Incidental Mutation 'Z1188:Ep400'
ID665750
Institutional Source Beutler Lab
Gene Symbol Ep400
Ensembl Gene ENSMUSG00000029505
Gene NameE1A binding protein p400
SynonymsmDomino, 1700020J09Rik, p400
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #Z1188 ()
Quality Score201.009
Status Not validated
Chromosome5
Chromosomal Location110664373-110770717 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 110755683 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Threonine at position 350 (K350T)
Ref Sequence ENSEMBL: ENSMUSP00000049038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041558] [ENSMUST00000112433] [ENSMUST00000112435] [ENSMUST00000112436] [ENSMUST00000146458]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000041558
AA Change: K350T
SMART Domains Protein: ENSMUSP00000049038
Gene: ENSMUSG00000029505
AA Change: K350T

DomainStartEndE-ValueType
Pfam:EP400_N 1 461 1.6e-232 PFAM
low complexity region 519 532 N/A INTRINSIC
low complexity region 550 561 N/A INTRINSIC
low complexity region 598 620 N/A INTRINSIC
low complexity region 631 645 N/A INTRINSIC
low complexity region 658 686 N/A INTRINSIC
HSA 762 833 1.31e-31 SMART
low complexity region 908 925 N/A INTRINSIC
DEXDc 1049 1238 2.76e-15 SMART
Blast:DEXDc 1276 1317 2e-15 BLAST
low complexity region 1407 1417 N/A INTRINSIC
HELICc 1807 1893 1.17e-4 SMART
low complexity region 2006 2019 N/A INTRINSIC
low complexity region 2080 2100 N/A INTRINSIC
low complexity region 2214 2223 N/A INTRINSIC
SANT 2243 2310 3.57e-1 SMART
low complexity region 2402 2489 N/A INTRINSIC
low complexity region 2596 2608 N/A INTRINSIC
low complexity region 2644 2679 N/A INTRINSIC
low complexity region 2694 2738 N/A INTRINSIC
low complexity region 2769 2806 N/A INTRINSIC
low complexity region 2846 2883 N/A INTRINSIC
low complexity region 2933 2947 N/A INTRINSIC
low complexity region 2974 2986 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112433
AA Change: K350T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108052
Gene: ENSMUSG00000029505
AA Change: K350T

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
low complexity region 121 145 N/A INTRINSIC
low complexity region 262 287 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 313 329 N/A INTRINSIC
coiled coil region 418 447 N/A INTRINSIC
low complexity region 471 485 N/A INTRINSIC
low complexity region 556 569 N/A INTRINSIC
low complexity region 587 598 N/A INTRINSIC
low complexity region 635 657 N/A INTRINSIC
low complexity region 666 677 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000112435
AA Change: K350T
SMART Domains Protein: ENSMUSP00000108054
Gene: ENSMUSG00000029505
AA Change: K350T

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
low complexity region 121 145 N/A INTRINSIC
low complexity region 262 287 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 313 329 N/A INTRINSIC
coiled coil region 418 447 N/A INTRINSIC
low complexity region 471 485 N/A INTRINSIC
low complexity region 556 569 N/A INTRINSIC
low complexity region 587 598 N/A INTRINSIC
low complexity region 635 657 N/A INTRINSIC
low complexity region 668 682 N/A INTRINSIC
low complexity region 695 723 N/A INTRINSIC
HSA 799 870 1.31e-31 SMART
low complexity region 945 962 N/A INTRINSIC
DEXDc 1086 1275 2.76e-15 SMART
Blast:DEXDc 1313 1354 2e-15 BLAST
low complexity region 1444 1454 N/A INTRINSIC
internal_repeat_1 1556 1646 6.82e-5 PROSPERO
low complexity region 1887 1900 N/A INTRINSIC
low complexity region 1961 1981 N/A INTRINSIC
low complexity region 2095 2104 N/A INTRINSIC
SANT 2124 2191 3.57e-1 SMART
low complexity region 2283 2370 N/A INTRINSIC
internal_repeat_1 2371 2463 6.82e-5 PROSPERO
low complexity region 2477 2489 N/A INTRINSIC
low complexity region 2525 2560 N/A INTRINSIC
low complexity region 2575 2619 N/A INTRINSIC
low complexity region 2645 2659 N/A INTRINSIC
low complexity region 2660 2680 N/A INTRINSIC
low complexity region 2720 2757 N/A INTRINSIC
low complexity region 2807 2821 N/A INTRINSIC
low complexity region 2848 2860 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000112436
AA Change: K350T
SMART Domains Protein: ENSMUSP00000108055
Gene: ENSMUSG00000029505
AA Change: K350T

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
low complexity region 121 145 N/A INTRINSIC
low complexity region 262 287 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 313 329 N/A INTRINSIC
coiled coil region 418 449 N/A INTRINSIC
low complexity region 472 482 N/A INTRINSIC
low complexity region 483 496 N/A INTRINSIC
low complexity region 514 525 N/A INTRINSIC
low complexity region 562 584 N/A INTRINSIC
low complexity region 595 609 N/A INTRINSIC
low complexity region 622 650 N/A INTRINSIC
HSA 726 797 1.31e-31 SMART
low complexity region 872 889 N/A INTRINSIC
DEXDc 1013 1202 2.76e-15 SMART
Blast:DEXDc 1240 1281 2e-15 BLAST
low complexity region 1371 1381 N/A INTRINSIC
internal_repeat_1 1483 1573 6.76e-5 PROSPERO
HELICc 1771 1857 1.17e-4 SMART
low complexity region 1970 1983 N/A INTRINSIC
low complexity region 2044 2064 N/A INTRINSIC
low complexity region 2178 2187 N/A INTRINSIC
SANT 2207 2274 3.57e-1 SMART
low complexity region 2366 2453 N/A INTRINSIC
internal_repeat_1 2454 2546 6.76e-5 PROSPERO
low complexity region 2560 2572 N/A INTRINSIC
low complexity region 2608 2643 N/A INTRINSIC
low complexity region 2658 2702 N/A INTRINSIC
low complexity region 2733 2770 N/A INTRINSIC
low complexity region 2810 2847 N/A INTRINSIC
low complexity region 2897 2911 N/A INTRINSIC
low complexity region 2938 2950 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000146458
AA Change: K350T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138369
Gene: ENSMUSG00000029505
AA Change: K350T

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
low complexity region 121 145 N/A INTRINSIC
low complexity region 262 287 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 313 329 N/A INTRINSIC
coiled coil region 418 449 N/A INTRINSIC
low complexity region 519 532 N/A INTRINSIC
low complexity region 550 561 N/A INTRINSIC
low complexity region 598 620 N/A INTRINSIC
low complexity region 629 640 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.3%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele die at E11.5 and display severe defects in yolk sac erythropoiesis, anemia, and a slight deformity of the neural tube. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 415 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700086D15Rik T A 11: 65,152,968 Q89L unknown Het
1700086D15Rik A C 11: 65,152,983 V84G unknown Het
1700086D15Rik A G 11: 65,153,254 F38S unknown Het
1700086D15Rik A G 11: 65,153,288 W27R unknown Het
1700086D15Rik A G 11: 65,153,302 L22P unknown Het
1810065E05Rik C T 11: 58,422,201 L27F probably benign Het
1810065E05Rik C T 11: 58,422,234 L38F possibly damaging Het
1810065E05Rik C T 11: 58,425,799 L202F probably benign Het
2210407C18Rik G A 11: 58,608,509 P161L probably benign Het
2210407C18Rik A G 11: 58,612,561 L47P probably benign Het
2210407C18Rik T G 11: 58,612,571 S44R probably benign Het
2810021J22Rik C T 11: 58,880,535 A281V probably benign Het
4930438A08Rik A G 11: 58,294,018 T521A unknown Het
4933427D14Rik G A 11: 72,176,709 T585I possibly damaging Het
4933427D14Rik G T 11: 72,189,616 P408H probably damaging Het
4933427D14Rik AAAAGTAA AAA 11: 72,195,712 probably null Het
4933427D14Rik A G 11: 72,195,743 C281R possibly damaging Het
4933427D14Rik T G 11: 72,195,754 K277T probably damaging Het
4933427D14Rik T TCCCCAGC 11: 72,195,764 probably null Het
4933427D14Rik G A 11: 72,198,482 P192L probably benign Het
4933427D14Rik C A 11: 72,198,534 A175S probably benign Het
4933427D14Rik T G 11: 72,198,924 S45R probably damaging Het
Ablim2 G A 5: 35,837,023 D326N probably damaging Het
Akap10 T A 11: 61,915,270 S211C probably benign Het
Alox8 C T 11: 69,186,047 R536Q probably benign Het
Alox8 A G 11: 69,197,496 V76A probably benign Het
Aloxe3 A G 11: 69,128,675 Q138R probably benign Het
Aloxe3 C T 11: 69,148,603 A667V probably benign Het
Aspa G T 11: 73,322,187 L110I probably benign Het
Aurkb C T 11: 69,047,866 R44W probably damaging Het
Aurkb T C 11: 69,047,870 F45S probably benign Het
B230118H07Rik T C 2: 101,610,605 K18E probably benign Het
B9d1 A T 11: 61,505,203 probably benign Het
Baz2b T G 2: 59,977,405 N170T probably benign Het
Borcs6 G A 11: 69,060,627 R277Q possibly damaging Het
Btnl10 T C 11: 58,919,312 V93A probably benign Het
Btnl10 AAAGA AAAGAAGA 11: 58,923,927 probably benign Het
Btnl10 C T 11: 58,926,824 T250I unknown Het
Cacna1a A C 8: 84,515,054 S213R probably damaging Het
Ccdc42 C T 11: 68,587,191 probably benign Het
Ccdc92b A G 11: 74,630,054 M61V possibly damaging Het
Chd3 C A 11: 69,348,445 E1753D probably benign Het
Chd3 A G 11: 69,361,451 W42R probably benign Het
Clec3a G A 8: 114,418,119 V12M possibly damaging Het
Clec4b1 A G 6: 123,050,046 probably benign Het
Cluh CGAGCCTGAGCCTGAGCC CGAGCCTGAGCCTGAGCCTGAGCC 11: 74,669,517 probably benign Het
Cntnap5a G A 1: 116,518,205 V1103M possibly damaging Het
Cntrob C T 11: 69,305,578 R677H probably benign Het
Cntrob G A 11: 69,308,056 P622L probably benign Het
Cyb5d1 A G 11: 69,395,202 L31P probably benign Het
Cyb5d1 C A 11: 69,395,272 A8S probably benign Het
Dmxl1 T G 18: 49,868,003 V830G probably damaging Het
Dnah9 A C 11: 66,085,174 S1350A probably benign Het
Dnah9 G A 11: 66,147,381 H110Y probably benign Het
Elac2 T C 11: 64,979,189 S27P probably benign Het
Epha6 C T 16: 59,654,090 R1108Q probably damaging Het
Epn2 C A 11: 61,579,634 probably benign Het
Fam114a2 A G 11: 57,484,032 S494P probably benign Het
Fam114a2 G A 11: 57,490,114 A438V probably benign Het
Fam114a2 C T 11: 57,499,755 V318I probably benign Het
Fam114a2 T C 11: 57,499,797 N304D probably benign Het
Fam114a2 C T 11: 57,514,234 G14E probably benign Het
Fam83g G A 11: 61,703,194 R518Q probably benign Het
Fat2 TGTACCTCACCCCAGTACCT TGTACCT 11: 55,308,970 probably null Het
Fat2 T G 11: 55,309,799 K816N probably benign Het
Fbxw10 G C 11: 62,847,292 R4T probably benign Het
Fbxw10 G A 11: 62,876,845 V836I probably benign Het
Fmnl2 A G 2: 53,114,871 E659G unknown Het
Foxo6 C T 4: 120,287,135 G40R possibly damaging Het
Fthl17b C A X: 8,962,574 A86S probably benign Het
Galnt10 G A 11: 57,765,688 V233I probably benign Het
Gemin5 C G 11: 58,122,289 S1446T probably benign Het
Gemin5 T C 11: 58,125,218 S1321G probably benign Het
Gemin5 T C 11: 58,130,071 M1097V probably benign Het
Gemin5 C G 11: 58,139,510 A830P probably benign Het
Gemin5 C G 11: 58,139,575 C808S probably benign Het
Gemin5 C G 11: 58,146,519 E623D probably benign Het
Ggnbp2 C T 11: 84,836,652 R481Q probably benign Het
Gjc2 T C 11: 59,176,433 S408G unknown Het
Gjc2 A G 11: 59,176,492 V388A unknown Het
Gjc2 ACCCTCCCT ACCCTCCCTCCCT 11: 59,182,735 probably benign Het
Glod4 C A 11: 76,242,993 probably null Het
Glod4 A G 11: 76,243,010 V6A probably benign Het
Glod4 T C 11: 76,243,604 K14R probably benign Het
Glod4 T C 11: 76,243,605 K14E probably benign Het
Glp2r C A 11: 67,709,568 R485L probably damaging Het
Glp2r C A 11: 67,709,644 V460F probably benign Het
Glp2r C G 11: 67,709,646 G459A probably benign Het
Glp2r C T 11: 67,740,167 V295I probably benign Het
Glp2r A G 11: 67,741,052 V283A probably benign Het
Glp2r T C 11: 67,741,059 I281V probably benign Het
Glp2r T C 11: 67,742,303 T235A probably benign Het
Glp2r A G 11: 67,744,947 V189A probably benign Het
Glp2r C A 11: 67,770,836 A13S probably benign Het
Gm12253 G C 11: 58,434,541 S13T possibly damaging Het
Gm12253 A G 11: 58,434,832 E43G probably benign Het
Gm12253 A C 11: 58,434,860 E52D probably benign Het
Gm12253 A C 11: 58,435,411 E84A probably benign Het
Gm12253 G A 11: 58,435,483 S108N probably benign Het
Gm12253 G A 11: 58,441,009 A215T possibly damaging Het
Gm12258 T G 11: 58,858,300 S100R Het
Gm12258 C T 11: 58,858,436 R146W Het
Gm12258 G A 11: 58,858,938 R313H unknown Het
Gm12258 G A 11: 58,858,950 G317E unknown Het
Gm12258 A T 11: 58,859,007 E336V unknown Het
Gm12258 A G 11: 58,859,187 probably benign Het
Gm12258 T A 11: 58,859,188 probably benign Het
Gm12258 G C 11: 58,859,864 G622R unknown Het
Gm13272 G C 4: 88,780,333 V162L probably damaging Het
Gps2 C T 11: 69,916,304 A60V probably benign Het
Gucy2e C A 11: 69,223,605 A1033S probably benign Het
Gucy2e C G 11: 69,236,603 G15R unknown Het
Guk1 G A 11: 59,191,921 probably benign Het
Haspin T C 11: 73,137,348 Q305R probably benign Het
Haspin A G 11: 73,137,951 L104P probably benign Het
Hes7 T C 11: 69,122,956 S214P probably benign Het
Hic1 G A 11: 75,167,526 T179M probably damaging Het
Hydin T G 8: 110,415,787 I766S probably benign Het
Iba57 CAGA CAGAGA 11: 59,161,503 probably null Het
Iba57 T C 11: 59,161,555 T87A unknown Het
Iba57 T C 11: 59,161,558 T86A unknown Het
Iba57 C G 11: 59,163,039 G36R unknown Het
Ighv5-8 TATATATATATATATATA TATATATATATATATATATA 12: 113,654,949 probably null Het
Igtp T G 11: 58,206,343 D113E probably damaging Het
Igtp C G 11: 58,206,965 L321V possibly damaging Het
Igtp C G 11: 58,207,118 L372V probably benign Het
Irgm2 T A 11: 58,219,513 V10D probably benign Het
Irgm2 A G 11: 58,219,563 N27D probably benign Het
Irgm2 T C 11: 58,219,912 I143T probably benign Het
Irgm2 T C 11: 58,219,954 L157S probably benign Het
Irgm2 G A 11: 58,220,007 V175I probably benign Het
Irgm2 G A 11: 58,220,098 S205N probably benign Het
Irgm2 A C 11: 58,220,125 H214P probably benign Het
Irgm2 G T 11: 58,220,412 A310S possibly damaging Het
Irgm2 C G 11: 58,220,563 T360S probably benign Het
Itgae T A 11: 73,103,887 L22M possibly damaging Het
Itgae A T 11: 73,103,960 Q46L probably damaging Het
Itgae A G 11: 73,115,640 H378R probably benign Het
Itgae G A 11: 73,118,087 V465I probably benign Het
Itgae A T 11: 73,121,931 K696N probably benign Het
Itgae G T 11: 73,121,957 G705V probably benign Het
Itgae C G 11: 73,134,127 S1028W probably benign Het
Kif1c C T 11: 70,724,114 P578L probably benign Het
Kmt2d T C 15: 98,851,744 N2656D unknown Het
Larp1 G A 11: 58,042,340 V257I probably benign Het
Llgl1 ACCCCAGCCCTTCTGATTACTGCCCTCCCCAGC ACCCCAGC 11: 60,713,097 probably null Het
Lrp1b A T 2: 40,750,934 N3499K Het
Lypd8 T C 11: 58,382,775 Y27H probably benign Het
Lypd8 C A 11: 58,384,649 A70E possibly damaging Het
Lypd8 G A 11: 58,384,663 E75K probably benign Het
Lypd8 CAATCACCAACA CAATCACCAACAGTTCCCTCGCCTCTGTTACCCCACAAATCACCAACA 11: 58,390,233 probably benign Het
Mapk7 CGCTGGTGCTGG CGCTGGTGCTGGTGCTGG 11: 61,490,212 probably benign Het
Mapk7 TGGGGCAGGGGCAGGGGCAGG TGGCGCTGGGGCAGGGGCAGGGGCAGGGGCAGG 11: 61,490,227 probably benign Het
Mapk7 CAGG CAGGGGAAGG 11: 61,490,244 probably benign Het
Mfap3 A T 11: 57,528,040 I9F possibly damaging Het
Mfap3 G A 11: 57,528,076 G21S probably benign Het
Mrm3 G A 11: 76,244,077 R102K probably benign Het
Mrm3 C T 11: 76,247,395 P203L probably benign Het
Mroh2a G T 1: 88,235,216 Q360H probably benign Het
Mrpl22 G A 11: 58,171,695 A4T unknown Het
Mrpl55 A G 11: 59,204,173 probably null Het
Mrpl55 A T 11: 59,204,589 L26F probably benign Het
Myh1 A C 11: 67,204,446 T211P probably benign Het
Myh2 T C 11: 67,188,813 I1032T probably benign Het
Myh8 A C 11: 67,297,486 N991T probably benign Het
Myocd A G 11: 65,184,592 S697P probably benign Het
Nlgn2 A G 11: 69,828,394 V210A possibly damaging Het
Nlrp1a T C 11: 71,092,243 K1299R probably benign Het
Nlrp1a C T 11: 71,097,251 R1131Q probably damaging Het
Nlrp1a T C 11: 71,099,616 I1038V probably benign Het
Nlrp1a T C 11: 71,124,088 E112G probably benign Het
Nlrp1a C G 11: 71,142,529 probably null Het
Nlrp1b C A 11: 71,181,708 M436I probably benign Het
Nlrp1b A C 11: 71,181,713 S435A probably benign Het
Nlrp1b A G 11: 71,181,799 I406T probably benign Het
Nlrp1b G C 11: 71,182,309 T236R probably benign Het
Nlrp1b A G 11: 71,182,322 Y232H probably benign Het
Nlrp1b A T 11: 71,182,440 D192E probably benign Het
Nlrp1b T C 11: 71,182,454 T188A probably benign Het
Nlrp1b C G 11: 71,182,544 E158Q probably benign Het
Nlrp1b A T 11: 71,182,552 M155K probably benign Het
Nlrp1b T A 11: 71,182,570 Q149L probably benign Het
Nlrp1b T C 11: 71,182,677 I113M probably benign Het
Nmur2 T C 11: 56,040,278 I202M probably benign Het
Obscn G A 11: 59,000,889 A6939V probably benign Het
Obscn C G 11: 59,009,193 G938A probably benign Het
Obscn G C 11: 59,013,188 T7320S probably benign Het
Obscn C T 11: 59,031,108 R5954Q probably damaging Het
Obscn G C 11: 59,039,150 P5080A probably benign Het
Obscn T A 11: 59,039,164 Q5075L probably damaging Het
Obscn T C 11: 59,041,775 I4869V probably benign Het
Obscn T C 11: 59,042,950 T5363A probably benign Het
Obscn G A 11: 59,043,027 A5337V probably benign Het
Obscn G A 11: 59,043,052 R5329C probably benign Het
Obscn C T 11: 59,049,480 D5354N Het
Obscn C A 11: 59,049,788 R4593S possibly damaging Het
Obscn T C 11: 59,049,797 T5307A Het
Obscn G A 11: 59,051,557 T4372M probably benign Het
Obscn T C 11: 59,052,613 M4237V probably benign Het
Obscn C T 11: 59,053,768 R4700Q probably benign Het
Obscn T C 11: 59,053,825 K4681R probably benign Het
Obscn T C 11: 59,054,218 E4658G probably benign Het
Obscn C T 11: 59,054,350 R4614Q probably benign Het
Obscn T C 11: 59,054,834 T4184A probably benign Het
Obscn C T 11: 59,055,457 R4474H probably damaging Het
Obscn T C 11: 59,055,505 D4458G probably damaging Het
Obscn C T 11: 59,055,514 R4455K probably benign Het
Obscn G T 11: 59,056,110 A4066E possibly damaging Het
Obscn A G 11: 59,056,769 M4478T Het
Obscn C A 11: 59,060,997 G3977W probably damaging Het
Obscn C T 11: 59,061,562 G3894R probably benign Het
Obscn C T 11: 59,061,582 R3887K probably benign Het
Obscn G C 11: 59,062,133 P4115A probably benign Het
Obscn C T 11: 59,062,139 D4113N probably damaging Het
Obscn CCACACACACACAC CCACACACACAC 11: 59,063,453 probably null Het
Obscn T C 11: 59,063,474 T4037A Het
Obscn T C 11: 59,063,576 K3727E probably damaging Het
Obscn G A 11: 59,067,147 R3576C probably benign Het
Obscn C T 11: 59,067,829 V3433I probably benign Het
Obscn C A 11: 59,069,931 A3185S probably benign Het
Obscn C T 11: 59,076,508 V2792I possibly damaging Het
Obscn G A 11: 59,079,158 R53C probably damaging Het
Obscn C G 11: 59,079,896 V2328L probably benign Het
Obscn C A 11: 59,081,872 G2116V possibly damaging Het
Obscn C T 11: 59,086,679 R1865H probably benign Het
Obscn T C 11: 59,086,701 R1858G probably benign Het
Obscn A G 11: 59,086,739 V1845A probably benign Het
Obscn T C 11: 59,090,747 H1815R probably benign Het
Obscn A G 11: 59,093,316 F1771S probably benign Het
Obscn C T 11: 59,093,413 V1739M possibly damaging Het
Obscn G T 11: 59,093,508 A1707D possibly damaging Het
Obscn C T 11: 59,093,509 A1707T probably benign Het
Obscn G A 11: 59,093,559 A1690V probably benign Het
Obscn C T 11: 59,099,909 A1613T possibly damaging Het
Obscn T C 11: 59,099,929 H1606R probably benign Het
Obscn C G 11: 59,103,341 A1572P probably damaging Het
Obscn T C 11: 59,103,514 H1514R probably benign Het
Obscn G A 11: 59,103,538 A1506V probably benign Het
Obscn T C 11: 59,112,554 E1306G probably benign Het
Obscn T C 11: 59,112,636 M1279V probably benign Het
Obscn T C 11: 59,122,737 M1095V probably benign Het
Obscn C T 11: 59,128,066 A949T probably benign Het
Obscn C T 11: 59,128,069 V973M probably damaging Het
Obscn T C 11: 59,129,687 M844V probably benign Het
Obscn G T 11: 59,129,837 L794M probably benign Het
Obscn C T 11: 59,130,623 R797H probably damaging Het
Obscn C T 11: 59,133,111 A578T possibly damaging Het
Obscn G A 11: 59,133,240 P535S probably damaging Het
Obscn C G 11: 59,133,246 A533P probably benign Het
Obscn T C 11: 59,135,679 I233V probably benign Het
Olfr224 G A 11: 58,566,562 A261V probably benign Het
Olfr224 A T 11: 58,566,695 S217T probably benign Het
Olfr224 C T 11: 58,567,094 V84I probably benign Het
Olfr311 G C 11: 58,841,081 probably benign Het
Olfr311 G T 11: 58,841,119 A2S probably benign Het
Olfr311 C T 11: 58,841,206 L31F probably benign Het
Olfr311 T C 11: 58,841,258 I48T probably benign Het
Olfr311 G A 11: 58,841,743 A210T probably benign Het
Olfr311 A G 11: 58,841,789 H225R probably benign Het
Olfr313 A G 11: 58,817,061 I18V probably benign Het
Olfr313 T C 11: 58,817,296 V96A probably benign Het
Olfr313 A C 11: 58,817,394 I129L probably benign Het
Olfr313 C G 11: 58,817,417 H136Q probably benign Het
Olfr313 T C 11: 58,817,682 C225R probably benign Het
Olfr313 C G 11: 58,817,818 P270R probably benign Het
Olfr314 A G 11: 58,786,947 T238A probably damaging Het
Olfr316 G A 11: 58,757,967 A101T probably benign Het
Olfr316 C T 11: 58,758,069 L135F probably benign Het
Olfr316 A G 11: 58,758,105 S147G probably benign Het
Olfr316 G A 11: 58,758,327 V221M probably damaging Het
Olfr316 A C,T 11: 58,758,342 I226L probably benign Het
Olfr316 A C 11: 58,758,360 K232Q probably benign Het
Olfr317 T G 11: 58,732,374 N264H probably benign Het
Olfr317 G A 11: 58,732,469 A232V probably benign Het
Olfr317 T C 11: 58,732,649 H172R probably benign Het
Olfr317 C A 11: 58,733,222 probably benign Het
Olfr318 G A 11: 58,721,096 probably benign Het
Olfr319 A C 11: 58,701,958 I86L probably benign Het
Olfr319 C T 11: 58,702,327 L209F possibly damaging Het
Olfr319 C A 11: 58,702,396 Q232K probably benign Het
Olfr320 G T 11: 58,683,932 D20Y probably benign Het
Olfr320 T C 11: 58,683,989 F39L probably benign Het
Olfr320 G A 11: 58,684,115 V81M probably benign Het
Olfr320 G A 11: 58,684,257 R128Q probably benign Het
Olfr320 C T 11: 58,684,463 H197Y probably benign Het
Olfr320 G A 11: 58,684,715 V281I probably benign Het
Olfr320 T C 11: 58,684,722 L283P probably benign Het
Olfr322 T G 11: 58,666,516 I319R probably benign Het
Olfr323 G A 11: 58,625,249 S79F probably benign Het
Olfr323 C G 11: 58,625,304 G61R probably benign Het
Olfr323 G A 11: 58,625,762 P95S probably benign Het
Olfr323 T G 11: 58,625,793 K84N probably benign Het
Olfr323 A C 11: 58,625,906 C46G possibly damaging Het
Olfr324 A C 11: 58,597,518 I35L probably benign Het
Olfr324 A G 11: 58,597,530 I39V probably benign Het
Olfr324 A G 11: 58,597,665 S84G possibly damaging Het
Olfr324 A G 11: 58,597,950 S179G probably benign Het
Olfr325 C T 11: 58,580,924 H27Y probably benign Het
Olfr325 T C 11: 58,580,931 V29A probably benign Het
Olfr325 G A 11: 58,581,002 V53I probably benign Het
Olfr325 T G 11: 58,581,296 L151V probably benign Het
Olfr325 G C 11: 58,581,657 S271T probably benign Het
Olfr328 T C 11: 58,551,561 K226R probably benign Het
Olfr328 C T 11: 58,551,975 S88N probably benign Het
Olfr328 C T 11: 58,552,114 A42T probably benign Het
Olfr329-ps G T 11: 58,543,446 S23Y probably benign Het
Olfr331 T C 11: 58,501,648 M309V probably benign Het
Olfr331 T C 11: 58,502,101 I158V probably benign Het
Olfr331 C A 11: 58,502,110 V155F probably benign Het
Olfr331 GGTGGATTGGTATGTGGAT GGTGGAT 11: 58,502,386 probably benign Het
Olfr331 C G 11: 58,502,461 V38L probably benign Het
Olfr331 C T 11: 58,502,570 M1I probably null Het
Olfr332 C A 11: 58,489,748 E336* probably null Het
Olfr332 C T 11: 58,490,297 A153T probably benign Het
Olfr332 T C 11: 58,490,488 Q89R probably benign Het
Ovca2 T C 11: 75,178,702 T32A probably benign Het
Pgbd5 G A 8: 124,380,216 R196C probably damaging Het
Pimreg TCACA TCA 11: 72,044,975 probably benign Het
Pimreg G A 11: 72,045,153 R154H probably damaging Het
Pitpnm3 T C 11: 72,064,129 K520E probably benign Het
Pitpnm3 C T 11: 72,120,143 R21Q probably benign Het
Prpsap2 A C 11: 61,756,252 V21G possibly damaging Het
Rabep1 C CT 11: 70,940,084 probably null Het
Rai1 A G 11: 60,187,563 N818D probably benign Het
Rap1gap2 C T 11: 74,596,895 E52K probably benign Het
Rc3h2 T C 2: 37,399,600 H400R possibly damaging Het
Rnf112 A G 11: 61,450,949 L343P unknown Het
Rnf167 C CACAGGGA 11: 70,650,820 probably null Het
Rpl26 A G 11: 68,903,243 Y78C probably benign Het
Rtn4rl1 C T 11: 75,266,037 P432S probably benign Het
Shisa6 GCCGCC GCCGCCTCCGCC 11: 66,525,693 probably benign Het
Slc10a2 G A 8: 5,105,063 L41F probably damaging Het
Slc11a2 A G 15: 100,408,099 probably null Het
Slc15a5 G T 6: 138,017,958 L122M Het
Slc2a4 GGCCG GG 11: 69,943,992 probably benign Het
Slc2a4 GCC G 11: 69,943,993 probably null Het
Slc6a4 G A 11: 77,010,556 G39E probably benign Het
Slc6a4 A G 11: 77,013,032 K152R probably benign Het
Smcr8 A G 11: 60,777,980 probably benign Het
Smcr8 T C 11: 60,779,106 V360A probably benign Het
Smcr8 C A 11: 60,779,873 R616S probably benign Het
Smg6 G T 11: 75,156,266 A1262S probably benign Het
Spns3 T C 11: 72,550,037 I58V probably benign Het
Spns3 G A 11: 72,550,091 P40S probably benign Het
Spns3 T C 11: 72,550,160 S17G probably benign Het
Srebf1 C T 11: 60,206,235 V256M probably benign Het
Tbc1d32 G T 10: 56,170,881 L564M probably damaging Het
Tekt1 T C 11: 72,359,771 Q33R probably benign Het
Timm22 T G 11: 76,407,117 V18G probably benign Het
Tmc3 T A 7: 83,612,478 L588H probably damaging Het
Tmem102 C G 11: 69,805,076 G53A possibly damaging Het
Tmem102 G C 11: 69,805,101 R45G probably benign Het
Tmem11 A G 11: 60,875,832 probably benign Het
Tom1l2 C T 11: 60,241,856 A414T probably benign Het
Top3a C T 11: 60,750,584 G425S probably benign Het
Trim16 C T 11: 62,820,602 A33V probably benign Het
Trim16 G C 11: 62,820,676 V58L probably benign Het
Trim16 TGAAGA TGAAGAAGA 11: 62,820,690 probably benign Het
Trim16 A AAGC 11: 62,820,695 probably benign Het
Trim16 G A 11: 62,836,817 E322K probably benign Het
Trim16 T C 11: 62,840,746 V481A probably benign Het
Trim16 C A 11: 62,840,849 D515E probably benign Het
Trim17 G A 11: 58,965,505 M129I probably benign Het
Trim17 A G 11: 58,970,446 N259S probably benign Het
Trim58 C A 11: 58,640,858 L131M possibly damaging Het
Trim58 A G 11: 58,651,660 N482S probably benign Het
Trpv1 C G 11: 73,240,601 P322A possibly damaging Het
Trpv1 C A 11: 73,254,291 D734E probably benign Het
Trpv3 C T 11: 73,269,687 A9V probably benign Het
Trpv3 G A 11: 73,278,977 A125T probably benign Het
Trpv3 A G 11: 73,283,676 T290A probably benign Het
Tvp23b A C 11: 62,881,943 N7H possibly damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Uqcrc2 A C 7: 120,640,293 K109N probably benign Het
Usp43 AGGGC AGGGCAGGGGATGAACCTCGGGC 11: 67,855,719 probably benign Het
Usp43 C T 11: 67,856,506 G792S probably benign Het
Vamp2 C T 11: 69,088,585 probably benign Het
Vamp2 G A 11: 69,090,063 G124R possibly damaging Het
Vat1l A C 8: 114,205,723 K3T probably damaging Het
Vmn2r120 A T 17: 57,522,436 V487E probably damaging Het
Xaf1 G A 11: 72,306,600 R134H probably benign Het
Xaf1 G C 11: 72,306,603 C135S probably damaging Het
Xaf1 C A 11: 72,306,608 L137I probably benign Het
Xaf1 A G 11: 72,308,650 E71G probably benign Het
Xaf1 T G 11: 72,308,966 C176W unknown Het
Xaf1 GGCT GGCTGGCCAGCT 11: 72,309,020 probably null Het
Xaf1 G C 11: 72,309,030 V198L unknown Het
Xaf1 T C 11: 72,309,055 L206S unknown Het
Zar1l C A 5: 150,507,193 R251I possibly damaging Het
Zfp286 G A 11: 62,784,956 T60M probably damaging Het
Zfp286 A G 11: 62,787,969 V44A probably benign Het
Zfp287 C T 11: 62,713,807 R758H probably benign Het
Zfp287 C G 11: 62,715,349 C244S probably benign Het
Zfp287 G A 11: 62,722,931 R225* probably null Het
Zfp39 G C 11: 58,890,045 Y630* probably null Het
Zfp39 A C 11: 58,890,047 Y630D probably benign Het
Zfp39 G C 11: 58,890,304 T544R possibly damaging Het
Zfp39 G C 11: 58,890,447 D496E probably benign Het
Zfp39 T C 11: 58,890,448 D496G possibly damaging Het
Zfp39 T C 11: 58,890,700 N412S possibly damaging Het
Zfp39 G T 11: 58,890,771 N388K probably benign Het
Zfp39 A G 11: 58,890,779 S386P probably benign Het
Zfp39 A C 11: 58,890,876 H353Q probably damaging Het
Zfp39 A C 11: 58,890,886 V350G probably benign Het
Zfp39 A G 11: 58,890,898 V346A probably benign Het
Zfp39 T A 11: 58,890,925 K337M probably benign Het
Zfp39 T A 11: 58,891,141 H265L probably damaging Het
Zfp39 A G 11: 58,891,297 I213T probably benign Het
Zfp39 T C 11: 58,891,316 K207E probably benign Het
Zfp39 G T 11: 58,900,581 S93R probably benign Het
Zfp39 T G 11: 58,900,583 S93R probably benign Het
Zfp672 G T 11: 58,329,626 T49K unknown Het
Zfp692 G T 11: 58,309,033 E149D probably benign Het
Zfp692 G A 11: 58,310,018 V242I probably benign Het
Zzef1 G A 11: 72,889,182 R1927H probably benign Het
Other mutations in Ep400
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Ep400 APN 5 110687841 missense unknown
IGL00585:Ep400 APN 5 110755905 missense possibly damaging 0.70
IGL00586:Ep400 APN 5 110739594 missense probably damaging 1.00
IGL00816:Ep400 APN 5 110735490 unclassified probably benign
IGL01066:Ep400 APN 5 110668199 splice site probably benign
IGL01302:Ep400 APN 5 110742048 missense probably benign 0.00
IGL01568:Ep400 APN 5 110719495 missense unknown
IGL01833:Ep400 APN 5 110680008 missense unknown
IGL02086:Ep400 APN 5 110676943 splice site probably benign
IGL02266:Ep400 APN 5 110695297 unclassified probably benign
IGL02288:Ep400 APN 5 110683836 splice site probably benign
IGL02301:Ep400 APN 5 110674960 missense probably damaging 1.00
IGL02377:Ep400 APN 5 110720825 missense unknown
IGL02382:Ep400 APN 5 110701728 missense unknown
IGL02419:Ep400 APN 5 110697376 splice site probably null
IGL02591:Ep400 APN 5 110733772 unclassified probably benign
IGL02981:Ep400 APN 5 110756103 missense possibly damaging 0.79
IGL02981:Ep400 APN 5 110691610 splice site probably benign
IGL03173:Ep400 APN 5 110708871 unclassified probably benign
IGL03244:Ep400 APN 5 110727563 missense unknown
IGL03333:Ep400 APN 5 110703566 missense unknown
santol UTSW 5 110701671 missense unknown
PIT4243001:Ep400 UTSW 5 110735580 missense unknown
PIT4260001:Ep400 UTSW 5 110693171 nonsense probably null
R0017:Ep400 UTSW 5 110673529 missense probably damaging 1.00
R0179:Ep400 UTSW 5 110668649 missense probably damaging 0.99
R0243:Ep400 UTSW 5 110724407 splice site probably benign
R0366:Ep400 UTSW 5 110701671 missense unknown
R0508:Ep400 UTSW 5 110739508 missense probably benign 0.00
R0541:Ep400 UTSW 5 110705016 missense unknown
R0558:Ep400 UTSW 5 110685067 splice site probably benign
R0576:Ep400 UTSW 5 110711093 unclassified probably benign
R0595:Ep400 UTSW 5 110703542 missense unknown
R0671:Ep400 UTSW 5 110688196 missense unknown
R0763:Ep400 UTSW 5 110665837 missense probably damaging 1.00
R1078:Ep400 UTSW 5 110735522 unclassified probably benign
R1300:Ep400 UTSW 5 110673560 missense probably damaging 1.00
R1439:Ep400 UTSW 5 110685478 missense unknown
R1520:Ep400 UTSW 5 110691778 intron probably benign
R1529:Ep400 UTSW 5 110739445 missense probably benign 0.00
R1535:Ep400 UTSW 5 110708166 unclassified probably benign
R1560:Ep400 UTSW 5 110671106 splice site probably null
R1587:Ep400 UTSW 5 110726902 missense probably benign 0.23
R1596:Ep400 UTSW 5 110708861 unclassified probably benign
R1653:Ep400 UTSW 5 110693174 nonsense probably null
R1711:Ep400 UTSW 5 110693308 unclassified probably benign
R1774:Ep400 UTSW 5 110685491 missense unknown
R1836:Ep400 UTSW 5 110705054 missense unknown
R1905:Ep400 UTSW 5 110670948 missense probably damaging 1.00
R1917:Ep400 UTSW 5 110703575 missense unknown
R2064:Ep400 UTSW 5 110735404 unclassified probably benign
R2122:Ep400 UTSW 5 110708850 unclassified probably benign
R2144:Ep400 UTSW 5 110703518 missense unknown
R2215:Ep400 UTSW 5 110693555 unclassified probably benign
R2252:Ep400 UTSW 5 110719091 missense unknown
R2253:Ep400 UTSW 5 110719091 missense unknown
R2483:Ep400 UTSW 5 110719236 missense unknown
R2504:Ep400 UTSW 5 110668645 missense probably damaging 1.00
R2512:Ep400 UTSW 5 110708915 unclassified probably benign
R2842:Ep400 UTSW 5 110698815 nonsense probably null
R2920:Ep400 UTSW 5 110755914 missense probably damaging 1.00
R3082:Ep400 UTSW 5 110693230 unclassified probably benign
R3151:Ep400 UTSW 5 110703569 missense unknown
R3552:Ep400 UTSW 5 110729287 missense unknown
R3623:Ep400 UTSW 5 110719236 missense unknown
R3779:Ep400 UTSW 5 110691649 missense unknown
R3923:Ep400 UTSW 5 110756523 missense possibly damaging 0.55
R4062:Ep400 UTSW 5 110741981 missense probably benign 0.10
R4508:Ep400 UTSW 5 110703615 missense unknown
R4584:Ep400 UTSW 5 110733897 unclassified probably benign
R4585:Ep400 UTSW 5 110753859 missense probably damaging 1.00
R4586:Ep400 UTSW 5 110753859 missense probably damaging 1.00
R4807:Ep400 UTSW 5 110695578 splice site probably null
R4921:Ep400 UTSW 5 110665810 missense probably damaging 1.00
R4976:Ep400 UTSW 5 110698812 missense unknown
R4976:Ep400 UTSW 5 110720756 missense unknown
R5075:Ep400 UTSW 5 110685485 missense unknown
R5120:Ep400 UTSW 5 110756358 missense probably damaging 1.00
R5122:Ep400 UTSW 5 110668170 missense probably damaging 1.00
R5223:Ep400 UTSW 5 110668630 missense probably damaging 1.00
R5284:Ep400 UTSW 5 110668124 missense probably damaging 1.00
R5388:Ep400 UTSW 5 110701728 missense unknown
R5401:Ep400 UTSW 5 110683171 missense unknown
R5431:Ep400 UTSW 5 110676554 missense unknown
R5461:Ep400 UTSW 5 110676684 nonsense probably null
R5568:Ep400 UTSW 5 110756205 missense probably damaging 1.00
R5650:Ep400 UTSW 5 110695952 critical splice donor site probably null
R5778:Ep400 UTSW 5 110719584 missense unknown
R5806:Ep400 UTSW 5 110755554 nonsense probably null
R5814:Ep400 UTSW 5 110695578 splice site probably null
R5830:Ep400 UTSW 5 110683996 missense unknown
R5882:Ep400 UTSW 5 110755587 missense probably benign 0.00
R5931:Ep400 UTSW 5 110735520 unclassified probably benign
R5945:Ep400 UTSW 5 110682866 missense unknown
R5966:Ep400 UTSW 5 110676900 missense unknown
R5973:Ep400 UTSW 5 110729831 missense unknown
R5980:Ep400 UTSW 5 110733729 unclassified probably benign
R6000:Ep400 UTSW 5 110683201 missense unknown
R6006:Ep400 UTSW 5 110704959 missense unknown
R6053:Ep400 UTSW 5 110755795 missense probably benign 0.22
R6145:Ep400 UTSW 5 110756703 missense possibly damaging 0.95
R6154:Ep400 UTSW 5 110755933 missense probably damaging 0.97
R6169:Ep400 UTSW 5 110741997 missense possibly damaging 0.83
R6228:Ep400 UTSW 5 110670942 missense probably damaging 1.00
R6295:Ep400 UTSW 5 110753809 missense probably benign 0.00
R6486:Ep400 UTSW 5 110697218 unclassified probably benign
R6504:Ep400 UTSW 5 110708837 unclassified probably benign
R6607:Ep400 UTSW 5 110683314 missense unknown
R6657:Ep400 UTSW 5 110693545 unclassified probably benign
R6660:Ep400 UTSW 5 110719447 nonsense probably null
R6741:Ep400 UTSW 5 110676895 missense unknown
R6933:Ep400 UTSW 5 110665862 missense probably damaging 1.00
R6937:Ep400 UTSW 5 110711152 unclassified probably benign
R7069:Ep400 UTSW 5 110668124 missense probably damaging 1.00
R7103:Ep400 UTSW 5 110733785 missense unknown
R7156:Ep400 UTSW 5 110685363 missense unknown
R7272:Ep400 UTSW 5 110755645 nonsense probably null
R7365:Ep400 UTSW 5 110719614 missense unknown
R7581:Ep400 UTSW 5 110756025 missense unknown
R7684:Ep400 UTSW 5 110697352 missense unknown
R7699:Ep400 UTSW 5 110696032 missense unknown
R7700:Ep400 UTSW 5 110696032 missense unknown
R7856:Ep400 UTSW 5 110666584 missense probably damaging 0.99
R7954:Ep400 UTSW 5 110668733 missense possibly damaging 0.46
R8098:Ep400 UTSW 5 110693251 missense unknown
R8108:Ep400 UTSW 5 110687883 missense unknown
R8260:Ep400 UTSW 5 110755612 nonsense probably null
R8293:Ep400 UTSW 5 110708892 missense unknown
R8314:Ep400 UTSW 5 110755753 missense unknown
R8351:Ep400 UTSW 5 110739334 missense probably damaging 1.00
R8424:Ep400 UTSW 5 110693278 missense unknown
R8459:Ep400 UTSW 5 110708891 missense unknown
R8529:Ep400 UTSW 5 110719236 missense unknown
R8688:Ep400 UTSW 5 110720819 missense unknown
R8744:Ep400 UTSW 5 110742059 missense unknown
R8923:Ep400 UTSW 5 110683998 missense unknown
R9005:Ep400 UTSW 5 110711093 missense unknown
R9087:Ep400 UTSW 5 110667564 nonsense probably null
X0012:Ep400 UTSW 5 110673196 small deletion probably benign
X0021:Ep400 UTSW 5 110682864 missense unknown
Z1176:Ep400 UTSW 5 110756635 missense unknown
Z1177:Ep400 UTSW 5 110683364 missense unknown
Z1177:Ep400 UTSW 5 110733743 missense unknown
Predicted Primers PCR Primer
(F):5'- AGATACGCTTGTAAAGGGGC -3'
(R):5'- GGACAGCCAATGAACCGATC -3'

Sequencing Primer
(F):5'- GGGCATAGTGCTTCTTTTTAAAAGCC -3'
(R):5'- CCAATGAACCGATCTCTGGGATTTG -3'
Posted On2021-03-08