Incidental Mutation 'Z1188:Smcr8'
ID 665994
Institutional Source Beutler Lab
Gene Symbol Smcr8
Ensembl Gene ENSMUSG00000049323
Gene Name Smith-Magenis syndrome chromosome region, candidate 8 homolog (human)
Synonyms 2310076G09Rik, D030073L15Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # Z1188 ()
Quality Score 221.999
Status Not validated
Chromosome 11
Chromosomal Location 60777524-60788287 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 60779106 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 360 (V360A)
Ref Sequence ENSEMBL: ENSMUSP00000055926 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002891] [ENSMUST00000056907] [ENSMUST00000102667] [ENSMUST00000102668] [ENSMUST00000117743] [ENSMUST00000120417] [ENSMUST00000130068]
AlphaFold Q3UMB5
Predicted Effect probably benign
Transcript: ENSMUST00000002891
SMART Domains Protein: ENSMUSP00000002891
Gene: ENSMUSG00000002814

TOPRIM 35 169 5.04e-24 SMART
TOP1Bc 172 269 4.99e-37 SMART
TOP1Ac 315 569 1.47e-107 SMART
Pfam:zf-C4_Topoisom 655 694 1.7e-15 PFAM
Pfam:zf-GRF 813 854 9.7e-23 PFAM
low complexity region 884 896 N/A INTRINSIC
Pfam:zf-GRF 897 941 7.9e-24 PFAM
ZnF_C2HC 985 1001 7.06e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000056907
AA Change: V360A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000055926
Gene: ENSMUSG00000049323
AA Change: V360A

low complexity region 13 30 N/A INTRINSIC
Pfam:Folliculin 78 262 5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102667
AA Change: V360A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099728
Gene: ENSMUSG00000049323
AA Change: V360A

low complexity region 13 30 N/A INTRINSIC
Pfam:Folliculin 87 255 8e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102668
SMART Domains Protein: ENSMUSP00000099729
Gene: ENSMUSG00000002814

TOPRIM 35 169 5.04e-24 SMART
TOP1Bc 172 269 4.99e-37 SMART
TOP1Ac 315 569 1.47e-107 SMART
Pfam:zf-C4_Topoisom 655 694 5.9e-16 PFAM
Pfam:zf-GRF 813 854 2.6e-21 PFAM
low complexity region 884 896 N/A INTRINSIC
Pfam:zf-GRF 897 941 4.2e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117743
SMART Domains Protein: ENSMUSP00000113057
Gene: ENSMUSG00000002814

TOPRIM 10 144 5.04e-24 SMART
TOP1Bc 147 244 4.99e-37 SMART
TOP1Ac 290 544 1.47e-107 SMART
Pfam:zf-C4_Topoisom 630 669 4.6e-16 PFAM
ZnF_C2HC 755 771 7.06e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120417
SMART Domains Protein: ENSMUSP00000113653
Gene: ENSMUSG00000002814

TOPRIM 10 144 5.04e-24 SMART
TOP1Bc 147 244 4.99e-37 SMART
TOP1Ac 290 544 1.47e-107 SMART
Pfam:zf-C4_Topoisom 630 666 1.9e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130068
SMART Domains Protein: ENSMUSP00000115727
Gene: ENSMUSG00000002814

PDB:4CGY|A 1 85 2e-48 PDB
SCOP:d1gkub3 5 85 7e-12 SMART
Blast:TOPRIM 10 85 7e-50 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.3%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mouse embryonic fibroblasts homozygous for a knock-out allele show impaired autophagy induction, a reduced autophagic flux, and abnormal expression of lysosomal enzymes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 413 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700086D15Rik T A 11: 65,152,968 Q89L unknown Het
1700086D15Rik A C 11: 65,152,983 V84G unknown Het
1700086D15Rik A G 11: 65,153,254 F38S unknown Het
1700086D15Rik A G 11: 65,153,288 W27R unknown Het
1700086D15Rik A G 11: 65,153,302 L22P unknown Het
1810065E05Rik C T 11: 58,422,201 L27F probably benign Het
1810065E05Rik C T 11: 58,422,234 L38F possibly damaging Het
1810065E05Rik C T 11: 58,425,799 L202F probably benign Het
2210407C18Rik G A 11: 58,608,509 P161L probably benign Het
2210407C18Rik A G 11: 58,612,561 L47P probably benign Het
2210407C18Rik T G 11: 58,612,571 S44R probably benign Het
2810021J22Rik C T 11: 58,880,535 A281V probably benign Het
4930438A08Rik A G 11: 58,294,018 T521A unknown Het
4933427D14Rik G A 11: 72,176,709 T585I possibly damaging Het
4933427D14Rik G T 11: 72,189,616 P408H probably damaging Het
4933427D14Rik AAAAGTAA AAA 11: 72,195,712 probably null Het
4933427D14Rik A G 11: 72,195,743 C281R possibly damaging Het
4933427D14Rik T G 11: 72,195,754 K277T probably damaging Het
4933427D14Rik T TCCCCAGC 11: 72,195,764 probably null Het
4933427D14Rik G A 11: 72,198,482 P192L probably benign Het
4933427D14Rik C A 11: 72,198,534 A175S probably benign Het
4933427D14Rik T G 11: 72,198,924 S45R probably damaging Het
Ablim2 G A 5: 35,837,023 D326N probably damaging Het
Akap10 T A 11: 61,915,270 S211C probably benign Het
Alox8 C T 11: 69,186,047 R536Q probably benign Het
Alox8 A G 11: 69,197,496 V76A probably benign Het
Aloxe3 A G 11: 69,128,675 Q138R probably benign Het
Aloxe3 C T 11: 69,148,603 A667V probably benign Het
Aspa G T 11: 73,322,187 L110I probably benign Het
Aurkb C T 11: 69,047,866 R44W probably damaging Het
Aurkb T C 11: 69,047,870 F45S probably benign Het
B230118H07Rik T C 2: 101,610,605 K18E probably benign Het
B9d1 A T 11: 61,505,203 probably benign Het
Baz2b T G 2: 59,977,405 N170T probably benign Het
Borcs6 G A 11: 69,060,627 R277Q possibly damaging Het
Btnl10 T C 11: 58,919,312 V93A probably benign Het
Btnl10 AAAGA AAAGAAGA 11: 58,923,927 probably benign Het
Btnl10 C T 11: 58,926,824 T250I unknown Het
Cacna1a A C 8: 84,515,054 S213R probably damaging Het
Ccdc42 C T 11: 68,587,191 probably benign Het
Ccdc92b A G 11: 74,630,054 M61V possibly damaging Het
Chd3 C A 11: 69,348,445 E1753D probably benign Het
Chd3 A G 11: 69,361,451 W42R probably benign Het
Clec3a G A 8: 114,418,119 V12M possibly damaging Het
Clec4b1 A G 6: 123,050,046 probably benign Het
Cntnap5a G A 1: 116,518,205 V1103M possibly damaging Het
Cntrob C T 11: 69,305,578 R677H probably benign Het
Cntrob G A 11: 69,308,056 P622L probably benign Het
Cyb5d1 A G 11: 69,395,202 L31P probably benign Het
Cyb5d1 C A 11: 69,395,272 A8S probably benign Het
Dmxl1 T G 18: 49,868,003 V830G probably damaging Het
Dnah9 A C 11: 66,085,174 S1350A probably benign Het
Dnah9 G A 11: 66,147,381 H110Y probably benign Het
Elac2 T C 11: 64,979,189 S27P probably benign Het
Ep400 T G 5: 110,755,683 K350T unknown Het
Epha6 C T 16: 59,654,090 R1108Q probably damaging Het
Epn2 C A 11: 61,579,634 probably benign Het
Fam114a2 A G 11: 57,484,032 S494P probably benign Het
Fam114a2 G A 11: 57,490,114 A438V probably benign Het
Fam114a2 C T 11: 57,499,755 V318I probably benign Het
Fam114a2 T C 11: 57,499,797 N304D probably benign Het
Fam114a2 C T 11: 57,514,234 G14E probably benign Het
Fam83g G A 11: 61,703,194 R518Q probably benign Het
Fat2 TGTACCTCACCCCAGTACCT TGTACCT 11: 55,308,970 probably null Het
Fat2 T G 11: 55,309,799 K816N probably benign Het
Fbxw10 G C 11: 62,847,292 R4T probably benign Het
Fbxw10 G A 11: 62,876,845 V836I probably benign Het
Fmnl2 A G 2: 53,114,871 E659G unknown Het
Foxo6 C T 4: 120,287,135 G40R possibly damaging Het
Fthl17b C A X: 8,962,574 A86S probably benign Het
Galnt10 G A 11: 57,765,688 V233I probably benign Het
Gemin5 C G 11: 58,122,289 S1446T probably benign Het
Gemin5 T C 11: 58,125,218 S1321G probably benign Het
Gemin5 T C 11: 58,130,071 M1097V probably benign Het
Gemin5 C G 11: 58,139,510 A830P probably benign Het
Gemin5 C G 11: 58,139,575 C808S probably benign Het
Gemin5 C G 11: 58,146,519 E623D probably benign Het
Ggnbp2 C T 11: 84,836,652 R481Q probably benign Het
Gjc2 T C 11: 59,176,433 S408G unknown Het
Gjc2 A G 11: 59,176,492 V388A unknown Het
Gjc2 ACCCTCCCT ACCCTCCCTCCCT 11: 59,182,735 probably benign Het
Glod4 C A 11: 76,242,993 probably null Het
Glod4 A G 11: 76,243,010 V6A probably benign Het
Glod4 T C 11: 76,243,604 K14R probably benign Het
Glod4 T C 11: 76,243,605 K14E probably benign Het
Glp2r C A 11: 67,709,568 R485L probably damaging Het
Glp2r C A 11: 67,709,644 V460F probably benign Het
Glp2r C G 11: 67,709,646 G459A probably benign Het
Glp2r C T 11: 67,740,167 V295I probably benign Het
Glp2r A G 11: 67,741,052 V283A probably benign Het
Glp2r T C 11: 67,741,059 I281V probably benign Het
Glp2r T C 11: 67,742,303 T235A probably benign Het
Glp2r A G 11: 67,744,947 V189A probably benign Het
Glp2r C A 11: 67,770,836 A13S probably benign Het
Gm12253 G C 11: 58,434,541 S13T possibly damaging Het
Gm12253 A G 11: 58,434,832 E43G probably benign Het
Gm12253 A C 11: 58,434,860 E52D probably benign Het
Gm12253 A C 11: 58,435,411 E84A probably benign Het
Gm12253 G A 11: 58,435,483 S108N probably benign Het
Gm12253 G A 11: 58,441,009 A215T possibly damaging Het
Gm12258 T G 11: 58,858,300 S100R Het
Gm12258 C T 11: 58,858,436 R146W Het
Gm12258 G A 11: 58,858,938 R313H unknown Het
Gm12258 G A 11: 58,858,950 G317E unknown Het
Gm12258 A T 11: 58,859,007 E336V unknown Het
Gm12258 A G 11: 58,859,187 probably benign Het
Gm12258 T A 11: 58,859,188 probably benign Het
Gm12258 G C 11: 58,859,864 G622R unknown Het
Gm13272 G C 4: 88,780,333 V162L probably damaging Het
Gps2 C T 11: 69,916,304 A60V probably benign Het
Gucy2e C A 11: 69,223,605 A1033S probably benign Het
Gucy2e C G 11: 69,236,603 G15R unknown Het
Guk1 G A 11: 59,191,921 probably benign Het
Haspin T C 11: 73,137,348 Q305R probably benign Het
Haspin A G 11: 73,137,951 L104P probably benign Het
Hes7 T C 11: 69,122,956 S214P probably benign Het
Hic1 G A 11: 75,167,526 T179M probably damaging Het
Hydin T G 8: 110,415,787 I766S probably benign Het
Iba57 CAGA CAGAGA 11: 59,161,503 probably null Het
Iba57 T C 11: 59,161,555 T87A unknown Het
Iba57 T C 11: 59,161,558 T86A unknown Het
Iba57 C G 11: 59,163,039 G36R unknown Het
Ighv5-8 TATATATATATATATATA TATATATATATATATATATA 12: 113,654,949 probably null Het
Igtp T G 11: 58,206,343 D113E probably damaging Het
Igtp C G 11: 58,206,965 L321V possibly damaging Het
Igtp C G 11: 58,207,118 L372V probably benign Het
Irgm2 T A 11: 58,219,513 V10D probably benign Het
Irgm2 A G 11: 58,219,563 N27D probably benign Het
Irgm2 T C 11: 58,219,912 I143T probably benign Het
Irgm2 T C 11: 58,219,954 L157S probably benign Het
Irgm2 G A 11: 58,220,007 V175I probably benign Het
Irgm2 G A 11: 58,220,098 S205N probably benign Het
Irgm2 A C 11: 58,220,125 H214P probably benign Het
Irgm2 G T 11: 58,220,412 A310S possibly damaging Het
Irgm2 C G 11: 58,220,563 T360S probably benign Het
Itgae T A 11: 73,103,887 L22M possibly damaging Het
Itgae A T 11: 73,103,960 Q46L probably damaging Het
Itgae A G 11: 73,115,640 H378R probably benign Het
Itgae G A 11: 73,118,087 V465I probably benign Het
Itgae A T 11: 73,121,931 K696N probably benign Het
Itgae G T 11: 73,121,957 G705V probably benign Het
Itgae C G 11: 73,134,127 S1028W probably benign Het
Kif1c C T 11: 70,724,114 P578L probably benign Het
Kmt2d T C 15: 98,851,744 N2656D unknown Het
Larp1 G A 11: 58,042,340 V257I probably benign Het
Lrp1b A T 2: 40,750,934 N3499K Het
Lypd8 T C 11: 58,382,775 Y27H probably benign Het
Lypd8 C A 11: 58,384,649 A70E possibly damaging Het
Lypd8 G A 11: 58,384,663 E75K probably benign Het
Mapk7 CGCTGGTGCTGG CGCTGGTGCTGGTGCTGG 11: 61,490,212 probably benign Het
Mapk7 CAGG CAGGGGAAGG 11: 61,490,244 probably benign Het
Mfap3 A T 11: 57,528,040 I9F possibly damaging Het
Mfap3 G A 11: 57,528,076 G21S probably benign Het
Mrm3 G A 11: 76,244,077 R102K probably benign Het
Mrm3 C T 11: 76,247,395 P203L probably benign Het
Mroh2a G T 1: 88,235,216 Q360H probably benign Het
Mrpl22 G A 11: 58,171,695 A4T unknown Het
Mrpl55 A G 11: 59,204,173 probably null Het
Mrpl55 A T 11: 59,204,589 L26F probably benign Het
Myh1 A C 11: 67,204,446 T211P probably benign Het
Myh2 T C 11: 67,188,813 I1032T probably benign Het
Myh8 A C 11: 67,297,486 N991T probably benign Het
Myocd A G 11: 65,184,592 S697P probably benign Het
Nlgn2 A G 11: 69,828,394 V210A possibly damaging Het
Nlrp1a T C 11: 71,092,243 K1299R probably benign Het
Nlrp1a C T 11: 71,097,251 R1131Q probably damaging Het
Nlrp1a T C 11: 71,099,616 I1038V probably benign Het
Nlrp1a T C 11: 71,124,088 E112G probably benign Het
Nlrp1a C G 11: 71,142,529 probably null Het
Nlrp1b C A 11: 71,181,708 M436I probably benign Het
Nlrp1b A C 11: 71,181,713 S435A probably benign Het
Nlrp1b A G 11: 71,181,799 I406T probably benign Het
Nlrp1b G C 11: 71,182,309 T236R probably benign Het
Nlrp1b A G 11: 71,182,322 Y232H probably benign Het
Nlrp1b A T 11: 71,182,440 D192E probably benign Het
Nlrp1b T C 11: 71,182,454 T188A probably benign Het
Nlrp1b C G 11: 71,182,544 E158Q probably benign Het
Nlrp1b A T 11: 71,182,552 M155K probably benign Het
Nlrp1b T A 11: 71,182,570 Q149L probably benign Het
Nlrp1b T C 11: 71,182,677 I113M probably benign Het
Nmur2 T C 11: 56,040,278 I202M probably benign Het
Obscn G A 11: 59,000,889 A6939V probably benign Het
Obscn C G 11: 59,009,193 G938A probably benign Het
Obscn G C 11: 59,013,188 T7320S probably benign Het
Obscn C T 11: 59,031,108 R5954Q probably damaging Het
Obscn G C 11: 59,039,150 P5080A probably benign Het
Obscn T A 11: 59,039,164 Q5075L probably damaging Het
Obscn T C 11: 59,041,775 I4869V probably benign Het
Obscn T C 11: 59,042,950 T5363A probably benign Het
Obscn G A 11: 59,043,027 A5337V probably benign Het
Obscn G A 11: 59,043,052 R5329C probably benign Het
Obscn C T 11: 59,049,480 D5354N Het
Obscn C A 11: 59,049,788 R4593S possibly damaging Het
Obscn T C 11: 59,049,797 T5307A Het
Obscn G A 11: 59,051,557 T4372M probably benign Het
Obscn T C 11: 59,052,613 M4237V probably benign Het
Obscn C T 11: 59,053,768 R4700Q probably benign Het
Obscn T C 11: 59,053,825 K4681R probably benign Het
Obscn T C 11: 59,054,218 E4658G probably benign Het
Obscn C T 11: 59,054,350 R4614Q probably benign Het
Obscn T C 11: 59,054,834 T4184A probably benign Het
Obscn C T 11: 59,055,457 R4474H probably damaging Het
Obscn T C 11: 59,055,505 D4458G probably damaging Het
Obscn C T 11: 59,055,514 R4455K probably benign Het
Obscn G T 11: 59,056,110 A4066E possibly damaging Het
Obscn A G 11: 59,056,769 M4478T Het
Obscn C A 11: 59,060,997 G3977W probably damaging Het
Obscn C T 11: 59,061,562 G3894R probably benign Het
Obscn C T 11: 59,061,582 R3887K probably benign Het
Obscn G C 11: 59,062,133 P4115A probably benign Het
Obscn C T 11: 59,062,139 D4113N probably damaging Het
Obscn CCACACACACACAC CCACACACACAC 11: 59,063,453 probably null Het
Obscn T C 11: 59,063,474 T4037A Het
Obscn T C 11: 59,063,576 K3727E probably damaging Het
Obscn G A 11: 59,067,147 R3576C probably benign Het
Obscn C T 11: 59,067,829 V3433I probably benign Het
Obscn C A 11: 59,069,931 A3185S probably benign Het
Obscn C T 11: 59,076,508 V2792I possibly damaging Het
Obscn G A 11: 59,079,158 R53C probably damaging Het
Obscn C G 11: 59,079,896 V2328L probably benign Het
Obscn C A 11: 59,081,872 G2116V possibly damaging Het
Obscn C T 11: 59,086,679 R1865H probably benign Het
Obscn T C 11: 59,086,701 R1858G probably benign Het
Obscn A G 11: 59,086,739 V1845A probably benign Het
Obscn T C 11: 59,090,747 H1815R probably benign Het
Obscn A G 11: 59,093,316 F1771S probably benign Het
Obscn C T 11: 59,093,413 V1739M possibly damaging Het
Obscn G T 11: 59,093,508 A1707D possibly damaging Het
Obscn C T 11: 59,093,509 A1707T probably benign Het
Obscn G A 11: 59,093,559 A1690V probably benign Het
Obscn C T 11: 59,099,909 A1613T possibly damaging Het
Obscn T C 11: 59,099,929 H1606R probably benign Het
Obscn C G 11: 59,103,341 A1572P probably damaging Het
Obscn T C 11: 59,103,514 H1514R probably benign Het
Obscn G A 11: 59,103,538 A1506V probably benign Het
Obscn T C 11: 59,112,554 E1306G probably benign Het
Obscn T C 11: 59,112,636 M1279V probably benign Het
Obscn T C 11: 59,122,737 M1095V probably benign Het
Obscn C T 11: 59,128,066 A949T probably benign Het
Obscn C T 11: 59,128,069 V973M probably damaging Het
Obscn T C 11: 59,129,687 M844V probably benign Het
Obscn G T 11: 59,129,837 L794M probably benign Het
Obscn C T 11: 59,130,623 R797H probably damaging Het
Obscn C T 11: 59,133,111 A578T possibly damaging Het
Obscn G A 11: 59,133,240 P535S probably damaging Het
Obscn C G 11: 59,133,246 A533P probably benign Het
Obscn T C 11: 59,135,679 I233V probably benign Het
Olfr224 G A 11: 58,566,562 A261V probably benign Het
Olfr224 A T 11: 58,566,695 S217T probably benign Het
Olfr224 C T 11: 58,567,094 V84I probably benign Het
Olfr311 G C 11: 58,841,081 probably benign Het
Olfr311 G T 11: 58,841,119 A2S probably benign Het
Olfr311 C T 11: 58,841,206 L31F probably benign Het
Olfr311 T C 11: 58,841,258 I48T probably benign Het
Olfr311 G A 11: 58,841,743 A210T probably benign Het
Olfr311 A G 11: 58,841,789 H225R probably benign Het
Olfr313 A G 11: 58,817,061 I18V probably benign Het
Olfr313 T C 11: 58,817,296 V96A probably benign Het
Olfr313 A C 11: 58,817,394 I129L probably benign Het
Olfr313 C G 11: 58,817,417 H136Q probably benign Het
Olfr313 T C 11: 58,817,682 C225R probably benign Het
Olfr313 C G 11: 58,817,818 P270R probably benign Het
Olfr314 A G 11: 58,786,947 T238A probably damaging Het
Olfr316 G A 11: 58,757,967 A101T probably benign Het
Olfr316 C T 11: 58,758,069 L135F probably benign Het
Olfr316 A G 11: 58,758,105 S147G probably benign Het
Olfr316 G A 11: 58,758,327 V221M probably damaging Het
Olfr316 A C,T 11: 58,758,342 I226L probably benign Het
Olfr316 A C 11: 58,758,360 K232Q probably benign Het
Olfr317 T G 11: 58,732,374 N264H probably benign Het
Olfr317 G A 11: 58,732,469 A232V probably benign Het
Olfr317 T C 11: 58,732,649 H172R probably benign Het
Olfr317 C A 11: 58,733,222 probably benign Het
Olfr318 G A 11: 58,721,096 probably benign Het
Olfr319 A C 11: 58,701,958 I86L probably benign Het
Olfr319 C T 11: 58,702,327 L209F possibly damaging Het
Olfr319 C A 11: 58,702,396 Q232K probably benign Het
Olfr320 G T 11: 58,683,932 D20Y probably benign Het
Olfr320 T C 11: 58,683,989 F39L probably benign Het
Olfr320 G A 11: 58,684,115 V81M probably benign Het
Olfr320 G A 11: 58,684,257 R128Q probably benign Het
Olfr320 C T 11: 58,684,463 H197Y probably benign Het
Olfr320 G A 11: 58,684,715 V281I probably benign Het
Olfr320 T C 11: 58,684,722 L283P probably benign Het
Olfr322 T G 11: 58,666,516 I319R probably benign Het
Olfr323 G A 11: 58,625,249 S79F probably benign Het
Olfr323 C G 11: 58,625,304 G61R probably benign Het
Olfr323 G A 11: 58,625,762 P95S probably benign Het
Olfr323 T G 11: 58,625,793 K84N probably benign Het
Olfr323 A C 11: 58,625,906 C46G possibly damaging Het
Olfr324 A C 11: 58,597,518 I35L probably benign Het
Olfr324 A G 11: 58,597,530 I39V probably benign Het
Olfr324 A G 11: 58,597,665 S84G possibly damaging Het
Olfr324 A G 11: 58,597,950 S179G probably benign Het
Olfr325 C T 11: 58,580,924 H27Y probably benign Het
Olfr325 T C 11: 58,580,931 V29A probably benign Het
Olfr325 G A 11: 58,581,002 V53I probably benign Het
Olfr325 T G 11: 58,581,296 L151V probably benign Het
Olfr325 G C 11: 58,581,657 S271T probably benign Het
Olfr328 T C 11: 58,551,561 K226R probably benign Het
Olfr328 C T 11: 58,551,975 S88N probably benign Het
Olfr328 C T 11: 58,552,114 A42T probably benign Het
Olfr329-ps G T 11: 58,543,446 S23Y probably benign Het
Olfr331 T C 11: 58,501,648 M309V probably benign Het
Olfr331 T C 11: 58,502,101 I158V probably benign Het
Olfr331 C A 11: 58,502,110 V155F probably benign Het
Olfr331 GGTGGATTGGTATGTGGAT GGTGGAT 11: 58,502,386 probably benign Het
Olfr331 C G 11: 58,502,461 V38L probably benign Het
Olfr331 C T 11: 58,502,570 M1I probably null Het
Olfr332 C A 11: 58,489,748 E336* probably null Het
Olfr332 C T 11: 58,490,297 A153T probably benign Het
Olfr332 T C 11: 58,490,488 Q89R probably benign Het
Ovca2 T C 11: 75,178,702 T32A probably benign Het
Pgbd5 G A 8: 124,380,216 R196C probably damaging Het
Pimreg TCACA TCA 11: 72,044,975 probably benign Het
Pimreg G A 11: 72,045,153 R154H probably damaging Het
Pitpnm3 T C 11: 72,064,129 K520E probably benign Het
Pitpnm3 C T 11: 72,120,143 R21Q probably benign Het
Prpsap2 A C 11: 61,756,252 V21G possibly damaging Het
Rabep1 C CT 11: 70,940,084 probably null Het
Rai1 A G 11: 60,187,563 N818D probably benign Het
Rap1gap2 C T 11: 74,596,895 E52K probably benign Het
Rc3h2 T C 2: 37,399,600 H400R possibly damaging Het
Rnf112 A G 11: 61,450,949 L343P unknown Het
Rnf167 C CACAGGGA 11: 70,650,820 probably null Het
Rpl26 A G 11: 68,903,243 Y78C probably benign Het
Rtn4rl1 C T 11: 75,266,037 P432S probably benign Het
Shisa6 GCCGCC GCCGCCTCCGCC 11: 66,525,693 probably benign Het
Slc10a2 G A 8: 5,105,063 L41F probably damaging Het
Slc11a2 A G 15: 100,408,099 probably null Het
Slc15a5 G T 6: 138,017,958 L122M Het
Slc2a4 GGCCG GG 11: 69,943,992 probably benign Het
Slc2a4 GCC G 11: 69,943,993 probably null Het
Slc6a4 G A 11: 77,010,556 G39E probably benign Het
Slc6a4 A G 11: 77,013,032 K152R probably benign Het
Smg6 G T 11: 75,156,266 A1262S probably benign Het
Spns3 T C 11: 72,550,037 I58V probably benign Het
Spns3 G A 11: 72,550,091 P40S probably benign Het
Spns3 T C 11: 72,550,160 S17G probably benign Het
Srebf1 C T 11: 60,206,235 V256M probably benign Het
Tbc1d32 G T 10: 56,170,881 L564M probably damaging Het
Tekt1 T C 11: 72,359,771 Q33R probably benign Het
Timm22 T G 11: 76,407,117 V18G probably benign Het
Tmc3 T A 7: 83,612,478 L588H probably damaging Het
Tmem102 C G 11: 69,805,076 G53A possibly damaging Het
Tmem102 G C 11: 69,805,101 R45G probably benign Het
Tmem11 A G 11: 60,875,832 probably benign Het
Tom1l2 C T 11: 60,241,856 A414T probably benign Het
Top3a C T 11: 60,750,584 G425S probably benign Het
Trim16 C T 11: 62,820,602 A33V probably benign Het
Trim16 G C 11: 62,820,676 V58L probably benign Het
Trim16 TGAAGA TGAAGAAGA 11: 62,820,690 probably benign Het
Trim16 A AAGC 11: 62,820,695 probably benign Het
Trim16 G A 11: 62,836,817 E322K probably benign Het
Trim16 T C 11: 62,840,746 V481A probably benign Het
Trim16 C A 11: 62,840,849 D515E probably benign Het
Trim17 G A 11: 58,965,505 M129I probably benign Het
Trim17 A G 11: 58,970,446 N259S probably benign Het
Trim58 C A 11: 58,640,858 L131M possibly damaging Het
Trim58 A G 11: 58,651,660 N482S probably benign Het
Trpv1 C G 11: 73,240,601 P322A possibly damaging Het
Trpv1 C A 11: 73,254,291 D734E probably benign Het
Trpv3 C T 11: 73,269,687 A9V probably benign Het
Trpv3 G A 11: 73,278,977 A125T probably benign Het
Trpv3 A G 11: 73,283,676 T290A probably benign Het
Tvp23b A C 11: 62,881,943 N7H possibly damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Uqcrc2 A C 7: 120,640,293 K109N probably benign Het
Usp43 AGGGC AGGGCAGGGGATGAACCTCGGGC 11: 67,855,719 probably benign Het
Usp43 C T 11: 67,856,506 G792S probably benign Het
Vamp2 C T 11: 69,088,585 probably benign Het
Vamp2 G A 11: 69,090,063 G124R possibly damaging Het
Vat1l A C 8: 114,205,723 K3T probably damaging Het
Vmn2r120 A T 17: 57,522,436 V487E probably damaging Het
Xaf1 G A 11: 72,306,600 R134H probably benign Het
Xaf1 G C 11: 72,306,603 C135S probably damaging Het
Xaf1 C A 11: 72,306,608 L137I probably benign Het
Xaf1 A G 11: 72,308,650 E71G probably benign Het
Xaf1 T G 11: 72,308,966 C176W unknown Het
Xaf1 GGCT GGCTGGCCAGCT 11: 72,309,020 probably null Het
Xaf1 G C 11: 72,309,030 V198L unknown Het
Xaf1 T C 11: 72,309,055 L206S unknown Het
Zar1l C A 5: 150,507,193 R251I possibly damaging Het
Zfp286 G A 11: 62,784,956 T60M probably damaging Het
Zfp286 A G 11: 62,787,969 V44A probably benign Het
Zfp287 C T 11: 62,713,807 R758H probably benign Het
Zfp287 C G 11: 62,715,349 C244S probably benign Het
Zfp287 G A 11: 62,722,931 R225* probably null Het
Zfp39 G C 11: 58,890,045 Y630* probably null Het
Zfp39 A C 11: 58,890,047 Y630D probably benign Het
Zfp39 G C 11: 58,890,304 T544R possibly damaging Het
Zfp39 G C 11: 58,890,447 D496E probably benign Het
Zfp39 T C 11: 58,890,448 D496G possibly damaging Het
Zfp39 T C 11: 58,890,700 N412S possibly damaging Het
Zfp39 G T 11: 58,890,771 N388K probably benign Het
Zfp39 A G 11: 58,890,779 S386P probably benign Het
Zfp39 A C 11: 58,890,876 H353Q probably damaging Het
Zfp39 A C 11: 58,890,886 V350G probably benign Het
Zfp39 A G 11: 58,890,898 V346A probably benign Het
Zfp39 T A 11: 58,890,925 K337M probably benign Het
Zfp39 T A 11: 58,891,141 H265L probably damaging Het
Zfp39 A G 11: 58,891,297 I213T probably benign Het
Zfp39 T C 11: 58,891,316 K207E probably benign Het
Zfp39 G T 11: 58,900,581 S93R probably benign Het
Zfp39 T G 11: 58,900,583 S93R probably benign Het
Zfp672 G T 11: 58,329,626 T49K unknown Het
Zfp692 G T 11: 58,309,033 E149D probably benign Het
Zfp692 G A 11: 58,310,018 V242I probably benign Het
Zzef1 G A 11: 72,889,182 R1927H probably benign Het
Other mutations in Smcr8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Smcr8 APN 11 60778632 splice site probably null
IGL00514:Smcr8 APN 11 60778367 nonsense probably null
IGL01563:Smcr8 APN 11 60783845 missense possibly damaging 0.55
IGL01650:Smcr8 APN 11 60778184 missense probably damaging 1.00
IGL02390:Smcr8 APN 11 60779722 missense probably benign 0.03
IGL02582:Smcr8 APN 11 60778895 missense probably benign 0.00
IGL03008:Smcr8 APN 11 60778461 missense probably damaging 1.00
IGL03286:Smcr8 APN 11 60778027 unclassified probably benign
chauvenist UTSW 11 60778598 missense probably damaging 1.00
liberta UTSW 11 60778443 missense probably damaging 1.00
patriot UTSW 11 60778032 missense probably damaging 1.00
patriot2 UTSW 11 60778028 start codon destroyed probably null 1.00
patriot3 UTSW 11 60779870 nonsense probably null
R0022:Smcr8 UTSW 11 60780359 missense probably damaging 1.00
R0022:Smcr8 UTSW 11 60780359 missense probably damaging 1.00
R0197:Smcr8 UTSW 11 60778115 missense probably damaging 1.00
R0333:Smcr8 UTSW 11 60780222 missense possibly damaging 0.96
R0346:Smcr8 UTSW 11 60779750 missense probably benign 0.00
R0701:Smcr8 UTSW 11 60778115 missense probably damaging 1.00
R0720:Smcr8 UTSW 11 60778443 missense probably damaging 1.00
R0883:Smcr8 UTSW 11 60778115 missense probably damaging 1.00
R1178:Smcr8 UTSW 11 60779532 missense probably damaging 1.00
R1418:Smcr8 UTSW 11 60778032 missense probably damaging 1.00
R2012:Smcr8 UTSW 11 60778184 missense probably damaging 1.00
R3690:Smcr8 UTSW 11 60778028 start codon destroyed probably null 1.00
R3767:Smcr8 UTSW 11 60779504 missense probably benign 0.30
R4801:Smcr8 UTSW 11 60778610 splice site probably null
R4802:Smcr8 UTSW 11 60778610 splice site probably null
R4862:Smcr8 UTSW 11 60778071 missense probably benign 0.01
R5108:Smcr8 UTSW 11 60779870 nonsense probably null
R5361:Smcr8 UTSW 11 60778292 missense probably damaging 1.00
R5745:Smcr8 UTSW 11 60784151 missense probably benign 0.00
R5806:Smcr8 UTSW 11 60780382 critical splice donor site probably null
R6041:Smcr8 UTSW 11 60779568 missense probably damaging 1.00
R6277:Smcr8 UTSW 11 60778809 missense probably benign 0.07
R6289:Smcr8 UTSW 11 60778598 missense probably damaging 1.00
R6445:Smcr8 UTSW 11 60779015 missense possibly damaging 0.95
R6826:Smcr8 UTSW 11 60778862 missense possibly damaging 0.85
R7062:Smcr8 UTSW 11 60780354 missense probably damaging 1.00
R7176:Smcr8 UTSW 11 60778946 missense probably damaging 1.00
R7516:Smcr8 UTSW 11 60779988 missense probably benign 0.01
R7848:Smcr8 UTSW 11 60779924 missense probably benign
R8487:Smcr8 UTSW 11 60783996 missense probably damaging 0.98
R8552:Smcr8 UTSW 11 60780153 missense probably damaging 1.00
R8717:Smcr8 UTSW 11 60779428 missense probably damaging 1.00
R9204:Smcr8 UTSW 11 60778031 missense probably damaging 1.00
R9218:Smcr8 UTSW 11 60779879 missense probably benign
Z1186:Smcr8 UTSW 11 60777980 unclassified probably benign
Z1186:Smcr8 UTSW 11 60779106 missense probably benign
Z1186:Smcr8 UTSW 11 60779873 missense probably benign
Z1187:Smcr8 UTSW 11 60777980 unclassified probably benign
Z1187:Smcr8 UTSW 11 60779106 missense probably benign
Z1187:Smcr8 UTSW 11 60779873 missense probably benign
Z1188:Smcr8 UTSW 11 60777980 unclassified probably benign
Z1188:Smcr8 UTSW 11 60779873 missense probably benign
Z1189:Smcr8 UTSW 11 60777980 unclassified probably benign
Z1189:Smcr8 UTSW 11 60779106 missense probably benign
Z1189:Smcr8 UTSW 11 60779873 missense probably benign
Z1190:Smcr8 UTSW 11 60777980 unclassified probably benign
Z1190:Smcr8 UTSW 11 60779106 missense probably benign
Z1190:Smcr8 UTSW 11 60779873 missense probably benign
Z1191:Smcr8 UTSW 11 60777980 unclassified probably benign
Z1191:Smcr8 UTSW 11 60779106 missense probably benign
Z1191:Smcr8 UTSW 11 60779873 missense probably benign
Z1192:Smcr8 UTSW 11 60777980 unclassified probably benign
Z1192:Smcr8 UTSW 11 60779106 missense probably benign
Z1192:Smcr8 UTSW 11 60779873 missense probably benign
Predicted Primers
Posted On 2021-03-08