Incidental Mutation 'Z1188:Hydin'
ID 665758
Institutional Source Beutler Lab
Gene Symbol Hydin
Ensembl Gene ENSMUSG00000059854
Gene Name HYDIN, axonemal central pair apparatus protein
Synonyms 1700034M11Rik, 4930545D19Rik, hy3, hyrh, hy-3
Accession Numbers
Essential gene? Possibly essential (E-score: 0.744) question?
Stock # Z1188 ()
Quality Score 194.009
Status Not validated
Chromosome 8
Chromosomal Location 110993609-111336885 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 111142419 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Serine at position 766 (I766S)
Ref Sequence ENSEMBL: ENSMUSP00000046204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043141]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000043141
AA Change: I766S

PolyPhen 2 Score 0.399 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000046204
Gene: ENSMUSG00000059854
AA Change: I766S

DomainStartEndE-ValueType
Pfam:Motile_Sperm 246 325 5.6e-8 PFAM
Pfam:ASH 559 659 9.4e-17 PFAM
low complexity region 788 798 N/A INTRINSIC
Pfam:PapD-like 848 906 1.2e-6 PFAM
low complexity region 998 1024 N/A INTRINSIC
low complexity region 1279 1292 N/A INTRINSIC
internal_repeat_6 1317 1549 5.96e-5 PROSPERO
internal_repeat_5 1355 1502 3.23e-5 PROSPERO
low complexity region 1574 1590 N/A INTRINSIC
internal_repeat_4 1712 1940 5.14e-6 PROSPERO
coiled coil region 1947 1977 N/A INTRINSIC
low complexity region 2009 2020 N/A INTRINSIC
low complexity region 2034 2049 N/A INTRINSIC
SCOP:d1eq1a_ 2305 2403 3e-4 SMART
low complexity region 2404 2419 N/A INTRINSIC
coiled coil region 2543 2588 N/A INTRINSIC
low complexity region 2636 2656 N/A INTRINSIC
internal_repeat_7 2772 3008 8.1e-5 PROSPERO
low complexity region 3660 3670 N/A INTRINSIC
low complexity region 3919 3934 N/A INTRINSIC
internal_repeat_5 4046 4190 3.23e-5 PROSPERO
internal_repeat_2 4106 4251 6.03e-7 PROSPERO
internal_repeat_4 4317 4532 5.14e-6 PROSPERO
internal_repeat_3 4403 4689 2.05e-6 PROSPERO
internal_repeat_2 4549 4697 6.03e-7 PROSPERO
low complexity region 4951 4964 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.3%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may be involved in cilia motility. Mutations in this gene cause of autosomal recessive primary ciliary dyskinesia-5, a disorder characterized by the accumulation of cerebrospinal fluid within the ventricles of the brain. A duplicate copy of this gene has been found in humans on chromosome 1. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a mutation in this gene develop hydrocephaly after birth. Symptoms develop after 3-5 days. Affected animals usually die before 2 months of age. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(1) Gene trapped(3) Transgenic(1) Spontaneous(2)

Other mutations in this stock
Total: 415 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700086D15Rik A G 11: 65,044,114 (GRCm39) W27R unknown Het
1700086D15Rik A G 11: 65,044,080 (GRCm39) F38S unknown Het
1700086D15Rik A C 11: 65,043,809 (GRCm39) V84G unknown Het
1700086D15Rik T A 11: 65,043,794 (GRCm39) Q89L unknown Het
1700086D15Rik A G 11: 65,044,128 (GRCm39) L22P unknown Het
1810065E05Rik C T 11: 58,313,027 (GRCm39) L27F probably benign Het
1810065E05Rik C T 11: 58,316,625 (GRCm39) L202F probably benign Het
1810065E05Rik C T 11: 58,313,060 (GRCm39) L38F possibly damaging Het
2810021J22Rik C T 11: 58,771,361 (GRCm39) A281V probably benign Het
4930438A08Rik A G 11: 58,184,844 (GRCm39) T521A unknown Het
4933427D14Rik G A 11: 72,067,535 (GRCm39) T585I possibly damaging Het
4933427D14Rik T G 11: 72,089,750 (GRCm39) S45R probably damaging Het
4933427D14Rik C A 11: 72,089,360 (GRCm39) A175S probably benign Het
4933427D14Rik G A 11: 72,089,308 (GRCm39) P192L probably benign Het
4933427D14Rik T TCCCCAGC 11: 72,086,590 (GRCm39) probably null Het
4933427D14Rik T G 11: 72,086,580 (GRCm39) K277T probably damaging Het
4933427D14Rik A G 11: 72,086,569 (GRCm39) C281R possibly damaging Het
4933427D14Rik AAAAGTAA AAA 11: 72,086,538 (GRCm39) probably null Het
4933427D14Rik G T 11: 72,080,442 (GRCm39) P408H probably damaging Het
Ablim2 G A 5: 35,994,367 (GRCm39) D326N probably damaging Het
Akap10 T A 11: 61,806,096 (GRCm39) S211C probably benign Het
Alox8 C T 11: 69,076,873 (GRCm39) R536Q probably benign Het
Alox8 A G 11: 69,088,322 (GRCm39) V76A probably benign Het
Aloxe3 A G 11: 69,019,501 (GRCm39) Q138R probably benign Het
Aloxe3 C T 11: 69,039,429 (GRCm39) A667V probably benign Het
Aspa G T 11: 73,213,013 (GRCm39) L110I probably benign Het
Aurkb C T 11: 68,938,692 (GRCm39) R44W probably damaging Het
Aurkb T C 11: 68,938,696 (GRCm39) F45S probably benign Het
B9d1 A T 11: 61,396,029 (GRCm39) probably benign Het
Baz2b T G 2: 59,807,749 (GRCm39) N170T probably benign Het
Borcs6 G A 11: 68,951,453 (GRCm39) R277Q possibly damaging Het
Btnl10 T C 11: 58,810,138 (GRCm39) V93A probably benign Het
Btnl10 C T 11: 58,817,650 (GRCm39) T250I unknown Het
Btnl10 AAAGA AAAGAAGA 11: 58,814,753 (GRCm39) probably benign Het
Cacna1a A C 8: 85,241,683 (GRCm39) S213R probably damaging Het
Ccdc42 C T 11: 68,478,017 (GRCm39) probably benign Het
Ccdc92b A G 11: 74,520,880 (GRCm39) M61V possibly damaging Het
Chd3 A G 11: 69,252,277 (GRCm39) W42R probably benign Het
Chd3 C A 11: 69,239,271 (GRCm39) E1753D probably benign Het
Clec3a G A 8: 115,144,859 (GRCm39) V12M possibly damaging Het
Clec4b1 A G 6: 123,027,005 (GRCm39) probably benign Het
Cluh CGAGCCTGAGCCTGAGCC CGAGCCTGAGCCTGAGCCTGAGCC 11: 74,560,343 (GRCm39) probably benign Het
Cntnap5a G A 1: 116,445,935 (GRCm39) V1103M possibly damaging Het
Cntrob C T 11: 69,196,404 (GRCm39) R677H probably benign Het
Cntrob G A 11: 69,198,882 (GRCm39) P622L probably benign Het
Cyb5d1 A G 11: 69,286,028 (GRCm39) L31P probably benign Het
Cyb5d1 C A 11: 69,286,098 (GRCm39) A8S probably benign Het
Dmxl1 T G 18: 50,001,070 (GRCm39) V830G probably damaging Het
Dnah9 A C 11: 65,976,000 (GRCm39) S1350A probably benign Het
Dnah9 G A 11: 66,038,207 (GRCm39) H110Y probably benign Het
Elac2 T C 11: 64,870,015 (GRCm39) S27P probably benign Het
Ep400 T G 5: 110,903,549 (GRCm39) K350T unknown Het
Epha6 C T 16: 59,474,453 (GRCm39) R1108Q probably damaging Het
Epn2 C A 11: 61,470,460 (GRCm39) probably benign Het
Fam114a2 A G 11: 57,374,858 (GRCm39) S494P probably benign Het
Fam114a2 C T 11: 57,405,060 (GRCm39) G14E probably benign Het
Fam114a2 T C 11: 57,390,623 (GRCm39) N304D probably benign Het
Fam114a2 C T 11: 57,390,581 (GRCm39) V318I probably benign Het
Fam114a2 G A 11: 57,380,940 (GRCm39) A438V probably benign Het
Fam83g G A 11: 61,594,020 (GRCm39) R518Q probably benign Het
Fat2 TGTACCTCACCCCAGTACCT TGTACCT 11: 55,199,796 (GRCm39) probably null Het
Fat2 T G 11: 55,200,625 (GRCm39) K816N probably benign Het
Fbxw10 G A 11: 62,767,671 (GRCm39) V836I probably benign Het
Fbxw10 G C 11: 62,738,118 (GRCm39) R4T probably benign Het
Fmnl2 A G 2: 53,004,883 (GRCm39) E659G unknown Het
Foxo6 C T 4: 120,144,332 (GRCm39) G40R possibly damaging Het
Fthl17b C A X: 8,828,813 (GRCm39) A86S probably benign Het
Galnt10 G A 11: 57,656,514 (GRCm39) V233I probably benign Het
Gemin5 C G 11: 58,037,345 (GRCm39) E623D probably benign Het
Gemin5 C G 11: 58,013,115 (GRCm39) S1446T probably benign Het
Gemin5 T C 11: 58,020,897 (GRCm39) M1097V probably benign Het
Gemin5 C G 11: 58,030,336 (GRCm39) A830P probably benign Het
Gemin5 C G 11: 58,030,401 (GRCm39) C808S probably benign Het
Gemin5 T C 11: 58,016,044 (GRCm39) S1321G probably benign Het
Ggnbp2 C T 11: 84,727,478 (GRCm39) R481Q probably benign Het
Gjc2 T C 11: 59,067,259 (GRCm39) S408G unknown Het
Gjc2 A G 11: 59,067,318 (GRCm39) V388A unknown Het
Gjc2 ACCCTCCCT ACCCTCCCTCCCT 11: 59,073,561 (GRCm39) probably benign Het
Glod4 A G 11: 76,133,836 (GRCm39) V6A probably benign Het
Glod4 C A 11: 76,133,819 (GRCm39) probably null Het
Glod4 T C 11: 76,134,431 (GRCm39) K14E probably benign Het
Glod4 T C 11: 76,134,430 (GRCm39) K14R probably benign Het
Glp2r C A 11: 67,600,394 (GRCm39) R485L probably damaging Het
Glp2r C A 11: 67,600,470 (GRCm39) V460F probably benign Het
Glp2r C G 11: 67,600,472 (GRCm39) G459A probably benign Het
Glp2r C T 11: 67,630,993 (GRCm39) V295I probably benign Het
Glp2r C A 11: 67,661,662 (GRCm39) A13S probably benign Het
Glp2r A G 11: 67,635,773 (GRCm39) V189A probably benign Het
Glp2r T C 11: 67,633,129 (GRCm39) T235A probably benign Het
Glp2r T C 11: 67,631,885 (GRCm39) I281V probably benign Het
Glp2r A G 11: 67,631,878 (GRCm39) V283A probably benign Het
Gm12253 G C 11: 58,325,367 (GRCm39) S13T possibly damaging Het
Gm12253 A G 11: 58,325,658 (GRCm39) E43G probably benign Het
Gm12253 A C 11: 58,325,686 (GRCm39) E52D probably benign Het
Gm12253 A C 11: 58,326,237 (GRCm39) E84A probably benign Het
Gm12253 G A 11: 58,326,309 (GRCm39) S108N probably benign Het
Gm12253 G A 11: 58,331,835 (GRCm39) A215T possibly damaging Het
Gm12258 G A 11: 58,749,764 (GRCm39) R313H unknown Het
Gm12258 G A 11: 58,749,776 (GRCm39) G317E unknown Het
Gm12258 A T 11: 58,749,833 (GRCm39) E336V unknown Het
Gm12258 A G 11: 58,750,013 (GRCm39) probably benign Het
Gm12258 T A 11: 58,750,014 (GRCm39) probably benign Het
Gm12258 G C 11: 58,750,690 (GRCm39) G622R unknown Het
Gm12258 C T 11: 58,749,262 (GRCm39) R146W Het
Gm12258 T G 11: 58,749,126 (GRCm39) S100R Het
Gm13272 G C 4: 88,698,570 (GRCm39) V162L probably damaging Het
Gps2 C T 11: 69,807,130 (GRCm39) A60V probably benign Het
Gucy2e C A 11: 69,114,431 (GRCm39) A1033S probably benign Het
Gucy2e C G 11: 69,127,429 (GRCm39) G15R unknown Het
Guk1 G A 11: 59,082,747 (GRCm39) probably benign Het
Haspin T C 11: 73,028,174 (GRCm39) Q305R probably benign Het
Haspin A G 11: 73,028,777 (GRCm39) L104P probably benign Het
Hes7 T C 11: 69,013,782 (GRCm39) S214P probably benign Het
Hic1 G A 11: 75,058,352 (GRCm39) T179M probably damaging Het
Iba57 T C 11: 59,052,381 (GRCm39) T87A unknown Het
Iba57 CAGA CAGAGA 11: 59,052,329 (GRCm39) probably null Het
Iba57 C G 11: 59,053,865 (GRCm39) G36R unknown Het
Iba57 T C 11: 59,052,384 (GRCm39) T86A unknown Het
Iftap T C 2: 101,440,950 (GRCm39) K18E probably benign Het
Ighv5-8 TATATATATATATATATA TATATATATATATATATATA 12: 113,618,569 (GRCm39) probably null Het
Igtp C G 11: 58,097,791 (GRCm39) L321V possibly damaging Het
Igtp T G 11: 58,097,169 (GRCm39) D113E probably damaging Het
Igtp C G 11: 58,097,944 (GRCm39) L372V probably benign Het
Irgm2 G A 11: 58,110,924 (GRCm39) S205N probably benign Het
Irgm2 G A 11: 58,110,833 (GRCm39) V175I probably benign Het
Irgm2 T C 11: 58,110,780 (GRCm39) L157S probably benign Het
Irgm2 T C 11: 58,110,738 (GRCm39) I143T probably benign Het
Irgm2 A G 11: 58,110,389 (GRCm39) N27D probably benign Het
Irgm2 T A 11: 58,110,339 (GRCm39) V10D probably benign Het
Irgm2 C G 11: 58,111,389 (GRCm39) T360S probably benign Het
Irgm2 G T 11: 58,111,238 (GRCm39) A310S possibly damaging Het
Irgm2 A C 11: 58,110,951 (GRCm39) H214P probably benign Het
Itgae C G 11: 73,024,953 (GRCm39) S1028W probably benign Het
Itgae G T 11: 73,012,783 (GRCm39) G705V probably benign Het
Itgae A T 11: 73,012,757 (GRCm39) K696N probably benign Het
Itgae G A 11: 73,008,913 (GRCm39) V465I probably benign Het
Itgae A G 11: 73,006,466 (GRCm39) H378R probably benign Het
Itgae T A 11: 72,994,713 (GRCm39) L22M possibly damaging Het
Itgae A T 11: 72,994,786 (GRCm39) Q46L probably damaging Het
Kif1c C T 11: 70,614,940 (GRCm39) P578L probably benign Het
Kmt2d T C 15: 98,749,625 (GRCm39) N2656D unknown Het
Larp1 G A 11: 57,933,166 (GRCm39) V257I probably benign Het
Llgl1 ACCCCAGCCCTTCTGATTACTGCCCTCCCCAGC ACCCCAGC 11: 60,603,923 (GRCm39) probably null Het
Lrp1b A T 2: 40,640,946 (GRCm39) N3499K Het
Lypd8 C A 11: 58,275,475 (GRCm39) A70E possibly damaging Het
Lypd8 G A 11: 58,275,489 (GRCm39) E75K probably benign Het
Lypd8 CAATCACCAACA CAATCACCAACAGTTCCCTCGCCTCTGTTACCCCACAAATCACCAACA 11: 58,281,059 (GRCm39) probably benign Het
Lypd8 T C 11: 58,273,601 (GRCm39) Y27H probably benign Het
Lypd8l G A 11: 58,499,335 (GRCm39) P161L probably benign Het
Lypd8l A G 11: 58,503,387 (GRCm39) L47P probably benign Het
Lypd8l T G 11: 58,503,397 (GRCm39) S44R probably benign Het
Mapk7 CAGG CAGGGGAAGG 11: 61,381,070 (GRCm39) probably benign Het
Mapk7 CGCTGGTGCTGG CGCTGGTGCTGGTGCTGG 11: 61,381,038 (GRCm39) probably benign Het
Mapk7 TGGGGCAGGGGCAGGGGCAGG TGGCGCTGGGGCAGGGGCAGGGGCAGGGGCAGG 11: 61,381,053 (GRCm39) probably benign Het
Mfap3 G A 11: 57,418,902 (GRCm39) G21S probably benign Het
Mfap3 A T 11: 57,418,866 (GRCm39) I9F possibly damaging Het
Mrm3 C T 11: 76,138,221 (GRCm39) P203L probably benign Het
Mrm3 G A 11: 76,134,903 (GRCm39) R102K probably benign Het
Mroh2a G T 1: 88,162,938 (GRCm39) Q360H probably benign Het
Mrpl22 G A 11: 58,062,521 (GRCm39) A4T unknown Het
Mrpl55 A T 11: 59,095,415 (GRCm39) L26F probably benign Het
Mrpl55 A G 11: 59,094,999 (GRCm39) probably null Het
Myh1 A C 11: 67,095,272 (GRCm39) T211P probably benign Het
Myh2 T C 11: 67,079,639 (GRCm39) I1032T probably benign Het
Myh8 A C 11: 67,188,312 (GRCm39) N991T probably benign Het
Myocd A G 11: 65,075,418 (GRCm39) S697P probably benign Het
Nlgn2 A G 11: 69,719,220 (GRCm39) V210A possibly damaging Het
Nlrp1a T C 11: 71,014,914 (GRCm39) E112G probably benign Het
Nlrp1a T C 11: 70,990,442 (GRCm39) I1038V probably benign Het
Nlrp1a C T 11: 70,988,077 (GRCm39) R1131Q probably damaging Het
Nlrp1a T C 11: 70,983,069 (GRCm39) K1299R probably benign Het
Nlrp1a C G 11: 71,033,355 (GRCm39) probably null Het
Nlrp1b T C 11: 71,073,503 (GRCm39) I113M probably benign Het
Nlrp1b T A 11: 71,073,396 (GRCm39) Q149L probably benign Het
Nlrp1b A T 11: 71,073,378 (GRCm39) M155K probably benign Het
Nlrp1b C G 11: 71,073,370 (GRCm39) E158Q probably benign Het
Nlrp1b T C 11: 71,073,280 (GRCm39) T188A probably benign Het
Nlrp1b A T 11: 71,073,266 (GRCm39) D192E probably benign Het
Nlrp1b A G 11: 71,073,148 (GRCm39) Y232H probably benign Het
Nlrp1b G C 11: 71,073,135 (GRCm39) T236R probably benign Het
Nlrp1b A G 11: 71,072,625 (GRCm39) I406T probably benign Het
Nlrp1b A C 11: 71,072,539 (GRCm39) S435A probably benign Het
Nlrp1b C A 11: 71,072,534 (GRCm39) M436I probably benign Het
Nmur2 T C 11: 55,931,104 (GRCm39) I202M probably benign Het
Obscn C T 11: 58,958,655 (GRCm39) V3433I probably benign Het
Obscn T C 11: 58,977,527 (GRCm39) R1858G probably benign Het
Obscn A G 11: 58,977,565 (GRCm39) V1845A probably benign Het
Obscn T C 11: 58,981,573 (GRCm39) H1815R probably benign Het
Obscn A G 11: 58,984,142 (GRCm39) F1771S probably benign Het
Obscn C T 11: 58,984,239 (GRCm39) V1739M possibly damaging Het
Obscn G T 11: 58,984,334 (GRCm39) A1707D possibly damaging Het
Obscn C T 11: 58,984,335 (GRCm39) A1707T probably benign Het
Obscn G A 11: 58,984,385 (GRCm39) A1690V probably benign Het
Obscn C T 11: 58,990,735 (GRCm39) A1613T possibly damaging Het
Obscn T C 11: 58,990,755 (GRCm39) H1606R probably benign Het
Obscn C G 11: 58,994,167 (GRCm39) A1572P probably damaging Het
Obscn T C 11: 58,994,340 (GRCm39) H1514R probably benign Het
Obscn G A 11: 58,994,364 (GRCm39) A1506V probably benign Het
Obscn T C 11: 59,003,380 (GRCm39) E1306G probably benign Het
Obscn T C 11: 59,003,462 (GRCm39) M1279V probably benign Het
Obscn T C 11: 59,013,563 (GRCm39) M1095V probably benign Het
Obscn C T 11: 59,018,892 (GRCm39) A949T probably benign Het
Obscn C T 11: 59,018,895 (GRCm39) V973M probably damaging Het
Obscn T C 11: 59,020,513 (GRCm39) M844V probably benign Het
Obscn G T 11: 59,020,663 (GRCm39) L794M probably benign Het
Obscn C T 11: 59,021,449 (GRCm39) R797H probably damaging Het
Obscn C T 11: 59,023,937 (GRCm39) A578T possibly damaging Het
Obscn G A 11: 59,024,066 (GRCm39) P535S probably damaging Het
Obscn C G 11: 59,024,072 (GRCm39) A533P probably benign Het
Obscn T C 11: 59,026,505 (GRCm39) I233V probably benign Het
Obscn C T 11: 58,940,306 (GRCm39) D5354N Het
Obscn C A 11: 58,940,614 (GRCm39) R4593S possibly damaging Het
Obscn T C 11: 58,940,623 (GRCm39) T5307A Het
Obscn G A 11: 58,942,383 (GRCm39) T4372M probably benign Het
Obscn T C 11: 58,943,439 (GRCm39) M4237V probably benign Het
Obscn C T 11: 58,944,594 (GRCm39) R4700Q probably benign Het
Obscn T C 11: 58,944,651 (GRCm39) K4681R probably benign Het
Obscn T C 11: 58,945,044 (GRCm39) E4658G probably benign Het
Obscn C T 11: 58,945,176 (GRCm39) R4614Q probably benign Het
Obscn T C 11: 58,945,660 (GRCm39) T4184A probably benign Het
Obscn C T 11: 58,946,283 (GRCm39) R4474H probably damaging Het
Obscn T C 11: 58,946,331 (GRCm39) D4458G probably damaging Het
Obscn C T 11: 58,946,340 (GRCm39) R4455K probably benign Het
Obscn G T 11: 58,946,936 (GRCm39) A4066E possibly damaging Het
Obscn A G 11: 58,947,595 (GRCm39) M4478T Het
Obscn C A 11: 58,951,823 (GRCm39) G3977W probably damaging Het
Obscn C T 11: 58,952,388 (GRCm39) G3894R probably benign Het
Obscn C T 11: 58,952,408 (GRCm39) R3887K probably benign Het
Obscn G C 11: 58,952,959 (GRCm39) P4115A probably benign Het
Obscn C T 11: 58,952,965 (GRCm39) D4113N probably damaging Het
Obscn CCACACACACACAC CCACACACACAC 11: 58,954,279 (GRCm39) probably null Het
Obscn T C 11: 58,954,300 (GRCm39) T4037A Het
Obscn T C 11: 58,954,402 (GRCm39) K3727E probably damaging Het
Obscn G A 11: 58,891,715 (GRCm39) A6939V probably benign Het
Obscn C G 11: 58,900,019 (GRCm39) G938A probably benign Het
Obscn G C 11: 58,904,014 (GRCm39) T7320S probably benign Het
Obscn C T 11: 58,921,934 (GRCm39) R5954Q probably damaging Het
Obscn G C 11: 58,929,976 (GRCm39) P5080A probably benign Het
Obscn T A 11: 58,929,990 (GRCm39) Q5075L probably damaging Het
Obscn T C 11: 58,932,601 (GRCm39) I4869V probably benign Het
Obscn T C 11: 58,933,776 (GRCm39) T5363A probably benign Het
Obscn G A 11: 58,933,853 (GRCm39) A5337V probably benign Het
Obscn G A 11: 58,933,878 (GRCm39) R5329C probably benign Het
Obscn G A 11: 58,957,973 (GRCm39) R3576C probably benign Het
Obscn C T 11: 58,977,505 (GRCm39) R1865H probably benign Het
Obscn C A 11: 58,972,698 (GRCm39) G2116V possibly damaging Het
Obscn C G 11: 58,970,722 (GRCm39) V2328L probably benign Het
Obscn G A 11: 58,969,984 (GRCm39) R53C probably damaging Het
Obscn C T 11: 58,967,334 (GRCm39) V2792I possibly damaging Het
Obscn C A 11: 58,960,757 (GRCm39) A3185S probably benign Het
Or11l3 G A 11: 58,516,075 (GRCm39) S79F probably benign Het
Or11l3 A C 11: 58,516,732 (GRCm39) C46G possibly damaging Het
Or11l3 T G 11: 58,516,619 (GRCm39) K84N probably benign Het
Or11l3 G A 11: 58,516,588 (GRCm39) P95S probably benign Het
Or11l3 C G 11: 58,516,130 (GRCm39) G61R probably benign Het
Or2ab1 A C 11: 58,488,344 (GRCm39) I35L probably benign Het
Or2ab1 A G 11: 58,488,776 (GRCm39) S179G probably benign Het
Or2ab1 A G 11: 58,488,491 (GRCm39) S84G possibly damaging Het
Or2ab1 A G 11: 58,488,356 (GRCm39) I39V probably benign Het
Or2ak4 G A 11: 58,648,793 (GRCm39) A101T probably benign Het
Or2ak4 A C 11: 58,649,186 (GRCm39) K232Q probably benign Het
Or2ak4 A C,T 11: 58,649,168 (GRCm39) I226L probably benign Het
Or2ak4 G A 11: 58,649,153 (GRCm39) V221M probably damaging Het
Or2ak4 A G 11: 58,648,931 (GRCm39) S147G probably benign Het
Or2ak4 C T 11: 58,648,895 (GRCm39) L135F probably benign Het
Or2ak5 G A 11: 58,611,922 (GRCm39) probably benign Het
Or2ak6 A C 11: 58,592,784 (GRCm39) I86L probably benign Het
Or2ak6 C A 11: 58,593,222 (GRCm39) Q232K probably benign Het
Or2ak6 C T 11: 58,593,153 (GRCm39) L209F possibly damaging Het
Or2ak7 G T 11: 58,574,758 (GRCm39) D20Y probably benign Het
Or2ak7 T C 11: 58,575,548 (GRCm39) L283P probably benign Het
Or2ak7 T C 11: 58,574,815 (GRCm39) F39L probably benign Het
Or2ak7 G A 11: 58,575,541 (GRCm39) V281I probably benign Het
Or2ak7 C T 11: 58,575,289 (GRCm39) H197Y probably benign Het
Or2ak7 G A 11: 58,575,083 (GRCm39) R128Q probably benign Het
Or2ak7 G A 11: 58,574,941 (GRCm39) V81M probably benign Het
Or2av9 C T 11: 58,381,123 (GRCm39) A153T probably benign Het
Or2av9 C A 11: 58,380,574 (GRCm39) E336* probably null Het
Or2av9 T C 11: 58,381,314 (GRCm39) Q89R probably benign Het
Or2t29 G T 11: 58,434,272 (GRCm39) S23Y probably benign Het
Or2t43 G A 11: 58,457,388 (GRCm39) A261V probably benign Het
Or2t43 C T 11: 58,457,920 (GRCm39) V84I probably benign Het
Or2t43 A T 11: 58,457,521 (GRCm39) S217T probably benign Het
Or2t44 A G 11: 58,677,773 (GRCm39) T238A probably damaging Het
Or2t46 G A 11: 58,471,828 (GRCm39) V53I probably benign Het
Or2t46 T G 11: 58,472,122 (GRCm39) L151V probably benign Het
Or2t46 G C 11: 58,472,483 (GRCm39) S271T probably benign Het
Or2t46 C T 11: 58,471,750 (GRCm39) H27Y probably benign Het
Or2t46 T C 11: 58,471,757 (GRCm39) V29A probably benign Het
Or2t47 C T 11: 58,442,940 (GRCm39) A42T probably benign Het
Or2t47 T C 11: 58,442,387 (GRCm39) K226R probably benign Het
Or2t47 C T 11: 58,442,801 (GRCm39) S88N probably benign Het
Or2t49 C A 11: 58,392,936 (GRCm39) V155F probably benign Het
Or2t49 GGTGGATTGGTATGTGGAT GGTGGAT 11: 58,393,212 (GRCm39) probably benign Het
Or2t49 C G 11: 58,393,287 (GRCm39) V38L probably benign Het
Or2t49 C T 11: 58,393,396 (GRCm39) M1I probably null Het
Or2t49 T C 11: 58,392,474 (GRCm39) M309V probably benign Het
Or2t49 T C 11: 58,392,927 (GRCm39) I158V probably benign Het
Or2w3 T G 11: 58,557,342 (GRCm39) I319R probably benign Het
Or2w3b T C 11: 58,623,475 (GRCm39) H172R probably benign Het
Or2w3b C A 11: 58,624,048 (GRCm39) probably benign Het
Or2w3b T G 11: 58,623,200 (GRCm39) N264H probably benign Het
Or2w3b G A 11: 58,623,295 (GRCm39) A232V probably benign Het
Or5af2 T C 11: 58,708,122 (GRCm39) V96A probably benign Het
Or5af2 A G 11: 58,707,887 (GRCm39) I18V probably benign Het
Or5af2 C G 11: 58,708,644 (GRCm39) P270R probably benign Het
Or5af2 T C 11: 58,708,508 (GRCm39) C225R probably benign Het
Or5af2 C G 11: 58,708,243 (GRCm39) H136Q probably benign Het
Or5af2 A C 11: 58,708,220 (GRCm39) I129L probably benign Het
Or9e1 G T 11: 58,731,945 (GRCm39) A2S probably benign Het
Or9e1 G C 11: 58,731,907 (GRCm39) probably benign Het
Or9e1 A G 11: 58,732,615 (GRCm39) H225R probably benign Het
Or9e1 G A 11: 58,732,569 (GRCm39) A210T probably benign Het
Or9e1 T C 11: 58,732,084 (GRCm39) I48T probably benign Het
Or9e1 C T 11: 58,732,032 (GRCm39) L31F probably benign Het
Ovca2 T C 11: 75,069,528 (GRCm39) T32A probably benign Het
Pgbd5 G A 8: 125,106,955 (GRCm39) R196C probably damaging Het
Pimreg G A 11: 71,935,979 (GRCm39) R154H probably damaging Het
Pimreg TCACA TCA 11: 71,935,801 (GRCm39) probably benign Het
Pitpnm3 C T 11: 72,010,969 (GRCm39) R21Q probably benign Het
Pitpnm3 T C 11: 71,954,955 (GRCm39) K520E probably benign Het
Prpsap2 A C 11: 61,647,078 (GRCm39) V21G possibly damaging Het
Rabep1 C CT 11: 70,830,910 (GRCm39) probably null Het
Rai1 A G 11: 60,078,389 (GRCm39) N818D probably benign Het
Rap1gap2 C T 11: 74,487,721 (GRCm39) E52K probably benign Het
Rc3h2 T C 2: 37,289,612 (GRCm39) H400R possibly damaging Het
Rnf112 A G 11: 61,341,775 (GRCm39) L343P unknown Het
Rnf167 C CACAGGGA 11: 70,541,646 (GRCm39) probably null Het
Rpl26 A G 11: 68,794,069 (GRCm39) Y78C probably benign Het
Rtn4rl1 C T 11: 75,156,863 (GRCm39) P432S probably benign Het
Shisa6 GCCGCC GCCGCCTCCGCC 11: 66,416,519 (GRCm39) probably benign Het
Slc10a2 G A 8: 5,155,063 (GRCm39) L41F probably damaging Het
Slc11a2 A G 15: 100,305,980 (GRCm39) probably null Het
Slc15a5 G T 6: 137,994,956 (GRCm39) L122M Het
Slc2a4 GCC G 11: 69,834,819 (GRCm39) probably null Het
Slc2a4 GGCCG GG 11: 69,834,818 (GRCm39) probably benign Het
Slc6a4 A G 11: 76,903,858 (GRCm39) K152R probably benign Het
Slc6a4 G A 11: 76,901,382 (GRCm39) G39E probably benign Het
Smcr8 T C 11: 60,669,932 (GRCm39) V360A probably benign Het
Smcr8 A G 11: 60,668,806 (GRCm39) probably benign Het
Smcr8 C A 11: 60,670,699 (GRCm39) R616S probably benign Het
Smg6 G T 11: 75,047,092 (GRCm39) A1262S probably benign Het
Spns3 T C 11: 72,440,863 (GRCm39) I58V probably benign Het
Spns3 T C 11: 72,440,986 (GRCm39) S17G probably benign Het
Spns3 G A 11: 72,440,917 (GRCm39) P40S probably benign Het
Srebf1 C T 11: 60,097,061 (GRCm39) V256M probably benign Het
Tbc1d32 G T 10: 56,046,977 (GRCm39) L564M probably damaging Het
Tekt1 T C 11: 72,250,597 (GRCm39) Q33R probably benign Het
Timm22 T G 11: 76,297,943 (GRCm39) V18G probably benign Het
Tmc3 T A 7: 83,261,686 (GRCm39) L588H probably damaging Het
Tmem102 C G 11: 69,695,902 (GRCm39) G53A possibly damaging Het
Tmem102 G C 11: 69,695,927 (GRCm39) R45G probably benign Het
Tmem11 A G 11: 60,766,658 (GRCm39) probably benign Het
Tom1l2 C T 11: 60,132,682 (GRCm39) A414T probably benign Het
Top3a C T 11: 60,641,410 (GRCm39) G425S probably benign Het
Trim16 C A 11: 62,731,675 (GRCm39) D515E probably benign Het
Trim16 T C 11: 62,731,572 (GRCm39) V481A probably benign Het
Trim16 G A 11: 62,727,643 (GRCm39) E322K probably benign Het
Trim16 A AAGC 11: 62,711,521 (GRCm39) probably benign Het
Trim16 TGAAGA TGAAGAAGA 11: 62,711,516 (GRCm39) probably benign Het
Trim16 G C 11: 62,711,502 (GRCm39) V58L probably benign Het
Trim16 C T 11: 62,711,428 (GRCm39) A33V probably benign Het
Trim17 G A 11: 58,856,331 (GRCm39) M129I probably benign Het
Trim17 A G 11: 58,861,272 (GRCm39) N259S probably benign Het
Trim58 A G 11: 58,542,486 (GRCm39) N482S probably benign Het
Trim58 C A 11: 58,531,684 (GRCm39) L131M possibly damaging Het
Trpv1 C G 11: 73,131,427 (GRCm39) P322A possibly damaging Het
Trpv1 C A 11: 73,145,117 (GRCm39) D734E probably benign Het
Trpv3 G A 11: 73,169,803 (GRCm39) A125T probably benign Het
Trpv3 C T 11: 73,160,513 (GRCm39) A9V probably benign Het
Trpv3 A G 11: 73,174,502 (GRCm39) T290A probably benign Het
Tvp23b A C 11: 62,772,769 (GRCm39) N7H possibly damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,139,706 (GRCm39) probably benign Het
Uqcrc2 A C 7: 120,239,516 (GRCm39) K109N probably benign Het
Usp43 AGGGC AGGGCAGGGGATGAACCTCGGGC 11: 67,746,545 (GRCm39) probably benign Het
Usp43 C T 11: 67,747,332 (GRCm39) G792S probably benign Het
Vamp2 C T 11: 68,979,411 (GRCm39) probably benign Het
Vamp2 G A 11: 68,980,889 (GRCm39) G124R possibly damaging Het
Vat1l A C 8: 114,932,463 (GRCm39) K3T probably damaging Het
Vmn2r120 A T 17: 57,829,436 (GRCm39) V487E probably damaging Het
Xaf1 G C 11: 72,199,856 (GRCm39) V198L unknown Het
Xaf1 GGCT GGCTGGCCAGCT 11: 72,199,846 (GRCm39) probably null Het
Xaf1 T G 11: 72,199,792 (GRCm39) C176W unknown Het
Xaf1 A G 11: 72,199,476 (GRCm39) E71G probably benign Het
Xaf1 C A 11: 72,197,434 (GRCm39) L137I probably benign Het
Xaf1 G C 11: 72,197,429 (GRCm39) C135S probably damaging Het
Xaf1 G A 11: 72,197,426 (GRCm39) R134H probably benign Het
Xaf1 T C 11: 72,199,881 (GRCm39) L206S unknown Het
Zar1l C A 5: 150,430,658 (GRCm39) R251I possibly damaging Het
Zfp286 A G 11: 62,678,795 (GRCm39) V44A probably benign Het
Zfp286 G A 11: 62,675,782 (GRCm39) T60M probably damaging Het
Zfp287 G A 11: 62,613,757 (GRCm39) R225* probably null Het
Zfp287 C T 11: 62,604,633 (GRCm39) R758H probably benign Het
Zfp287 C G 11: 62,606,175 (GRCm39) C244S probably benign Het
Zfp39 T C 11: 58,781,526 (GRCm39) N412S possibly damaging Het
Zfp39 T C 11: 58,781,274 (GRCm39) D496G possibly damaging Het
Zfp39 G C 11: 58,781,273 (GRCm39) D496E probably benign Het
Zfp39 G C 11: 58,781,130 (GRCm39) T544R possibly damaging Het
Zfp39 A C 11: 58,780,873 (GRCm39) Y630D probably benign Het
Zfp39 G C 11: 58,780,871 (GRCm39) Y630* probably null Het
Zfp39 T G 11: 58,791,409 (GRCm39) S93R probably benign Het
Zfp39 G T 11: 58,791,407 (GRCm39) S93R probably benign Het
Zfp39 T C 11: 58,782,142 (GRCm39) K207E probably benign Het
Zfp39 A G 11: 58,782,123 (GRCm39) I213T probably benign Het
Zfp39 T A 11: 58,781,967 (GRCm39) H265L probably damaging Het
Zfp39 G T 11: 58,781,597 (GRCm39) N388K probably benign Het
Zfp39 A G 11: 58,781,605 (GRCm39) S386P probably benign Het
Zfp39 A C 11: 58,781,702 (GRCm39) H353Q probably damaging Het
Zfp39 A C 11: 58,781,712 (GRCm39) V350G probably benign Het
Zfp39 A G 11: 58,781,724 (GRCm39) V346A probably benign Het
Zfp39 T A 11: 58,781,751 (GRCm39) K337M probably benign Het
Zfp672 G T 11: 58,220,452 (GRCm39) T49K unknown Het
Zfp692 G T 11: 58,199,859 (GRCm39) E149D probably benign Het
Zfp692 G A 11: 58,200,844 (GRCm39) V242I probably benign Het
Zzef1 G A 11: 72,780,008 (GRCm39) R1927H probably benign Het
Other mutations in Hydin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Hydin APN 8 111,296,434 (GRCm39) missense possibly damaging 0.69
IGL00432:Hydin APN 8 111,327,884 (GRCm39) missense probably damaging 0.98
IGL01025:Hydin APN 8 111,053,033 (GRCm39) missense probably benign 0.38
IGL01140:Hydin APN 8 111,124,694 (GRCm39) missense probably benign 0.14
IGL01317:Hydin APN 8 111,053,078 (GRCm39) missense probably damaging 0.98
IGL01473:Hydin APN 8 111,038,792 (GRCm39) missense probably benign 0.08
IGL01473:Hydin APN 8 111,081,585 (GRCm39) missense probably damaging 1.00
IGL01610:Hydin APN 8 111,284,345 (GRCm39) missense probably benign 0.00
IGL01685:Hydin APN 8 111,081,665 (GRCm39) nonsense probably null
IGL01734:Hydin APN 8 111,217,421 (GRCm39) nonsense probably null
IGL01743:Hydin APN 8 111,319,408 (GRCm39) missense possibly damaging 0.94
IGL01829:Hydin APN 8 111,316,154 (GRCm39) missense possibly damaging 0.68
IGL01919:Hydin APN 8 111,245,806 (GRCm39) missense possibly damaging 0.89
IGL01946:Hydin APN 8 111,217,350 (GRCm39) missense possibly damaging 0.91
IGL01983:Hydin APN 8 111,241,527 (GRCm39) missense probably benign 0.02
IGL02122:Hydin APN 8 111,221,047 (GRCm39) missense possibly damaging 0.86
IGL02140:Hydin APN 8 111,293,570 (GRCm39) missense probably benign
IGL02158:Hydin APN 8 111,336,598 (GRCm39) missense possibly damaging 0.89
IGL02167:Hydin APN 8 111,145,055 (GRCm39) missense possibly damaging 0.96
IGL02171:Hydin APN 8 111,178,590 (GRCm39) nonsense probably null
IGL02185:Hydin APN 8 111,233,108 (GRCm39) missense possibly damaging 0.86
IGL02517:Hydin APN 8 111,293,604 (GRCm39) missense probably benign 0.01
IGL02639:Hydin APN 8 111,265,081 (GRCm39) missense probably benign 0.01
IGL02644:Hydin APN 8 111,265,100 (GRCm39) missense probably damaging 1.00
IGL02652:Hydin APN 8 111,316,154 (GRCm39) missense possibly damaging 0.68
IGL02658:Hydin APN 8 111,139,908 (GRCm39) missense possibly damaging 0.86
IGL02706:Hydin APN 8 111,137,198 (GRCm39) missense probably damaging 0.99
IGL02892:Hydin APN 8 111,325,591 (GRCm39) missense possibly damaging 0.89
IGL02947:Hydin APN 8 111,145,094 (GRCm39) missense probably damaging 0.96
IGL03136:Hydin APN 8 111,145,156 (GRCm39) missense probably benign 0.22
IGL03248:Hydin APN 8 111,321,921 (GRCm39) missense probably damaging 0.97
IGL03251:Hydin APN 8 111,217,228 (GRCm39) missense probably damaging 1.00
IGL03350:Hydin APN 8 111,038,856 (GRCm39) missense possibly damaging 0.86
IGL03366:Hydin APN 8 110,993,995 (GRCm39) missense unknown
IGL03404:Hydin APN 8 111,296,409 (GRCm39) missense probably benign 0.06
Franz_joseph UTSW 8 111,327,950 (GRCm39) missense probably damaging 1.00
jahreszeiten UTSW 8 111,295,991 (GRCm39) missense probably damaging 1.00
maria UTSW 8 111,235,759 (GRCm39) splice site probably benign
schoepfung UTSW 8 111,326,877 (GRCm39) missense possibly damaging 0.68
surprise UTSW 8 111,254,648 (GRCm39) missense probably benign
teresa UTSW 8 111,336,303 (GRCm39) missense possibly damaging 0.79
BB001:Hydin UTSW 8 111,145,103 (GRCm39) missense possibly damaging 0.93
BB004:Hydin UTSW 8 111,307,476 (GRCm39) missense possibly damaging 0.89
BB011:Hydin UTSW 8 111,145,103 (GRCm39) missense possibly damaging 0.93
BB014:Hydin UTSW 8 111,307,476 (GRCm39) missense possibly damaging 0.89
P0005:Hydin UTSW 8 111,220,921 (GRCm39) critical splice acceptor site probably null
R0099:Hydin UTSW 8 111,316,193 (GRCm39) missense probably damaging 1.00
R0125:Hydin UTSW 8 111,189,163 (GRCm39) missense probably benign 0.12
R0157:Hydin UTSW 8 111,026,642 (GRCm39) missense possibly damaging 0.86
R0241:Hydin UTSW 8 111,124,655 (GRCm39) missense probably benign 0.04
R0241:Hydin UTSW 8 111,124,655 (GRCm39) missense probably benign 0.04
R0255:Hydin UTSW 8 111,291,650 (GRCm39) missense probably benign 0.00
R0352:Hydin UTSW 8 111,296,533 (GRCm39) critical splice donor site probably null
R0379:Hydin UTSW 8 111,235,759 (GRCm39) splice site probably benign
R0468:Hydin UTSW 8 111,139,855 (GRCm39) missense possibly damaging 0.96
R0477:Hydin UTSW 8 111,145,130 (GRCm39) missense probably damaging 1.00
R0479:Hydin UTSW 8 111,325,720 (GRCm39) missense probably damaging 1.00
R0539:Hydin UTSW 8 111,249,704 (GRCm39) missense probably benign
R0550:Hydin UTSW 8 111,314,407 (GRCm39) missense probably benign 0.01
R0571:Hydin UTSW 8 111,240,735 (GRCm39) splice site probably null
R0606:Hydin UTSW 8 111,276,430 (GRCm39) splice site probably benign
R0789:Hydin UTSW 8 111,293,603 (GRCm39) missense possibly damaging 0.53
R0849:Hydin UTSW 8 111,325,616 (GRCm39) missense probably damaging 1.00
R0946:Hydin UTSW 8 111,257,685 (GRCm39) missense probably benign 0.25
R1201:Hydin UTSW 8 111,296,487 (GRCm39) missense probably benign 0.01
R1375:Hydin UTSW 8 111,232,854 (GRCm39) critical splice donor site probably null
R1385:Hydin UTSW 8 111,249,836 (GRCm39) missense probably benign 0.40
R1411:Hydin UTSW 8 111,301,663 (GRCm39) missense probably benign 0.04
R1437:Hydin UTSW 8 111,308,617 (GRCm39) nonsense probably null
R1447:Hydin UTSW 8 111,249,798 (GRCm39) missense probably damaging 1.00
R1448:Hydin UTSW 8 111,173,217 (GRCm39) missense probably benign 0.27
R1466:Hydin UTSW 8 111,259,585 (GRCm39) missense possibly damaging 0.47
R1466:Hydin UTSW 8 111,259,585 (GRCm39) missense possibly damaging 0.47
R1523:Hydin UTSW 8 111,259,903 (GRCm39) missense probably benign 0.05
R1544:Hydin UTSW 8 111,301,486 (GRCm39) missense probably benign 0.30
R1581:Hydin UTSW 8 111,137,092 (GRCm39) missense probably benign
R1584:Hydin UTSW 8 111,307,447 (GRCm39) missense probably benign 0.27
R1598:Hydin UTSW 8 111,137,306 (GRCm39) missense possibly damaging 0.96
R1633:Hydin UTSW 8 111,233,614 (GRCm39) missense probably benign 0.10
R1777:Hydin UTSW 8 111,316,203 (GRCm39) missense probably benign 0.14
R1817:Hydin UTSW 8 111,259,459 (GRCm39) missense probably benign 0.00
R1828:Hydin UTSW 8 111,237,526 (GRCm39) missense probably benign 0.03
R1837:Hydin UTSW 8 111,296,257 (GRCm39) missense probably benign 0.20
R1848:Hydin UTSW 8 111,296,440 (GRCm39) missense probably benign 0.19
R1869:Hydin UTSW 8 111,227,337 (GRCm39) missense possibly damaging 0.94
R1909:Hydin UTSW 8 111,314,404 (GRCm39) missense probably damaging 1.00
R1928:Hydin UTSW 8 111,229,579 (GRCm39) missense possibly damaging 0.93
R1950:Hydin UTSW 8 111,336,619 (GRCm39) missense possibly damaging 0.64
R2095:Hydin UTSW 8 111,189,289 (GRCm39) missense probably damaging 0.96
R2172:Hydin UTSW 8 111,308,681 (GRCm39) missense probably benign 0.42
R2217:Hydin UTSW 8 111,145,138 (GRCm39) missense probably benign
R2248:Hydin UTSW 8 111,304,835 (GRCm39) missense probably benign 0.09
R2272:Hydin UTSW 8 111,035,764 (GRCm39) missense probably benign 0.01
R2294:Hydin UTSW 8 111,026,591 (GRCm39) missense probably damaging 0.99
R2315:Hydin UTSW 8 111,124,676 (GRCm39) missense probably benign 0.01
R2330:Hydin UTSW 8 111,291,641 (GRCm39) missense probably benign 0.01
R2374:Hydin UTSW 8 111,291,780 (GRCm39) missense probably damaging 1.00
R2446:Hydin UTSW 8 111,314,347 (GRCm39) missense possibly damaging 0.82
R2484:Hydin UTSW 8 111,239,747 (GRCm39) missense possibly damaging 0.76
R2698:Hydin UTSW 8 111,336,561 (GRCm39) missense possibly damaging 0.70
R2843:Hydin UTSW 8 111,245,746 (GRCm39) missense probably benign
R2844:Hydin UTSW 8 111,245,746 (GRCm39) missense probably benign
R2846:Hydin UTSW 8 111,245,746 (GRCm39) missense probably benign
R2882:Hydin UTSW 8 111,293,555 (GRCm39) missense possibly damaging 0.92
R2937:Hydin UTSW 8 111,130,927 (GRCm39) missense possibly damaging 0.88
R3031:Hydin UTSW 8 111,329,848 (GRCm39) missense possibly damaging 0.83
R3038:Hydin UTSW 8 111,309,321 (GRCm39) missense probably damaging 1.00
R3121:Hydin UTSW 8 111,233,138 (GRCm39) missense probably benign
R3157:Hydin UTSW 8 110,994,005 (GRCm39) missense unknown
R3547:Hydin UTSW 8 111,308,699 (GRCm39) missense possibly damaging 0.85
R3696:Hydin UTSW 8 111,329,911 (GRCm39) missense probably damaging 1.00
R3850:Hydin UTSW 8 111,290,561 (GRCm39) missense probably damaging 0.99
R3896:Hydin UTSW 8 111,235,711 (GRCm39) missense possibly damaging 0.93
R3983:Hydin UTSW 8 111,118,957 (GRCm39) missense probably damaging 1.00
R4031:Hydin UTSW 8 111,336,679 (GRCm39) missense probably benign 0.30
R4072:Hydin UTSW 8 111,231,888 (GRCm39) missense possibly damaging 0.68
R4095:Hydin UTSW 8 111,268,179 (GRCm39) missense probably damaging 0.98
R4176:Hydin UTSW 8 111,320,452 (GRCm39) missense probably benign 0.00
R4213:Hydin UTSW 8 111,183,139 (GRCm39) missense possibly damaging 0.91
R4412:Hydin UTSW 8 111,142,368 (GRCm39) missense probably damaging 0.99
R4471:Hydin UTSW 8 111,313,764 (GRCm39) missense probably damaging 1.00
R4474:Hydin UTSW 8 111,290,497 (GRCm39) missense probably benign 0.11
R4495:Hydin UTSW 8 111,322,034 (GRCm39) missense probably damaging 0.99
R4508:Hydin UTSW 8 111,245,886 (GRCm39) missense possibly damaging 0.91
R4578:Hydin UTSW 8 110,993,971 (GRCm39) missense unknown
R4583:Hydin UTSW 8 111,321,857 (GRCm39) missense probably benign 0.36
R4600:Hydin UTSW 8 111,293,582 (GRCm39) missense probably benign 0.04
R4681:Hydin UTSW 8 111,233,103 (GRCm39) missense possibly damaging 0.85
R4685:Hydin UTSW 8 111,189,154 (GRCm39) missense probably damaging 0.99
R4689:Hydin UTSW 8 111,322,046 (GRCm39) missense probably benign 0.18
R4735:Hydin UTSW 8 111,282,264 (GRCm39) critical splice donor site probably null
R4736:Hydin UTSW 8 111,249,840 (GRCm39) missense probably benign 0.02
R4740:Hydin UTSW 8 111,173,071 (GRCm39) missense probably benign 0.06
R4771:Hydin UTSW 8 111,259,515 (GRCm39) missense probably benign
R4777:Hydin UTSW 8 111,137,096 (GRCm39) missense probably damaging 0.98
R4859:Hydin UTSW 8 111,233,126 (GRCm39) missense possibly damaging 0.93
R4911:Hydin UTSW 8 111,322,070 (GRCm39) missense probably benign 0.01
R4964:Hydin UTSW 8 111,217,305 (GRCm39) missense possibly damaging 0.86
R4965:Hydin UTSW 8 111,124,727 (GRCm39) missense probably benign
R4989:Hydin UTSW 8 111,290,554 (GRCm39) missense possibly damaging 0.84
R4995:Hydin UTSW 8 111,296,274 (GRCm39) missense probably damaging 0.97
R5059:Hydin UTSW 8 111,232,401 (GRCm39) missense probably damaging 0.96
R5071:Hydin UTSW 8 111,265,105 (GRCm39) missense probably benign 0.03
R5073:Hydin UTSW 8 111,265,105 (GRCm39) missense probably benign 0.03
R5092:Hydin UTSW 8 111,309,300 (GRCm39) missense probably benign 0.16
R5156:Hydin UTSW 8 111,336,333 (GRCm39) missense probably benign 0.00
R5166:Hydin UTSW 8 111,249,774 (GRCm39) missense possibly damaging 0.89
R5189:Hydin UTSW 8 111,139,843 (GRCm39) critical splice acceptor site probably null
R5243:Hydin UTSW 8 111,232,380 (GRCm39) missense possibly damaging 0.92
R5244:Hydin UTSW 8 111,259,451 (GRCm39) missense possibly damaging 0.77
R5256:Hydin UTSW 8 111,313,855 (GRCm39) missense possibly damaging 0.92
R5266:Hydin UTSW 8 111,061,416 (GRCm39) missense possibly damaging 0.87
R5283:Hydin UTSW 8 111,178,612 (GRCm39) missense possibly damaging 0.96
R5343:Hydin UTSW 8 111,212,051 (GRCm39) missense probably benign 0.40
R5359:Hydin UTSW 8 111,265,004 (GRCm39) missense probably benign 0.00
R5390:Hydin UTSW 8 111,322,099 (GRCm39) missense probably benign
R5394:Hydin UTSW 8 111,266,474 (GRCm39) splice site probably null
R5441:Hydin UTSW 8 111,291,741 (GRCm39) missense possibly damaging 0.72
R5461:Hydin UTSW 8 111,245,863 (GRCm39) missense probably damaging 0.96
R5662:Hydin UTSW 8 111,307,341 (GRCm39) missense probably benign 0.02
R5695:Hydin UTSW 8 111,261,915 (GRCm39) missense probably benign 0.35
R5732:Hydin UTSW 8 111,178,690 (GRCm39) missense probably benign 0.03
R5774:Hydin UTSW 8 111,298,547 (GRCm39) nonsense probably null
R5780:Hydin UTSW 8 111,312,712 (GRCm39) missense probably damaging 1.00
R5787:Hydin UTSW 8 111,052,985 (GRCm39) missense probably damaging 0.99
R5802:Hydin UTSW 8 111,178,692 (GRCm39) missense possibly damaging 0.86
R5841:Hydin UTSW 8 111,259,846 (GRCm39) missense possibly damaging 0.76
R5856:Hydin UTSW 8 111,268,474 (GRCm39) missense probably damaging 0.99
R5893:Hydin UTSW 8 111,217,308 (GRCm39) missense probably benign 0.12
R5963:Hydin UTSW 8 111,220,926 (GRCm39) missense possibly damaging 0.93
R6008:Hydin UTSW 8 111,325,717 (GRCm39) missense probably benign 0.02
R6019:Hydin UTSW 8 111,293,252 (GRCm39) missense probably benign
R6038:Hydin UTSW 8 111,325,663 (GRCm39) missense probably benign 0.16
R6038:Hydin UTSW 8 111,325,663 (GRCm39) missense probably benign 0.16
R6133:Hydin UTSW 8 111,327,908 (GRCm39) missense probably benign 0.00
R6135:Hydin UTSW 8 111,189,292 (GRCm39) missense possibly damaging 0.85
R6157:Hydin UTSW 8 111,254,648 (GRCm39) missense probably benign
R6209:Hydin UTSW 8 111,320,434 (GRCm39) missense probably benign 0.05
R6238:Hydin UTSW 8 111,118,743 (GRCm39) splice site probably null
R6293:Hydin UTSW 8 111,324,543 (GRCm39) missense possibly damaging 0.83
R6340:Hydin UTSW 8 111,081,574 (GRCm39) splice site probably null
R6349:Hydin UTSW 8 111,145,091 (GRCm39) nonsense probably null
R6357:Hydin UTSW 8 111,268,289 (GRCm39) missense possibly damaging 0.86
R6385:Hydin UTSW 8 111,038,856 (GRCm39) missense possibly damaging 0.86
R6396:Hydin UTSW 8 111,233,521 (GRCm39) missense probably damaging 0.96
R6466:Hydin UTSW 8 111,233,600 (GRCm39) missense possibly damaging 0.85
R6648:Hydin UTSW 8 111,252,299 (GRCm39) splice site probably null
R6671:Hydin UTSW 8 111,327,950 (GRCm39) missense probably damaging 1.00
R6695:Hydin UTSW 8 111,053,092 (GRCm39) missense probably benign 0.05
R6800:Hydin UTSW 8 111,324,603 (GRCm39) missense probably benign 0.09
R6841:Hydin UTSW 8 111,265,007 (GRCm39) missense probably benign 0.09
R6867:Hydin UTSW 8 111,266,434 (GRCm39) missense probably benign 0.08
R6889:Hydin UTSW 8 111,259,488 (GRCm39) missense possibly damaging 0.79
R6895:Hydin UTSW 8 111,038,883 (GRCm39) missense probably benign 0.00
R6940:Hydin UTSW 8 111,217,243 (GRCm39) missense probably damaging 1.00
R6951:Hydin UTSW 8 111,124,757 (GRCm39) missense probably benign
R6980:Hydin UTSW 8 111,139,916 (GRCm39) missense possibly damaging 0.91
R6981:Hydin UTSW 8 111,257,704 (GRCm39) missense possibly damaging 0.89
R7061:Hydin UTSW 8 111,329,920 (GRCm39) missense possibly damaging 0.90
R7085:Hydin UTSW 8 111,329,962 (GRCm39) missense probably benign 0.03
R7086:Hydin UTSW 8 111,326,877 (GRCm39) missense possibly damaging 0.68
R7110:Hydin UTSW 8 111,081,583 (GRCm39) critical splice acceptor site probably null
R7158:Hydin UTSW 8 111,336,303 (GRCm39) missense possibly damaging 0.79
R7163:Hydin UTSW 8 111,329,968 (GRCm39) missense probably benign 0.25
R7209:Hydin UTSW 8 111,216,424 (GRCm39) nonsense probably null
R7244:Hydin UTSW 8 111,276,307 (GRCm39) missense probably damaging 0.98
R7347:Hydin UTSW 8 111,326,994 (GRCm39) missense probably benign 0.06
R7349:Hydin UTSW 8 111,124,803 (GRCm39) splice site probably null
R7359:Hydin UTSW 8 111,232,733 (GRCm39) missense probably damaging 0.98
R7365:Hydin UTSW 8 111,327,905 (GRCm39) missense probably damaging 1.00
R7365:Hydin UTSW 8 111,284,294 (GRCm39) missense probably damaging 0.99
R7436:Hydin UTSW 8 111,310,546 (GRCm39) missense probably damaging 0.96
R7528:Hydin UTSW 8 111,107,204 (GRCm39) nonsense probably null
R7544:Hydin UTSW 8 111,316,157 (GRCm39) missense probably benign 0.35
R7625:Hydin UTSW 8 111,268,476 (GRCm39) missense probably benign 0.01
R7713:Hydin UTSW 8 111,320,444 (GRCm39) missense possibly damaging 0.69
R7763:Hydin UTSW 8 111,232,475 (GRCm39) missense possibly damaging 0.92
R7771:Hydin UTSW 8 111,291,717 (GRCm39) missense probably damaging 0.97
R7794:Hydin UTSW 8 111,235,715 (GRCm39) missense probably damaging 1.00
R7833:Hydin UTSW 8 111,316,092 (GRCm39) missense probably damaging 0.99
R7894:Hydin UTSW 8 111,239,642 (GRCm39) missense possibly damaging 0.88
R7899:Hydin UTSW 8 111,314,380 (GRCm39) missense probably benign 0.00
R7908:Hydin UTSW 8 111,237,499 (GRCm39) missense probably benign 0.01
R7912:Hydin UTSW 8 111,282,239 (GRCm39) missense possibly damaging 0.68
R7919:Hydin UTSW 8 110,993,971 (GRCm39) missense unknown
R7924:Hydin UTSW 8 111,145,103 (GRCm39) missense possibly damaging 0.93
R7927:Hydin UTSW 8 111,307,476 (GRCm39) missense possibly damaging 0.89
R7970:Hydin UTSW 8 111,035,723 (GRCm39) missense probably damaging 0.99
R7993:Hydin UTSW 8 111,306,264 (GRCm39) missense probably benign
R8011:Hydin UTSW 8 111,310,541 (GRCm39) missense probably damaging 1.00
R8041:Hydin UTSW 8 111,301,626 (GRCm39) missense probably benign 0.02
R8080:Hydin UTSW 8 111,261,863 (GRCm39) missense probably benign 0.32
R8081:Hydin UTSW 8 111,092,101 (GRCm39) missense possibly damaging 0.93
R8095:Hydin UTSW 8 111,295,991 (GRCm39) missense probably damaging 1.00
R8157:Hydin UTSW 8 111,178,668 (GRCm39) missense probably benign 0.33
R8186:Hydin UTSW 8 111,336,277 (GRCm39) missense probably benign 0.14
R8205:Hydin UTSW 8 111,319,270 (GRCm39) missense possibly damaging 0.57
R8263:Hydin UTSW 8 111,178,705 (GRCm39) missense probably benign 0.00
R8288:Hydin UTSW 8 111,233,661 (GRCm39) missense probably damaging 0.96
R8298:Hydin UTSW 8 111,327,015 (GRCm39) missense probably damaging 1.00
R8309:Hydin UTSW 8 111,334,534 (GRCm39) missense probably benign 0.18
R8348:Hydin UTSW 8 111,329,878 (GRCm39) missense possibly damaging 0.68
R8356:Hydin UTSW 8 111,259,756 (GRCm39) missense possibly damaging 0.67
R8406:Hydin UTSW 8 111,336,543 (GRCm39) missense possibly damaging 0.94
R8415:Hydin UTSW 8 111,178,626 (GRCm39) missense probably damaging 1.00
R8417:Hydin UTSW 8 111,296,024 (GRCm39) missense probably benign 0.28
R8432:Hydin UTSW 8 111,324,583 (GRCm39) missense probably benign 0.02
R8437:Hydin UTSW 8 111,189,367 (GRCm39) missense probably damaging 0.96
R8463:Hydin UTSW 8 111,237,553 (GRCm39) missense probably benign 0.22
R8508:Hydin UTSW 8 111,308,650 (GRCm39) missense probably benign 0.00
R8510:Hydin UTSW 8 111,233,202 (GRCm39) missense probably damaging 1.00
R8560:Hydin UTSW 8 111,265,106 (GRCm39) missense probably benign 0.09
R8682:Hydin UTSW 8 111,035,798 (GRCm39) missense probably damaging 0.96
R8697:Hydin UTSW 8 111,259,515 (GRCm39) missense probably benign
R8857:Hydin UTSW 8 111,298,587 (GRCm39) critical splice donor site probably null
R8866:Hydin UTSW 8 111,308,779 (GRCm39) missense possibly damaging 0.89
R8878:Hydin UTSW 8 111,035,720 (GRCm39) missense probably benign 0.12
R8897:Hydin UTSW 8 111,316,112 (GRCm39) missense probably benign
R8987:Hydin UTSW 8 111,239,766 (GRCm39) nonsense probably null
R9072:Hydin UTSW 8 110,994,083 (GRCm39) critical splice donor site probably null
R9073:Hydin UTSW 8 110,994,083 (GRCm39) critical splice donor site probably null
R9102:Hydin UTSW 8 111,235,546 (GRCm39) missense probably benign 0.33
R9224:Hydin UTSW 8 111,259,516 (GRCm39) missense probably benign
R9255:Hydin UTSW 8 111,261,972 (GRCm39) missense probably benign 0.23
R9257:Hydin UTSW 8 111,301,648 (GRCm39) missense probably damaging 0.99
R9261:Hydin UTSW 8 110,994,047 (GRCm39) missense unknown
R9273:Hydin UTSW 8 111,233,580 (GRCm39) missense probably damaging 0.98
R9376:Hydin UTSW 8 111,124,695 (GRCm39) missense possibly damaging 0.70
R9380:Hydin UTSW 8 111,290,504 (GRCm39) missense probably benign 0.07
R9386:Hydin UTSW 8 111,314,362 (GRCm39) missense probably benign
R9406:Hydin UTSW 8 111,314,412 (GRCm39) missense probably null 0.96
R9492:Hydin UTSW 8 111,326,877 (GRCm39) missense possibly damaging 0.68
R9513:Hydin UTSW 8 111,322,114 (GRCm39) missense probably damaging 0.99
R9562:Hydin UTSW 8 111,312,786 (GRCm39) missense probably benign 0.11
R9664:Hydin UTSW 8 111,220,965 (GRCm39) missense probably benign 0.01
R9733:Hydin UTSW 8 111,262,011 (GRCm39) missense probably benign
R9753:Hydin UTSW 8 111,217,398 (GRCm39) missense possibly damaging 0.85
X0063:Hydin UTSW 8 111,277,951 (GRCm39) missense probably damaging 1.00
Z1088:Hydin UTSW 8 111,319,423 (GRCm39) frame shift probably null
Z1088:Hydin UTSW 8 111,312,680 (GRCm39) missense probably benign 0.00
Z1088:Hydin UTSW 8 111,026,605 (GRCm39) missense probably benign 0.12
Z1176:Hydin UTSW 8 111,268,232 (GRCm39) missense possibly damaging 0.65
Z1177:Hydin UTSW 8 111,313,774 (GRCm39) frame shift probably null
Z1177:Hydin UTSW 8 111,176,864 (GRCm39) missense possibly damaging 0.47
Z1177:Hydin UTSW 8 111,107,242 (GRCm39) missense probably damaging 1.00
Z1177:Hydin UTSW 8 111,336,621 (GRCm39) missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- CAGTTACTTGTTCCCCAGGATGC -3'
(R):5'- CCAATCGTCTGAGGGTTAAAAC -3'

Sequencing Primer
(F):5'- AGGATGCCCCCTCTTATTGTTATAAG -3'
(R):5'- CTCAGAAGCACAGGAGGTC -3'
Posted On 2021-03-08