Incidental Mutation 'Z1187:Lrp1b'
ID 665327
Institutional Source Beutler Lab
Gene Symbol Lrp1b
Ensembl Gene ENSMUSG00000049252
Gene Name low density lipoprotein-related protein 1B (deleted in tumors)
Synonyms 9630004P12Rik
Accession Numbers

Genbank: NM_053011.2

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # Z1187 ()
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 40595246-42653624 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 40750934 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 3499 (N3499K)
Ref Sequence ENSEMBL: ENSMUSP00000054275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052550]
AlphaFold no structure available at present
Predicted Effect
SMART Domains Protein: ENSMUSP00000054275
Gene: ENSMUSG00000049252
AA Change: N3499K

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
low complexity region 35 46 N/A INTRINSIC
LDLa 62 102 2.97e-12 SMART
LDLa 107 146 1.31e-8 SMART
EGF 150 185 1.95e1 SMART
EGF_CA 186 225 8.37e-8 SMART
LY 256 300 4.06e1 SMART
LY 304 348 1.15e-5 SMART
LY 349 392 1.17e-11 SMART
LY 393 435 1.12e-8 SMART
LY 436 478 2.21e1 SMART
EGF 505 548 2.45e0 SMART
LY 579 621 1.32e-5 SMART
LY 622 665 1.88e-10 SMART
LY 668 717 1.47e-12 SMART
LY 718 760 5.78e-11 SMART
LY 761 802 1.45e0 SMART
EGF_like 828 865 4.55e1 SMART
LDLa 875 914 7.15e-15 SMART
LDLa 916 955 5.26e-13 SMART
LDLa 957 995 6.13e-14 SMART
LDLa 997 1035 6.47e-13 SMART
LDLa 1036 1075 1.76e-14 SMART
LDLa 1083 1121 2.29e-13 SMART
LDLa 1125 1164 3.36e-11 SMART
LDLa 1166 1206 2.57e-7 SMART
EGF 1206 1244 1.58e-3 SMART
EGF 1248 1284 4.56e0 SMART
LY 1311 1353 4.85e-4 SMART
LY 1358 1400 6.49e-14 SMART
LY 1401 1445 8.18e-11 SMART
LY 1446 1490 4.25e-9 SMART
LY 1492 1534 5.4e-2 SMART
EGF 1561 1601 9.41e-2 SMART
LY 1629 1671 3.03e-5 SMART
LY 1672 1716 1.22e-9 SMART
LY 1718 1756 1.02e-2 SMART
LY 1757 1798 8.25e-7 SMART
EGF 1868 1906 4.03e-1 SMART
LY 1933 1975 1.01e-1 SMART
LY 1976 2018 3.03e-14 SMART
LY 2019 2062 2.16e-10 SMART
LY 2063 2105 4.09e-11 SMART
LY 2107 2149 9.96e0 SMART
EGF 2177 2214 2.13e0 SMART
LY 2292 2334 6.96e-5 SMART
LY 2340 2385 1.07e-5 SMART
LY 2386 2428 1.1e-11 SMART
LY 2429 2470 4.78e-3 SMART
EGF 2498 2535 2.03e1 SMART
LDLa 2540 2580 1.1e-6 SMART
LDLa 2582 2619 1.72e-8 SMART
LDLa 2621 2658 2.45e-13 SMART
LDLa 2669 2707 6.53e-9 SMART
LDLa 2712 2749 7.97e-13 SMART
LDLa 2750 2789 1.22e-8 SMART
LDLa 2791 2832 3.07e-14 SMART
LDLa 2835 2873 7.32e-12 SMART
LDLa 2875 2917 1.85e-8 SMART
LDLa 2921 2958 4.76e-11 SMART
EGF_CA 2957 2998 1.79e-7 SMART
EGF_CA 2999 3039 1.85e-9 SMART
LY 3066 3111 2.58e-8 SMART
LY 3112 3152 1.22e-9 SMART
LY 3153 3196 8.84e-7 SMART
LY 3197 3237 3.22e-9 SMART
LY 3238 3279 1.04e-3 SMART
EGF 3307 3345 7.13e-2 SMART
LDLa 3347 3385 9.29e-14 SMART
LDLa 3387 3424 2.25e-12 SMART
LDLa 3426 3464 5.63e-13 SMART
LDLa 3466 3504 1.07e-13 SMART
LDLa 3506 3543 1.35e-15 SMART
EGF_like 3545 3581 2.8e1 SMART
LDLa 3545 3582 1.49e-12 SMART
LDLa 3583 3620 4.21e-12 SMART
LDLa 3624 3661 4.9e-13 SMART
LDLa 3662 3700 9.58e-16 SMART
LDLa 3704 3743 5.38e-10 SMART
LDLa 3745 3784 1.42e-9 SMART
LDLa 3792 3829 3.66e-12 SMART
EGF 3835 3874 3.71e0 SMART
EGF_CA 3875 3912 6.8e-8 SMART
LY 3987 4033 4.24e0 SMART
LY 4050 4093 4.46e-3 SMART
LY 4094 4136 1.73e-9 SMART
EGF 4206 4239 2.45e0 SMART
EGF 4247 4280 2.48e-1 SMART
EGF 4283 4316 1.49e-4 SMART
EGF 4319 4352 1.69e-3 SMART
EGF 4355 4388 1.18e1 SMART
EGF_like 4391 4423 6.67e1 SMART
EGF 4424 4458 1.61e0 SMART
transmembrane domain 4476 4498 N/A INTRINSIC
low complexity region 4499 4509 N/A INTRINSIC
low complexity region 4512 4523 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the low density lipoprotein (LDL) receptor family. These receptors play a wide variety of roles in normal cell function and development due to their interactions with multiple ligands. Disruption of this gene has been reported in several types of cancer. [provided by RefSeq, Jun 2016]
PHENOTYPE: Homozygous null mice appear normal, are fertile, have normal brain histology and function, normal plasma cholesterol and fasting triglycerides, and do not develop tumors. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, knock-out(3) Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 419 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700086D15Rik T A 11: 65,152,968 Q89L unknown Het
1700086D15Rik A C 11: 65,152,983 V84G unknown Het
1700086D15Rik A G 11: 65,153,254 F38S unknown Het
1700086D15Rik A G 11: 65,153,288 W27R unknown Het
1700086D15Rik A G 11: 65,153,302 L22P unknown Het
1810065E05Rik C T 11: 58,422,201 L27F probably benign Het
1810065E05Rik C T 11: 58,422,234 L38F possibly damaging Het
1810065E05Rik C T 11: 58,425,799 L202F probably benign Het
2210407C18Rik G A 11: 58,608,509 P161L probably benign Het
2210407C18Rik A G 11: 58,612,561 L47P probably benign Het
2210407C18Rik T G 11: 58,612,571 S44R probably benign Het
2810021J22Rik C T 11: 58,880,535 A281V probably benign Het
4930438A08Rik A G 11: 58,294,018 T521A unknown Het
4932415D10Rik CGAATCTGCACACTGAGGACTTGGCCCTGGGATGCATGCAGGAGAATCTGCACACTGAGGACTTGGCCCTGGGATGCATGCAGGAGAATCTGCACACTGAGGACTTGGCCCTGGGATGCATGCAGGAGAATCTGCACACTGAGGACTTGGCCCTGGGATGTATGCAGGAGAATCTGCACACTGAGGACTTGGCCCTGGG CGAATCTGCACACTGAGGACTTGGCCCTGGGATGCATGCAGGAGAATCTGCACACTGAGGACTTGGCCCTGGGATGCATGCAGGAGAATCTGCACACTGAGGACTTGGCCCTGGGATGTATGCAGGAGAATCTGCACACTGAGGACTTGGCCCTGGG 10: 82,288,556 probably benign Het
4933427D14Rik G A 11: 72,176,709 T585I possibly damaging Het
4933427D14Rik G T 11: 72,189,616 P408H probably damaging Het
4933427D14Rik GGAAAAG GG 11: 72,195,710 probably null Het
4933427D14Rik AAAAGTAA AAA 11: 72,195,712 probably null Het
4933427D14Rik A G 11: 72,195,743 C281R possibly damaging Het
4933427D14Rik T G 11: 72,195,754 K277T probably damaging Het
4933427D14Rik T TCCCCAGC 11: 72,195,764 probably null Het
4933427D14Rik G A 11: 72,198,482 P192L probably benign Het
4933427D14Rik C A 11: 72,198,534 A175S probably benign Het
4933427D14Rik T G 11: 72,198,924 S45R probably damaging Het
Adgra3 G A 5: 49,979,079 A688V probably damaging Het
Adh1 T C 3: 138,286,783 I220T probably damaging Het
Adh4 T C 3: 138,419,330 probably null Het
Akap10 T A 11: 61,915,270 S211C probably benign Het
Alg10b C A 15: 90,228,194 L414I possibly damaging Het
Alox8 C T 11: 69,186,047 R536Q probably benign Het
Alox8 A G 11: 69,197,496 V76A probably benign Het
Aloxe3 A G 11: 69,128,675 Q138R probably benign Het
Aloxe3 C T 11: 69,148,603 A667V probably benign Het
Ank2 A G 3: 126,955,952 F476S probably damaging Het
Aplp2 T A 9: 31,152,341 E657V possibly damaging Het
Aspa G T 11: 73,322,187 L110I probably benign Het
Atp6v1g3 A G 1: 138,273,844 K27E possibly damaging Het
Aurkb C T 11: 69,047,866 R44W probably damaging Het
Aurkb T C 11: 69,047,870 F45S probably benign Het
B230118H07Rik T C 2: 101,610,605 K18E probably benign Het
B9d1 A T 11: 61,505,203 probably benign Het
BC034090 A G 1: 155,241,499 I291T probably benign Het
Borcs6 G A 11: 69,060,627 R277Q possibly damaging Het
Btnl10 T C 11: 58,919,312 V93A probably benign Het
Btnl10 AAAGA AAAGAAGA 11: 58,923,927 probably benign Het
Btnl10 AGAC AGACGAC 11: 58,923,929 probably benign Het
Btnl10 C T 11: 58,926,824 T250I unknown Het
Ccdc42 C T 11: 68,587,191 probably benign Het
Ccdc92b A G 11: 74,630,054 M61V possibly damaging Het
Chd3 C A 11: 69,348,445 E1753D probably benign Het
Chd3 A G 11: 69,361,451 W42R probably benign Het
Chrna9 T C 5: 65,976,780 F325L probably benign Het
Clec3a G A 8: 114,418,119 V12M possibly damaging Het
Cluh CCCCGAGCC CCCCGAGCCCGAGCC 11: 74,669,514 probably benign Het
Cluh CCGAGCC CCGAGCCCGAGCC 11: 74,669,516 probably benign Het
Cluh CGAGCCTGAGCCTGAGCC CGAGCCTGAGCCTGAGCCTGAGCC 11: 74,669,517 probably benign Het
Cluh GCCTGA GCCTGATCCTGA 11: 74,669,520 probably benign Het
Cluh CCTGAG CCTGAGTCTGAG 11: 74,669,521 probably benign Het
Cluh G GGGCCTA 11: 74,669,524 probably benign Het
Cluh TGAGCC TGAGCCCGAGCC 11: 74,669,529 probably benign Het
Cnot9 T A 1: 74,517,126 N27K probably benign Het
Cntrob C T 11: 69,305,578 R677H probably benign Het
Cntrob G A 11: 69,308,056 P622L probably benign Het
Crybg3 C T 16: 59,506,245 V1041M probably damaging Het
Cyb5d1 A G 11: 69,395,202 L31P probably benign Het
Cyb5d1 C A 11: 69,395,272 A8S probably benign Het
Dnah9 A C 11: 66,085,174 S1350A probably benign Het
Dnah9 G A 11: 66,147,381 H110Y probably benign Het
Eif2b5 C T 16: 20,498,921 A3V unknown Het
Elac2 T C 11: 64,979,189 S27P probably benign Het
Epn2 C A 11: 61,579,634 probably benign Het
Fam114a2 A G 11: 57,484,032 S494P probably benign Het
Fam114a2 G A 11: 57,490,114 A438V probably benign Het
Fam114a2 C T 11: 57,499,755 V318I probably benign Het
Fam114a2 T C 11: 57,499,797 N304D probably benign Het
Fam114a2 C T 11: 57,514,234 G14E probably benign Het
Fam83g G A 11: 61,703,194 R518Q probably benign Het
Fat2 TGTACCTCACCCCAGTACCT TGTACCT 11: 55,308,970 probably null Het
Fat2 T G 11: 55,309,799 K816N probably benign Het
Fbxw10 G C 11: 62,847,292 R4T probably benign Het
Fbxw10 G A 11: 62,876,845 V836I probably benign Het
Foxo6 C T 4: 120,287,135 G40R possibly damaging Het
Fsd1 C A 17: 55,993,920 P260T probably benign Het
Galnt10 G A 11: 57,765,688 V233I probably benign Het
Gemin5 C G 11: 58,122,289 S1446T probably benign Het
Gemin5 T C 11: 58,125,218 S1321G probably benign Het
Gemin5 T C 11: 58,130,071 M1097V probably benign Het
Gemin5 C G 11: 58,139,510 A830P probably benign Het
Gemin5 C G 11: 58,139,575 C808S probably benign Het
Gemin5 C G 11: 58,146,519 E623D probably benign Het
Ggnbp2 C T 11: 84,836,652 R481Q probably benign Het
Gjc2 T C 11: 59,176,433 S408G unknown Het
Gjc2 ACCCTCCCT ACCCTCCCTCCCT 11: 59,182,735 probably benign Het
Glod4 C A 11: 76,242,993 probably null Het
Glod4 A G 11: 76,243,010 V6A probably benign Het
Glod4 T C 11: 76,243,604 K14R probably benign Het
Glod4 T C 11: 76,243,605 K14E probably benign Het
Glp2r C A 11: 67,709,568 R485L probably damaging Het
Glp2r C A 11: 67,709,644 V460F probably benign Het
Glp2r C G 11: 67,709,646 G459A probably benign Het
Glp2r C T 11: 67,740,167 V295I probably benign Het
Glp2r A G 11: 67,741,052 V283A probably benign Het
Glp2r T C 11: 67,741,059 I281V probably benign Het
Glp2r T C 11: 67,742,303 T235A probably benign Het
Glp2r A G 11: 67,744,947 V189A probably benign Het
Glp2r C A 11: 67,770,836 A13S probably benign Het
Gm12253 G C 11: 58,434,541 S13T possibly damaging Het
Gm12253 A G 11: 58,434,832 E43G probably benign Het
Gm12253 A C 11: 58,434,860 E52D probably benign Het
Gm12253 A C 11: 58,435,411 E84A probably benign Het
Gm12253 G A 11: 58,435,483 S108N probably benign Het
Gm12253 G A 11: 58,441,009 A215T possibly damaging Het
Gm12258 T G 11: 58,858,300 S100R Het
Gm12258 C T 11: 58,858,436 R146W Het
Gm12258 G A 11: 58,858,938 R313H unknown Het
Gm12258 G A 11: 58,858,950 G317E unknown Het
Gm12258 A T 11: 58,859,007 E336V unknown Het
Gm12258 A G 11: 58,859,187 probably benign Het
Gm12258 T A 11: 58,859,188 probably benign Het
Gm12258 G C 11: 58,859,864 G622R unknown Het
Golga5 A G 12: 102,474,594 E196G probably benign Het
Gps2 C T 11: 69,916,304 A60V probably benign Het
Gucy2e C A 11: 69,223,605 A1033S probably benign Het
Gucy2e C G 11: 69,236,603 G15R unknown Het
Guk1 G A 11: 59,191,921 probably benign Het
Haspin T C 11: 73,137,348 Q305R probably benign Het
Haspin A G 11: 73,137,951 L104P probably benign Het
Hes7 T C 11: 69,122,956 S214P probably benign Het
Hic1 G A 11: 75,167,526 T179M probably damaging Het
Iba57 CAGA CAGAGA 11: 59,161,503 probably null Het
Iba57 AG AGCG 11: 59,161,504 probably null Het
Iba57 T C 11: 59,161,555 T87A unknown Het
Iba57 T C 11: 59,161,558 T86A unknown Het
Iba57 C G 11: 59,163,039 G36R unknown Het
Ifi207 G A 1: 173,730,527 T215I unknown Het
Igtp T G 11: 58,206,343 D113E probably damaging Het
Igtp C G 11: 58,206,965 L321V possibly damaging Het
Igtp C G 11: 58,207,118 L372V probably benign Het
Irgm2 T A 11: 58,219,513 V10D probably benign Het
Irgm2 A G 11: 58,219,563 N27D probably benign Het
Irgm2 T C 11: 58,219,912 I143T probably benign Het
Irgm2 T C 11: 58,219,954 L157S probably benign Het
Irgm2 G A 11: 58,220,007 V175I probably benign Het
Irgm2 G A 11: 58,220,098 S205N probably benign Het
Irgm2 A C 11: 58,220,125 H214P probably benign Het
Irgm2 G T 11: 58,220,412 A310S possibly damaging Het
Irgm2 C G 11: 58,220,563 T360S probably benign Het
Itgae T A 11: 73,103,887 L22M possibly damaging Het
Itgae A T 11: 73,103,960 Q46L probably damaging Het
Itgae A G 11: 73,115,640 H378R probably benign Het
Itgae G A 11: 73,118,087 V465I probably benign Het
Itgae A T 11: 73,121,931 K696N probably benign Het
Itgae G T 11: 73,121,957 G705V probably benign Het
Itgae C G 11: 73,134,127 S1028W probably benign Het
Kif1c C T 11: 70,724,114 P578L probably benign Het
Klhdc7a A G 4: 139,966,541 I365T probably damaging Het
Kmt2d T C 15: 98,851,744 N2656D unknown Het
Larp1 G A 11: 58,042,340 V257I probably benign Het
Llgl1 ACCCCAGCCCTTCTGATTACTGCCCTCCCCAGC ACCCCAGC 11: 60,713,097 probably null Het
Lypd8 T C 11: 58,382,775 Y27H probably benign Het
Lypd8 C A 11: 58,384,649 A70E possibly damaging Het
Lypd8 G A 11: 58,384,663 E75K probably benign Het
Lypd8 CAATCACCAACA CAATCACCAACAGTTCCCTCGCCTCTGTTACCCCACAAATCACCAACA 11: 58,390,233 probably benign Het
Mapk7 CGCTGGTGCTGG CGCTGGTGCTGGTGCTGG 11: 61,490,212 probably benign Het
Mapk7 TGGGGCAGGGGCAGGGGCAGG TGGCGCTGGGGCAGGGGCAGGGGCAGGGGCAGG 11: 61,490,227 probably benign Het
Mfap3 A T 11: 57,528,040 I9F possibly damaging Het
Mfap3 G A 11: 57,528,076 G21S probably benign Het
Mrm3 G A 11: 76,244,077 R102K probably benign Het
Mrm3 C T 11: 76,247,395 P203L probably benign Het
Mrpl22 G A 11: 58,171,695 A4T unknown Het
Mrpl55 A G 11: 59,204,173 probably null Het
Mrpl55 A T 11: 59,204,589 L26F probably benign Het
Myh1 A C 11: 67,204,446 T211P probably benign Het
Myh8 A C 11: 67,297,486 N991T probably benign Het
Myo18a C A 11: 77,853,817 F1970L possibly damaging Het
Myocd A G 11: 65,184,592 S697P probably benign Het
Nlgn2 A G 11: 69,828,394 V210A possibly damaging Het
Nlrp1a T C 11: 71,092,243 K1299R probably benign Het
Nlrp1a C T 11: 71,097,251 R1131Q probably damaging Het
Nlrp1a T C 11: 71,099,616 I1038V probably benign Het
Nlrp1a T C 11: 71,124,088 E112G probably benign Het
Nlrp1a C G 11: 71,142,529 probably null Het
Nlrp1b C A 11: 71,181,708 M436I probably benign Het
Nlrp1b A C 11: 71,181,713 S435A probably benign Het
Nlrp1b A G 11: 71,181,799 I406T probably benign Het
Nlrp1b A G 11: 71,182,322 Y232H probably benign Het
Nlrp1b A T 11: 71,182,440 D192E probably benign Het
Nlrp1b T C 11: 71,182,454 T188A probably benign Het
Nlrp1b C G 11: 71,182,544 E158Q probably benign Het
Nlrp1b A T 11: 71,182,552 M155K probably benign Het
Nlrp1b T A 11: 71,182,570 Q149L probably benign Het
Nlrp1b T C 11: 71,182,677 I113M probably benign Het
Nmur2 T C 11: 56,040,278 I202M probably benign Het
Obscn G A 11: 59,000,889 A6939V probably benign Het
Obscn C G 11: 59,009,193 G938A probably benign Het
Obscn G C 11: 59,013,188 T7320S probably benign Het
Obscn C T 11: 59,031,108 R5954Q probably damaging Het
Obscn G C 11: 59,039,150 P5080A probably benign Het
Obscn T A 11: 59,039,164 Q5075L probably damaging Het
Obscn T C 11: 59,041,775 I4869V probably benign Het
Obscn T C 11: 59,042,950 T5363A probably benign Het
Obscn G A 11: 59,043,027 A5337V probably benign Het
Obscn G A 11: 59,043,052 R5329C probably benign Het
Obscn C T 11: 59,049,480 D5354N Het
Obscn C A 11: 59,049,788 R4593S possibly damaging Het
Obscn T C 11: 59,049,797 T5307A Het
Obscn G A 11: 59,051,557 T4372M probably benign Het
Obscn T C 11: 59,052,613 M4237V probably benign Het
Obscn C T 11: 59,053,768 R4700Q probably benign Het
Obscn T C 11: 59,053,825 K4681R probably benign Het
Obscn T C 11: 59,054,218 E4658G probably benign Het
Obscn C T 11: 59,054,350 R4614Q probably benign Het
Obscn T C 11: 59,055,505 D4458G probably damaging Het
Obscn C T 11: 59,055,514 R4455K probably benign Het
Obscn G T 11: 59,056,110 A4066E possibly damaging Het
Obscn A G 11: 59,056,769 M4478T Het
Obscn C A 11: 59,060,997 G3977W probably damaging Het
Obscn C T 11: 59,061,562 G3894R probably benign Het
Obscn CCACACACACACAC CCACACACACAC 11: 59,063,453 probably null Het
Obscn T C 11: 59,063,474 T4037A Het
Obscn T C 11: 59,063,576 K3727E probably damaging Het
Obscn G A 11: 59,067,147 R3576C probably benign Het
Obscn C T 11: 59,067,829 V3433I probably benign Het
Obscn G A,C 11: 59,069,833 silent Het
Obscn C A 11: 59,069,931 A3185S probably benign Het
Obscn C T 11: 59,076,508 V2792I possibly damaging Het
Obscn G A 11: 59,079,158 R53C probably damaging Het
Obscn C G 11: 59,079,896 V2328L probably benign Het
Obscn C A 11: 59,081,872 G2116V possibly damaging Het
Obscn C T 11: 59,086,679 R1865H probably benign Het
Obscn T C 11: 59,086,701 R1858G probably benign Het
Obscn A G 11: 59,086,739 V1845A probably benign Het
Obscn A G 11: 59,093,316 F1771S probably benign Het
Obscn C T 11: 59,093,413 V1739M possibly damaging Het
Obscn G T 11: 59,093,508 A1707D possibly damaging Het
Obscn C T 11: 59,093,509 A1707T probably benign Het
Obscn G A 11: 59,093,559 A1690V probably benign Het
Obscn C T 11: 59,099,909 A1613T possibly damaging Het
Obscn T C 11: 59,099,929 H1606R probably benign Het
Obscn C G 11: 59,103,341 A1572P probably damaging Het
Obscn T C 11: 59,103,514 H1514R probably benign Het
Obscn G A 11: 59,103,538 A1506V probably benign Het
Obscn T C 11: 59,112,554 E1306G probably benign Het
Obscn T C 11: 59,122,737 M1095V probably benign Het
Obscn C T 11: 59,128,066 A949T probably benign Het
Obscn C T 11: 59,128,069 V973M probably damaging Het
Obscn G T 11: 59,129,837 L794M probably benign Het
Obscn C T 11: 59,130,623 R797H probably damaging Het
Obscn C T 11: 59,133,111 A578T possibly damaging Het
Obscn G A 11: 59,133,240 P535S probably damaging Het
Obscn C G 11: 59,133,246 A533P probably benign Het
Obscn T C 11: 59,135,679 I233V probably benign Het
Olfr116 A G 17: 37,623,844 S264P probably damaging Het
Olfr224 G A 11: 58,566,562 A261V probably benign Het
Olfr224 A T 11: 58,566,695 S217T probably benign Het
Olfr224 C T 11: 58,567,094 V84I probably benign Het
Olfr311 G C 11: 58,841,081 probably benign Het
Olfr311 G T 11: 58,841,119 A2S probably benign Het
Olfr311 C T 11: 58,841,206 L31F probably benign Het
Olfr311 T C 11: 58,841,258 I48T probably benign Het
Olfr311 G A 11: 58,841,743 A210T probably benign Het
Olfr311 A G 11: 58,841,789 H225R probably benign Het
Olfr313 A G 11: 58,817,061 I18V probably benign Het
Olfr313 T C 11: 58,817,296 V96A probably benign Het
Olfr313 A C 11: 58,817,394 I129L probably benign Het
Olfr313 C G 11: 58,817,417 H136Q probably benign Het
Olfr313 T C 11: 58,817,682 C225R probably benign Het
Olfr313 C G 11: 58,817,818 P270R probably benign Het
Olfr314 A G 11: 58,786,947 T238A probably damaging Het
Olfr316 G A 11: 58,757,967 A101T probably benign Het
Olfr316 C T 11: 58,758,069 L135F probably benign Het
Olfr316 A G 11: 58,758,105 S147G probably benign Het
Olfr316 G A 11: 58,758,327 V221M probably damaging Het
Olfr316 A C 11: 58,758,342 I226L probably benign Het
Olfr316 A C 11: 58,758,360 K232Q probably benign Het
Olfr317 T G 11: 58,732,374 N264H probably benign Het
Olfr317 G A 11: 58,732,469 A232V probably benign Het
Olfr317 T C 11: 58,732,649 H172R probably benign Het
Olfr317 C A 11: 58,733,222 probably benign Het
Olfr318 G A 11: 58,721,096 probably benign Het
Olfr319 A C 11: 58,701,958 I86L probably benign Het
Olfr319 C T 11: 58,702,327 L209F possibly damaging Het
Olfr319 C A 11: 58,702,396 Q232K probably benign Het
Olfr320 G T 11: 58,683,932 D20Y probably benign Het
Olfr320 T C 11: 58,683,989 F39L probably benign Het
Olfr320 G A 11: 58,684,115 V81M probably benign Het
Olfr320 G A 11: 58,684,257 R128Q probably benign Het
Olfr320 C T 11: 58,684,463 H197Y probably benign Het
Olfr320 T C 11: 58,684,722 L283P probably benign Het
Olfr322 T G 11: 58,666,516 I319R probably benign Het
Olfr323 G A 11: 58,625,249 S79F probably benign Het
Olfr323 C G 11: 58,625,304 G61R probably benign Het
Olfr323 G A 11: 58,625,762 P95S probably benign Het
Olfr323 T G 11: 58,625,793 K84N probably benign Het
Olfr323 A C 11: 58,625,906 C46G possibly damaging Het
Olfr324 A C 11: 58,597,518 I35L probably benign Het
Olfr324 A G 11: 58,597,530 I39V probably benign Het
Olfr324 A G 11: 58,597,665 S84G possibly damaging Het
Olfr324 A G 11: 58,597,950 S179G probably benign Het
Olfr325 C T 11: 58,580,924 H27Y probably benign Het
Olfr325 T C 11: 58,580,931 V29A probably benign Het
Olfr325 G A 11: 58,581,002 V53I probably benign Het
Olfr325 T G 11: 58,581,296 L151V probably benign Het
Olfr325 G C 11: 58,581,657 S271T probably benign Het
Olfr328 T C 11: 58,551,561 K226R probably benign Het
Olfr328 C T 11: 58,551,975 S88N probably benign Het
Olfr328 C T 11: 58,552,114 A42T probably benign Het
Olfr329-ps G T 11: 58,543,446 S23Y probably benign Het
Olfr331 T C 11: 58,501,648 M309V probably benign Het
Olfr331 T C 11: 58,502,101 I158V probably benign Het
Olfr331 C A 11: 58,502,110 V155F probably benign Het
Olfr331 GGTGGATTGGTATGTGGAT GGTGGAT 11: 58,502,386 probably benign Het
Olfr331 C G 11: 58,502,461 V38L probably benign Het
Olfr331 C T 11: 58,502,570 M1I probably null Het
Olfr332 C A 11: 58,489,748 E336* probably null Het
Olfr332 C T 11: 58,490,297 A153T probably benign Het
Olfr332 T C 11: 58,490,488 Q89R probably benign Het
Olfr420 C A 1: 174,159,341 C189* probably null Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Ovca2 T C 11: 75,178,702 T32A probably benign Het
Pfkfb1 T G X: 150,608,631 V25G probably damaging Het
Pimreg TCACA TCA 11: 72,044,975 probably benign Het
Pimreg G A 11: 72,045,153 R154H probably damaging Het
Pitpnm3 T C 11: 72,064,129 K520E probably benign Het
Pitpnm3 C T 11: 72,120,143 R21Q probably benign Het
Ppp1r12b C G 1: 134,955,524 V87L probably benign Het
Pramef12 A G 4: 144,395,947 L9P probably damaging Het
Prpsap2 A C 11: 61,756,252 V21G possibly damaging Het
Rabep1 C CT 11: 70,940,084 probably null Het
Rai1 A G 11: 60,187,563 N818D probably benign Het
Rap1gap2 C T 11: 74,596,895 E52K probably benign Het
Rc3h2 T C 2: 37,399,600 H400R possibly damaging Het
Rnf112 A G 11: 61,450,949 L343P unknown Het
Rnf167 C CACAGGGA 11: 70,650,820 probably null Het
Rtn4rl1 C T 11: 75,266,037 P432S probably benign Het
Shisa6 CGCCGC CGCCGCGGCCGC 11: 66,525,698 probably benign Het
Shisa6 CGCCGC CGCCGCAGCCGC 11: 66,525,707 probably benign Het
Slc2a4 GGCCG GG 11: 69,943,992 probably benign Het
Slc2a4 GCC G 11: 69,943,993 probably null Het
Slc6a4 G A 11: 77,010,556 G39E probably benign Het
Slc6a4 A G 11: 77,013,032 K152R probably benign Het
Smcr8 A G 11: 60,777,980 probably benign Het
Smcr8 T C 11: 60,779,106 V360A probably benign Het
Smcr8 C A 11: 60,779,873 R616S probably benign Het
Smg6 G T 11: 75,156,266 A1262S probably benign Het
Spns3 T C 11: 72,550,037 I58V probably benign Het
Spns3 G A 11: 72,550,091 P40S probably benign Het
Spns3 T C 11: 72,550,160 S17G probably benign Het
Srebf1 C T 11: 60,206,235 V256M probably benign Het
Tekt1 T C 11: 72,359,771 Q33R probably benign Het
Timm22 T G 11: 76,407,117 V18G probably benign Het
Tmem102 C G 11: 69,805,076 G53A possibly damaging Het
Tmem102 G C 11: 69,805,101 R45G probably benign Het
Tmem11 A G 11: 60,875,832 probably benign Het
Tom1l2 C T 11: 60,241,856 A414T probably benign Het
Tomm20l ACAAGATTC AC 12: 71,121,984 probably null Het
Top3a C T 11: 60,750,584 G425S probably benign Het
Trim16 C T 11: 62,820,602 A33V probably benign Het
Trim16 G C 11: 62,820,676 V58L probably benign Het
Trim16 TGAAGA TGAAGAAGA 11: 62,820,690 probably benign Het
Trim16 GA GAACA 11: 62,820,694 probably benign Het
Trim16 A AAGC 11: 62,820,695 probably benign Het
Trim16 G A 11: 62,836,817 E322K probably benign Het
Trim16 T C 11: 62,840,746 V481A probably benign Het
Trim16 C A 11: 62,840,849 D515E probably benign Het
Trim17 G A 11: 58,965,505 M129I probably benign Het
Trim17 A G 11: 58,970,446 N259S probably benign Het
Trim23 G A 13: 104,178,887 A3T probably benign Het
Trim58 C A 11: 58,640,858 L131M possibly damaging Het
Trim58 A G 11: 58,651,660 N482S probably benign Het
Trmt1l A G 1: 151,457,580 N642S possibly damaging Het
Trpv1 C G 11: 73,240,601 P322A possibly damaging Het
Trpv1 C A 11: 73,254,291 D734E probably benign Het
Trpv3 C T 11: 73,269,687 A9V probably benign Het
Trpv3 G A 11: 73,278,977 A125T probably benign Het
Trpv3 A G 11: 73,283,676 T290A probably benign Het
Tvp23b A C 11: 62,881,943 N7H possibly damaging Het
Usp43 AGGGC AGGGCAGGGGATGAACCTCGGGC 11: 67,855,719 probably benign Het
Usp43 C T 11: 67,856,506 G792S probably benign Het
Vamp2 C T 11: 69,088,585 probably benign Het
Vamp2 G A 11: 69,090,063 G124R possibly damaging Het
Vmn2r15 G T 5: 109,286,663 P725H probably damaging Het
Vmn2r18 T C 5: 151,585,032 D209G probably benign Het
Wdr4 C T 17: 31,512,203 G61E probably damaging Het
Xaf1 G A 11: 72,306,600 R134H probably benign Het
Xaf1 G C 11: 72,306,603 C135S probably damaging Het
Xaf1 C A 11: 72,306,608 L137I probably benign Het
Xaf1 A G 11: 72,308,650 E71G probably benign Het
Xaf1 T G 11: 72,308,966 C176W unknown Het
Xaf1 GGCT GGCTGGCCAGCT 11: 72,309,020 probably null Het
Xaf1 G C 11: 72,309,030 V198L unknown Het
Xaf1 T C 11: 72,309,055 L206S unknown Het
Zfhx4 C G 3: 5,243,007 S431C probably damaging Het
Zfp286 G A 11: 62,784,956 T60M probably damaging Het
Zfp286 A G 11: 62,787,969 V44A probably benign Het
Zfp287 C T 11: 62,713,807 R758H probably benign Het
Zfp287 C G 11: 62,715,349 C244S probably benign Het
Zfp287 G A 11: 62,722,931 R225* probably null Het
Zfp39 G C 11: 58,890,045 Y630* probably null Het
Zfp39 A C 11: 58,890,047 Y630D probably benign Het
Zfp39 G C 11: 58,890,304 T544R possibly damaging Het
Zfp39 G C 11: 58,890,447 D496E probably benign Het
Zfp39 T C 11: 58,890,448 D496G possibly damaging Het
Zfp39 T C 11: 58,890,700 N412S possibly damaging Het
Zfp39 G T 11: 58,890,771 N388K probably benign Het
Zfp39 A G 11: 58,890,779 S386P probably benign Het
Zfp39 A C 11: 58,890,876 H353Q probably damaging Het
Zfp39 A C 11: 58,890,886 V350G probably benign Het
Zfp39 A G 11: 58,890,898 V346A probably benign Het
Zfp39 T A 11: 58,890,925 K337M probably benign Het
Zfp39 T A 11: 58,891,141 H265L probably damaging Het
Zfp39 A G 11: 58,891,297 I213T probably benign Het
Zfp39 T C 11: 58,891,316 K207E probably benign Het
Zfp39 G T 11: 58,900,581 S93R probably benign Het
Zfp39 T G 11: 58,900,583 S93R probably benign Het
Zfp672 G T 11: 58,329,626 T49K unknown Het
Zfp692 G T 11: 58,309,033 E149D probably benign Het
Zfp692 G A 11: 58,310,018 V242I probably benign Het
Zzef1 G A 11: 72,889,182 R1927H probably benign Het
Other mutations in Lrp1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Lrp1b APN 2 41110861 missense probably damaging 1.00
IGL00543:Lrp1b APN 2 41468948 missense possibly damaging 0.69
IGL00578:Lrp1b APN 2 40679173 missense unknown
IGL01020:Lrp1b APN 2 40998247 missense probably damaging 1.00
IGL01092:Lrp1b APN 2 40750947 missense probably damaging 0.97
IGL01155:Lrp1b APN 2 41770935 missense probably benign 0.17
IGL01361:Lrp1b APN 2 41110751 splice site probably benign
IGL01377:Lrp1b APN 2 40601538 missense probably damaging 1.00
IGL01459:Lrp1b APN 2 40860714 missense probably damaging 0.97
IGL01473:Lrp1b APN 2 40611486 missense probably damaging 0.97
IGL01528:Lrp1b APN 2 40919182 missense probably damaging 0.99
IGL01536:Lrp1b APN 2 41110883 missense probably benign 0.01
IGL01564:Lrp1b APN 2 40677486 splice site probably benign
IGL01747:Lrp1b APN 2 40860685 missense probably damaging 1.00
IGL01764:Lrp1b APN 2 40697442 missense unknown
IGL01783:Lrp1b APN 2 41312572 missense probably damaging 1.00
IGL01802:Lrp1b APN 2 41511482 missense probably benign 0.07
IGL01826:Lrp1b APN 2 41449234 missense probably damaging 1.00
IGL01884:Lrp1b APN 2 41284213 nonsense probably null
IGL01908:Lrp1b APN 2 40702804 missense probably benign
IGL01935:Lrp1b APN 2 41268355 missense probably damaging 1.00
IGL01959:Lrp1b APN 2 41312527 missense probably damaging 0.99
IGL02010:Lrp1b APN 2 41468942 missense probably damaging 1.00
IGL02022:Lrp1b APN 2 41282160 missense probably damaging 1.00
IGL02028:Lrp1b APN 2 41511452 missense probably damaging 1.00
IGL02034:Lrp1b APN 2 41268370 nonsense probably null
IGL02043:Lrp1b APN 2 40697525 missense probably null 0.44
IGL02066:Lrp1b APN 2 41111079 nonsense probably null
IGL02085:Lrp1b APN 2 40889309 missense probably benign
IGL02137:Lrp1b APN 2 40730688 splice site probably benign
IGL02218:Lrp1b APN 2 41295672 missense probably benign 0.11
IGL02409:Lrp1b APN 2 41445196 missense possibly damaging 0.93
IGL02513:Lrp1b APN 2 41110753 critical splice donor site probably null
IGL02543:Lrp1b APN 2 40870401 missense possibly damaging 0.89
IGL02701:Lrp1b APN 2 41246017 missense possibly damaging 0.50
IGL02728:Lrp1b APN 2 40801398 missense probably benign 0.03
IGL02739:Lrp1b APN 2 41498215 missense probably damaging 1.00
IGL02748:Lrp1b APN 2 40702749 missense probably damaging 0.99
IGL02754:Lrp1b APN 2 40702794 missense probably benign 0.02
IGL02797:Lrp1b APN 2 41671057 missense
IGL02813:Lrp1b APN 2 40679217 critical splice acceptor site probably null
IGL02831:Lrp1b APN 2 41193591 missense probably damaging 1.00
IGL02869:Lrp1b APN 2 40701830 missense unknown
IGL02946:Lrp1b APN 2 41312559 missense probably damaging 1.00
IGL02952:Lrp1b APN 2 41506703 missense probably benign 0.33
IGL02958:Lrp1b APN 2 41302916 missense probably damaging 1.00
IGL02977:Lrp1b APN 2 40730735 missense probably damaging 1.00
IGL03001:Lrp1b APN 2 40927889 missense probably damaging 1.00
IGL03010:Lrp1b APN 2 42323606 missense possibly damaging 0.94
IGL03060:Lrp1b APN 2 40637753 missense probably benign 0.04
IGL03129:Lrp1b APN 2 41312466 splice site probably benign
IGL03166:Lrp1b APN 2 41111038 missense probably damaging 1.00
IGL03170:Lrp1b APN 2 40697444 missense unknown
IGL03195:Lrp1b APN 2 41471122 missense possibly damaging 0.95
IGL03224:Lrp1b APN 2 41471031 missense possibly damaging 0.92
IGL03251:Lrp1b APN 2 40600267 missense probably benign 0.20
IGL03281:Lrp1b APN 2 40725514 missense probably benign 0.01
IGL03295:Lrp1b APN 2 40678987 splice site probably null
IGL03340:Lrp1b APN 2 41468969 missense probably damaging 0.97
IGL03391:Lrp1b APN 2 41295641 missense possibly damaging 0.95
IGL03401:Lrp1b APN 2 41110778 missense probably benign 0.18
IGL03403:Lrp1b APN 2 40702824 missense probably benign 0.16
IGL03408:Lrp1b APN 2 40858582 missense probably damaging 0.97
Fetching UTSW 2 40879555 missense probably benign 0.00
Heiden UTSW 2 40637775 missense probably benign 0.00
hither UTSW 2 40702848 missense probably benign 0.00
Roeslein UTSW 2 40725907 missense probably damaging 1.00
I2288:Lrp1b UTSW 2 41122932 missense probably damaging 0.99
I2289:Lrp1b UTSW 2 41122932 missense probably damaging 0.99
LCD18:Lrp1b UTSW 2 42237562 intron probably benign
PIT4431001:Lrp1b UTSW 2 41004755 missense
PIT4585001:Lrp1b UTSW 2 41269204 missense
R0022:Lrp1b UTSW 2 40998038 splice site probably benign
R0022:Lrp1b UTSW 2 40998038 splice site probably benign
R0054:Lrp1b UTSW 2 40742817 missense probably benign 0.11
R0054:Lrp1b UTSW 2 40742817 missense probably benign 0.11
R0094:Lrp1b UTSW 2 41282030 unclassified probably benign
R0102:Lrp1b UTSW 2 41408985 splice site probably benign
R0123:Lrp1b UTSW 2 40596983 missense probably damaging 1.00
R0128:Lrp1b UTSW 2 41511508 missense probably damaging 1.00
R0130:Lrp1b UTSW 2 41511508 missense probably damaging 1.00
R0134:Lrp1b UTSW 2 40596983 missense probably damaging 1.00
R0135:Lrp1b UTSW 2 41269239 missense probably damaging 0.99
R0153:Lrp1b UTSW 2 41123019 missense possibly damaging 0.92
R0178:Lrp1b UTSW 2 40725907 missense probably damaging 1.00
R0225:Lrp1b UTSW 2 40596983 missense probably damaging 1.00
R0242:Lrp1b UTSW 2 40998183 missense probably benign 0.01
R0242:Lrp1b UTSW 2 40998183 missense probably benign 0.01
R0312:Lrp1b UTSW 2 41282171 missense probably damaging 1.00
R0325:Lrp1b UTSW 2 40851711 missense probably damaging 1.00
R0330:Lrp1b UTSW 2 40701761 nonsense probably null
R0372:Lrp1b UTSW 2 40730798 missense probably benign 0.30
R0400:Lrp1b UTSW 2 40750914 missense probably benign 0.40
R0408:Lrp1b UTSW 2 40677591 missense probably damaging 1.00
R0498:Lrp1b UTSW 2 41458405 missense probably benign 0.19
R0563:Lrp1b UTSW 2 40750914 missense probably benign 0.40
R0569:Lrp1b UTSW 2 40889239 missense probably benign 0.11
R0622:Lrp1b UTSW 2 41728551 critical splice donor site probably null
R0682:Lrp1b UTSW 2 41295641 missense probably benign 0.01
R0727:Lrp1b UTSW 2 40750944 missense probably benign 0.40
R0747:Lrp1b UTSW 2 40870341 missense probably damaging 1.00
R0761:Lrp1b UTSW 2 41185935 missense probably damaging 0.99
R0905:Lrp1b UTSW 2 41284185 missense probably damaging 1.00
R0959:Lrp1b UTSW 2 41268354 missense possibly damaging 0.83
R1124:Lrp1b UTSW 2 40875051 missense probably damaging 1.00
R1158:Lrp1b UTSW 2 40677494 missense unknown
R1265:Lrp1b UTSW 2 41476654 missense probably damaging 1.00
R1276:Lrp1b UTSW 2 41728576 missense probably benign 0.35
R1277:Lrp1b UTSW 2 40725945 missense probably benign
R1282:Lrp1b UTSW 2 40860761 missense probably damaging 1.00
R1291:Lrp1b UTSW 2 41341895 missense probably benign 0.05
R1316:Lrp1b UTSW 2 40702804 missense probably benign
R1340:Lrp1b UTSW 2 40702794 missense probably benign 0.02
R1371:Lrp1b UTSW 2 40647153 missense probably damaging 1.00
R1415:Lrp1b UTSW 2 40629664 missense probably damaging 1.00
R1416:Lrp1b UTSW 2 40998216 missense probably damaging 1.00
R1417:Lrp1b UTSW 2 41004641 missense probably benign 0.14
R1465:Lrp1b UTSW 2 41111059 missense probably benign 0.00
R1465:Lrp1b UTSW 2 41111059 missense probably benign 0.00
R1467:Lrp1b UTSW 2 40657356 splice site probably benign
R1468:Lrp1b UTSW 2 40927829 critical splice donor site probably null
R1468:Lrp1b UTSW 2 40927829 critical splice donor site probably null
R1480:Lrp1b UTSW 2 40903389 missense probably damaging 1.00
R1488:Lrp1b UTSW 2 41502024 missense probably benign 0.01
R1496:Lrp1b UTSW 2 42323662 missense probably damaging 0.98
R1542:Lrp1b UTSW 2 41123712 missense probably damaging 1.00
R1571:Lrp1b UTSW 2 41476646 missense probably damaging 1.00
R1598:Lrp1b UTSW 2 41511478 missense probably damaging 1.00
R1619:Lrp1b UTSW 2 40697589 missense unknown
R1697:Lrp1b UTSW 2 40822683 missense probably damaging 0.99
R1698:Lrp1b UTSW 2 40851806 nonsense probably null
R1699:Lrp1b UTSW 2 41185962 missense possibly damaging 0.91
R1715:Lrp1b UTSW 2 41185981 missense probably damaging 1.00
R1748:Lrp1b UTSW 2 41728706 missense possibly damaging 0.56
R1756:Lrp1b UTSW 2 41110825 missense probably damaging 1.00
R1889:Lrp1b UTSW 2 40919167 nonsense probably null
R1895:Lrp1b UTSW 2 40665147 missense unknown
R1902:Lrp1b UTSW 2 40860661 missense probably damaging 1.00
R1919:Lrp1b UTSW 2 41728729 missense probably benign 0.00
R1939:Lrp1b UTSW 2 40697589 missense unknown
R1946:Lrp1b UTSW 2 40665147 missense unknown
R1954:Lrp1b UTSW 2 40858441 missense probably damaging 1.00
R1970:Lrp1b UTSW 2 40875069 missense probably damaging 1.00
R1983:Lrp1b UTSW 2 41511404 critical splice donor site probably null
R2029:Lrp1b UTSW 2 41341849 missense probably benign 0.02
R2054:Lrp1b UTSW 2 40697482 missense unknown
R2108:Lrp1b UTSW 2 41110757 missense probably damaging 1.00
R2158:Lrp1b UTSW 2 40879555 missense probably benign 0.00
R2168:Lrp1b UTSW 2 41375846 missense probably damaging 1.00
R2184:Lrp1b UTSW 2 40730702 missense probably benign
R2188:Lrp1b UTSW 2 41408959 missense probably benign 0.25
R2200:Lrp1b UTSW 2 41284165 missense probably benign 0.43
R2342:Lrp1b UTSW 2 40919196 missense possibly damaging 0.89
R2421:Lrp1b UTSW 2 40882133 splice site probably benign
R2656:Lrp1b UTSW 2 41511581 missense probably damaging 0.99
R2864:Lrp1b UTSW 2 40874995 missense possibly damaging 0.92
R2874:Lrp1b UTSW 2 40851693 missense probably damaging 1.00
R2911:Lrp1b UTSW 2 41506692 missense probably benign 0.00
R2919:Lrp1b UTSW 2 41770899 missense probably damaging 1.00
R3027:Lrp1b UTSW 2 40870271 missense probably benign 0.33
R3083:Lrp1b UTSW 2 40600324 missense probably damaging 0.99
R3545:Lrp1b UTSW 2 40600288 missense probably damaging 1.00
R3546:Lrp1b UTSW 2 40600288 missense probably damaging 1.00
R3547:Lrp1b UTSW 2 40600288 missense probably damaging 1.00
R3709:Lrp1b UTSW 2 40697442 missense unknown
R3817:Lrp1b UTSW 2 40876658 missense probably damaging 1.00
R3876:Lrp1b UTSW 2 41445194 missense probably damaging 1.00
R3877:Lrp1b UTSW 2 41445194 missense probably damaging 1.00
R3896:Lrp1b UTSW 2 40922428 splice site probably null
R3901:Lrp1b UTSW 2 40822695 missense probably damaging 1.00
R3915:Lrp1b UTSW 2 41449236 missense probably damaging 1.00
R3922:Lrp1b UTSW 2 40677581 missense unknown
R3964:Lrp1b UTSW 2 41312470 splice site probably benign
R4013:Lrp1b UTSW 2 40802984 missense possibly damaging 0.66
R4014:Lrp1b UTSW 2 40802984 missense possibly damaging 0.66
R4015:Lrp1b UTSW 2 40802984 missense possibly damaging 0.66
R4017:Lrp1b UTSW 2 40802984 missense possibly damaging 0.66
R4031:Lrp1b UTSW 2 40702848 missense probably benign 0.00
R4095:Lrp1b UTSW 2 41449191 missense probably benign 0.03
R4108:Lrp1b UTSW 2 40665087 missense unknown
R4176:Lrp1b UTSW 2 41408393 missense probably damaging 1.00
R4181:Lrp1b UTSW 2 40611434 missense probably damaging 1.00
R4359:Lrp1b UTSW 2 40903065 missense probably damaging 1.00
R4410:Lrp1b UTSW 2 40665082 missense possibly damaging 0.96
R4416:Lrp1b UTSW 2 40663667 missense unknown
R4489:Lrp1b UTSW 2 40661489 unclassified probably benign
R4577:Lrp1b UTSW 2 40821719 missense probably damaging 1.00
R4623:Lrp1b UTSW 2 41246021 missense probably damaging 1.00
R4677:Lrp1b UTSW 2 40801484 missense probably damaging 1.00
R4684:Lrp1b UTSW 2 40922304 missense probably benign 0.44
R4714:Lrp1b UTSW 2 41110759 missense possibly damaging 0.90
R4721:Lrp1b UTSW 2 40715369 splice site probably null
R4755:Lrp1b UTSW 2 41269273 missense probably benign 0.07
R4755:Lrp1b UTSW 2 41471016 missense probably benign
R4774:Lrp1b UTSW 2 40661532 missense probably null 1.00
R4854:Lrp1b UTSW 2 41111077 missense probably damaging 1.00
R4880:Lrp1b UTSW 2 41770919 missense probably benign 0.07
R4885:Lrp1b UTSW 2 41468893 missense probably benign
R4901:Lrp1b UTSW 2 40821645 missense probably damaging 1.00
R4919:Lrp1b UTSW 2 40647234 missense probably benign 0.25
R4935:Lrp1b UTSW 2 41498393 missense probably benign 0.01
R4937:Lrp1b UTSW 2 40802885 splice site probably null
R4967:Lrp1b UTSW 2 41788974 missense probably damaging 1.00
R4968:Lrp1b UTSW 2 40702707 splice site probably null
R4968:Lrp1b UTSW 2 41789062 missense probably damaging 1.00
R5155:Lrp1b UTSW 2 41728622 splice site probably null
R5221:Lrp1b UTSW 2 41112982 missense possibly damaging 0.79
R5224:Lrp1b UTSW 2 41110840 missense possibly damaging 0.61
R5227:Lrp1b UTSW 2 40851793 missense possibly damaging 0.95
R5246:Lrp1b UTSW 2 41470940 critical splice donor site probably null
R5263:Lrp1b UTSW 2 41960679 missense probably damaging 1.00
R5274:Lrp1b UTSW 2 41344444 missense probably null 1.00
R5291:Lrp1b UTSW 2 40903003 missense probably damaging 1.00
R5362:Lrp1b UTSW 2 41375902 missense probably damaging 1.00
R5365:Lrp1b UTSW 2 40647125 missense possibly damaging 0.55
R5369:Lrp1b UTSW 2 41004613 nonsense probably null
R5419:Lrp1b UTSW 2 40730704 nonsense probably null
R5434:Lrp1b UTSW 2 41770868 missense probably damaging 0.96
R5452:Lrp1b UTSW 2 40922316 missense probably damaging 1.00
R5453:Lrp1b UTSW 2 41282237 missense probably damaging 1.00
R5496:Lrp1b UTSW 2 40927973 missense probably benign 0.02
R5524:Lrp1b UTSW 2 41110888 missense probably damaging 1.00
R5538:Lrp1b UTSW 2 40697474 missense unknown
R5571:Lrp1b UTSW 2 41408342 missense probably damaging 0.97
R5577:Lrp1b UTSW 2 40875123 missense possibly damaging 0.70
R5609:Lrp1b UTSW 2 41341795 missense probably damaging 1.00
R5635:Lrp1b UTSW 2 42652822 utr 5 prime probably benign
R5669:Lrp1b UTSW 2 41111038 missense probably damaging 1.00
R5672:Lrp1b UTSW 2 41341759 missense probably benign 0.01
R5690:Lrp1b UTSW 2 40750894 splice site probably null
R5752:Lrp1b UTSW 2 41295612 missense probably damaging 1.00
R5853:Lrp1b UTSW 2 40663726 missense unknown
R5869:Lrp1b UTSW 2 41004603 missense probably damaging 0.98
R5880:Lrp1b UTSW 2 41341814 missense probably benign 0.23
R5887:Lrp1b UTSW 2 40821707 missense possibly damaging 0.91
R5893:Lrp1b UTSW 2 40601587 missense probably damaging 1.00
R5894:Lrp1b UTSW 2 41498221 missense probably benign 0.11
R6019:Lrp1b UTSW 2 41302970 missense probably damaging 1.00
R6019:Lrp1b UTSW 2 41476809 missense probably damaging 1.00
R6021:Lrp1b UTSW 2 41344427 missense probably benign 0.02
R6045:Lrp1b UTSW 2 40701813 missense unknown
R6047:Lrp1b UTSW 2 40637775 missense probably benign 0.00
R6060:Lrp1b UTSW 2 40750934 missense
R6063:Lrp1b UTSW 2 41284144 nonsense probably null
R6090:Lrp1b UTSW 2 41185868 critical splice donor site probably null
R6112:Lrp1b UTSW 2 41341882 missense probably benign 0.14
R6128:Lrp1b UTSW 2 40860655 missense probably benign
R6149:Lrp1b UTSW 2 40875153 splice site probably null
R6174:Lrp1b UTSW 2 41449263 missense probably benign
R6177:Lrp1b UTSW 2 41123736 splice site probably null
R6257:Lrp1b UTSW 2 40596969 splice site probably null
R6267:Lrp1b UTSW 2 40657525 missense probably benign 0.00
R6268:Lrp1b UTSW 2 40821717 missense probably benign 0.01
R6331:Lrp1b UTSW 2 40803209 missense probably damaging 1.00
R6334:Lrp1b UTSW 2 41789033 missense probably benign
R6359:Lrp1b UTSW 2 41295596 missense probably damaging 1.00
R6371:Lrp1b UTSW 2 40851654 missense possibly damaging 0.61
R6421:Lrp1b UTSW 2 40889270 missense probably damaging 1.00
R6524:Lrp1b UTSW 2 40851804 missense possibly damaging 0.95
R6616:Lrp1b UTSW 2 40699631 missense unknown
R6632:Lrp1b UTSW 2 40725442 missense probably benign 0.23
R6656:Lrp1b UTSW 2 40637864 nonsense probably null
R6698:Lrp1b UTSW 2 41302946 missense probably damaging 1.00
R6741:Lrp1b UTSW 2 41245989 missense possibly damaging 0.82
R6742:Lrp1b UTSW 2 41471120 missense probably benign 0.31
R6811:Lrp1b UTSW 2 40715500 splice site probably null
R6811:Lrp1b UTSW 2 41449194 missense probably benign 0.01
R6855:Lrp1b UTSW 2 40628696 missense possibly damaging 0.66
R6888:Lrp1b UTSW 2 41471126 missense probably benign 0.18
R6946:Lrp1b UTSW 2 40697439 missense probably benign
R6984:Lrp1b UTSW 2 40822628 missense probably damaging 0.97
R7026:Lrp1b UTSW 2 41269222 missense probably damaging 1.00
R7028:Lrp1b UTSW 2 41246011 missense probably benign 0.45
R7036:Lrp1b UTSW 2 41112342 missense possibly damaging 0.89
R7043:Lrp1b UTSW 2 40922414 missense possibly damaging 0.84
R7071:Lrp1b UTSW 2 41408264 missense
R7077:Lrp1b UTSW 2 41770846 missense
R7115:Lrp1b UTSW 2 40998235 missense
R7143:Lrp1b UTSW 2 41312643 missense
R7146:Lrp1b UTSW 2 41375994 nonsense probably null
R7149:Lrp1b UTSW 2 40637860 missense
R7185:Lrp1b UTSW 2 40801512 critical splice acceptor site probably null
R7239:Lrp1b UTSW 2 41004713 missense
R7247:Lrp1b UTSW 2 41269212 missense
R7331:Lrp1b UTSW 2 40663610 splice site probably null
R7369:Lrp1b UTSW 2 41282039 missense
R7378:Lrp1b UTSW 2 41295669 missense
R7381:Lrp1b UTSW 2 40802917 missense
R7406:Lrp1b UTSW 2 41376018 critical splice acceptor site probably null
R7437:Lrp1b UTSW 2 40822645 missense
R7437:Lrp1b UTSW 2 40822646 missense
R7446:Lrp1b UTSW 2 41671057 missense
R7460:Lrp1b UTSW 2 40598466 missense
R7462:Lrp1b UTSW 2 41113029 missense
R7475:Lrp1b UTSW 2 41344576 missense
R7479:Lrp1b UTSW 2 40801505 missense
R7523:Lrp1b UTSW 2 41511461 missense
R7525:Lrp1b UTSW 2 40657416 missense
R7549:Lrp1b UTSW 2 40875122 missense
R7552:Lrp1b UTSW 2 40677570 missense
R7558:Lrp1b UTSW 2 41341936 missense
R7587:Lrp1b UTSW 2 40730717 missense
R7599:Lrp1b UTSW 2 40661549 missense
R7635:Lrp1b UTSW 2 41123597 critical splice donor site probably null
R7663:Lrp1b UTSW 2 42653035 unclassified probably benign
R7674:Lrp1b UTSW 2 42652909 start gained probably benign
R7681:Lrp1b UTSW 2 40874999 nonsense probably null
R7703:Lrp1b UTSW 2 41110786 missense
R7742:Lrp1b UTSW 2 40822629 missense
R7767:Lrp1b UTSW 2 40801505 missense
R7829:Lrp1b UTSW 2 40903448 nonsense probably null
R7861:Lrp1b UTSW 2 40697558 missense
R7868:Lrp1b UTSW 2 41449234 missense
R7883:Lrp1b UTSW 2 40665129 missense
R7956:Lrp1b UTSW 2 41282149 splice site probably null
R7963:Lrp1b UTSW 2 40927935 missense
R7964:Lrp1b UTSW 2 40598511 missense
R8035:Lrp1b UTSW 2 40860655 missense
R8046:Lrp1b UTSW 2 41269187 missense
R8128:Lrp1b UTSW 2 41269236 missense probably null
R8234:Lrp1b UTSW 2 41312656 missense
R8237:Lrp1b UTSW 2 40851774 missense
R8244:Lrp1b UTSW 2 41506782 missense
R8370:Lrp1b UTSW 2 40998105 missense
R8395:Lrp1b UTSW 2 40657399 missense
R8398:Lrp1b UTSW 2 40701807 missense
R8421:Lrp1b UTSW 2 40725423 missense
R8426:Lrp1b UTSW 2 41498306 missense
R8443:Lrp1b UTSW 2 41375855 nonsense probably null
R8444:Lrp1b UTSW 2 40870260 missense
R8486:Lrp1b UTSW 2 41728690 missense probably damaging 1.00
R8500:Lrp1b UTSW 2 41506779 missense probably benign 0.12
R8507:Lrp1b UTSW 2 41408375 missense
R8552:Lrp1b UTSW 2 41408981 missense probably benign 0.00
R8554:Lrp1b UTSW 2 41344483 missense probably benign 0.28
R8669:Lrp1b UTSW 2 41282035 critical splice donor site probably null
R8699:Lrp1b UTSW 2 41282195 missense
R8796:Lrp1b UTSW 2 40903414 missense
R8815:Lrp1b UTSW 2 40665159 missense
R8842:Lrp1b UTSW 2 41268405 missense
R8858:Lrp1b UTSW 2 41670815 intron probably benign
R8864:Lrp1b UTSW 2 41112706 missense
R8918:Lrp1b UTSW 2 40725881 missense
R8920:Lrp1b UTSW 2 42323598 missense
R8963:Lrp1b UTSW 2 40998184 missense probably benign 0.28
R8971:Lrp1b UTSW 2 41435628 missense
R9007:Lrp1b UTSW 2 40697552 missense
R9042:Lrp1b UTSW 2 41502017 missense
R9053:Lrp1b UTSW 2 40858489 missense
R9063:Lrp1b UTSW 2 41341826 missense
R9072:Lrp1b UTSW 2 40725445 nonsense probably null
R9105:Lrp1b UTSW 2 41506791 missense
R9131:Lrp1b UTSW 2 40699578 nonsense probably null
R9226:Lrp1b UTSW 2 41511448 missense
R9245:Lrp1b UTSW 2 40598444 missense
R9275:Lrp1b UTSW 2 40597064 missense
R9278:Lrp1b UTSW 2 40597064 missense
R9303:Lrp1b UTSW 2 41728562 missense
R9305:Lrp1b UTSW 2 41728562 missense
R9306:Lrp1b UTSW 2 40628750 missense possibly damaging 0.66
R9320:Lrp1b UTSW 2 41445099 critical splice donor site probably null
R9330:Lrp1b UTSW 2 41122981 missense
R9352:Lrp1b UTSW 2 40858426 missense
R9386:Lrp1b UTSW 2 41123628 missense
R9397:Lrp1b UTSW 2 40750910 missense
R9444:Lrp1b UTSW 2 41123718 missense
R9452:Lrp1b UTSW 2 41960714 nonsense probably null
R9474:Lrp1b UTSW 2 40601587 missense probably damaging 1.00
RF018:Lrp1b UTSW 2 41110907 missense
RF020:Lrp1b UTSW 2 41770846 missense
V1662:Lrp1b UTSW 2 41122932 missense probably damaging 0.99
X0028:Lrp1b UTSW 2 41471145 missense probably damaging 1.00
X0064:Lrp1b UTSW 2 41502043 missense probably damaging 1.00
Z1176:Lrp1b UTSW 2 40677506 missense
Z1176:Lrp1b UTSW 2 40697582 missense
Z1176:Lrp1b UTSW 2 40922383 missense
Z1176:Lrp1b UTSW 2 41728710 missense
Z1177:Lrp1b UTSW 2 40637749 missense
Z1177:Lrp1b UTSW 2 41188848 missense
Z1188:Lrp1b UTSW 2 40750934 missense
Predicted Primers PCR Primer
(F):5'- GGTAAGCACTCCAGTCATTTTATC -3'
(R):5'- TGCTGTGCTATGCATTGACG -3'

Sequencing Primer
(F):5'- GCACTCCAGTCATTTTATCCTTTAAG -3'
(R):5'- CTATGCATTGACGTTGTAGTTAGACC -3'
Posted On 2021-03-08