign 0.00
R5942:Kndc1 UTSW 7 139,516,792 (GRCm39) missense probably damaging 1.00
R5979:Kndc1 UTSW 7 139,519,740 (GRCm39) missense probably benign 0.05
R5990:Kndc1 UTSW 7 139,507,333 (GRCm39) missense probably damaging 0.99
R6038:Kndc1 UTSW 7 139,503,691 (GRCm39) frame shift probably null
R6076:Kndc1 UTSW 7 139,481,954 (GRCm39) missense probably damaging 1.00
R6118:Kndc1 UTSW 7 139,503,717 (GRCm39) missense probably damaging 1.00
R6151:Kndc1 UTSW 7 139,501,129 (GRCm39) missense probably benign 0.04
R6276:Kndc1 UTSW 7 139,500,979 (GRCm39) missense probably benign
R6367:Kndc1 UTSW 7 139,493,422 (GRCm39) missense probably damaging 1.00
R6726:Kndc1 UTSW 7 139,502,667 (GRCm39) critical splice donor site probably null
R6745:Kndc1 UTSW 7 139,500,892 (GRCm39) missense probably benign 0.02
R6886:Kndc1 UTSW 7 139,493,485 (GRCm39) missense probably benign 0.01
R6912:Kndc1 UTSW 7 139,490,194 (GRCm39) missense probably damaging 0.99
R7070:Kndc1 UTSW 7 139,501,744 (GRCm39) missense probably damaging 1.00
R7123:Kndc1 UTSW 7 139,516,749 (GRCm39) missense probably damaging 0.99
R7158:Kndc1 UTSW 7 139,511,773 (GRCm39) missense possibly damaging 0.48
R7248:Kndc1 UTSW 7 139,500,699 (GRCm39) missense probably damaging 1.00
R7437:Kndc1 UTSW 7 139,488,959 (GRCm39) missense probably damaging 1.00
R7564:Kndc1 UTSW 7 139,500,612 (GRCm39) missense probably benign 0.01
R7570:Kndc1 UTSW 7 139,503,691 (GRCm39) frame shift probably null
R7625:Kndc1 UTSW 7 139,517,930 (GRCm39) missense possibly damaging 0.90
R7629:Kndc1 UTSW 7 139,475,176 (GRCm39) missense probably damaging 1.00
R7726:Kndc1 UTSW 7 139,519,751 (GRCm39) missense possibly damaging 0.67
R7840:Kndc1 UTSW 7 139,503,731 (GRCm39) missense probably damaging 1.00
R7859:Kndc1 UTSW 7 139,500,880 (GRCm39) missense possibly damaging 0.57
R7934:Kndc1 UTSW 7 139,501,402 (GRCm39) missense probably benign 0.02
R8011:Kndc1 UTSW 7 139,490,536 (GRCm39) missense possibly damaging 0.90
R8062:Kndc1 UTSW 7 139,498,760 (GRCm39) missense probably benign 0.01
R8134:Kndc1 UTSW 7 139,481,285 (GRCm39) splice site probably null
R8197:Kndc1 UTSW 7 139,493,447 (GRCm39) missense probably damaging 1.00
R8350:Kndc1 UTSW 7 139,503,960 (GRCm39) missense probably damaging 1.00
R8399:Kndc1 UTSW 7 139,493,434 (GRCm39) missense probably damaging 1.00
R8400:Kndc1 UTSW 7 139,493,434 (GRCm39) missense probably damaging 1.00
R8447:Kndc1 UTSW 7 139,481,121 (GRCm39) missense probably damaging 1.00
R8534:Kndc1 UTSW 7 139,503,669 (GRCm39) missense probably benign 0.27
R8735:Kndc1 UTSW 7 139,490,130 (GRCm39) missense probably benign 0.00
R8816:Kndc1 UTSW 7 139,517,909 (GRCm39) missense probably damaging 1.00
R8883:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R8899:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R8961:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R8961:Kndc1 UTSW 7 139,503,976 (GRCm39) missense possibly damaging 0.95
R9002:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R9010:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R9065:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R9066:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R9223:Kndc1 UTSW 7 139,501,357 (GRCm39) missense possibly damaging 0.89
R9230:Kndc1 UTSW 7 139,500,600 (GRCm39) missense probably damaging 1.00
R9291:Kndc1 UTSW 7 139,475,140 (GRCm39) missense possibly damaging 0.55
R9441:Kndc1 UTSW 7 139,501,392 (GRCm39) missense probably damaging 0.99
R9476:Kndc1 UTSW 7 139,510,031 (GRCm39) missense probably benign 0.00
R9510:Kndc1 UTSW 7 139,510,031 (GRCm39) missense probably benign 0.00
R9518:Kndc1 UTSW 7 139,519,827 (GRCm39) missense probably damaging 1.00
R9758:Kndc1 UTSW 7 139,500,620 (GRCm39) missense possibly damaging 0.71
Z1177:Kndc1 UTSW 7 139,501,828 (GRCm39) missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- TGAACGGCTCGAGAAACCAG -3'
(R):5'- GGCTAAGGAGAGACAGCTTTTC -3'

Sequencing Primer
(F):5'- AACCAGCTGGCCATATCTGAGTTC -3'
(R):5'- AGGAGAGACAGCTTTTCATCTCC -3'
Posted On 2021-03-08