Incidental Mutation 'Z1189:Dmxl1'
ID 666534
Institutional Source Beutler Lab
Gene Symbol Dmxl1
Ensembl Gene ENSMUSG00000037416
Gene Name Dmx-like 1
Synonyms C630007L23Rik
Accession Numbers
Essential gene? Probably essential (E-score: 0.956) question?
Stock # Z1189 ()
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 49965737-50098540 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 50001070 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 830 (V830G)
Ref Sequence ENSEMBL: ENSMUSP00000137871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041772] [ENSMUST00000180611]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000041772
AA Change: V830G

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000045559
Gene: ENSMUSG00000037416
AA Change: V830G

DomainStartEndE-ValueType
WD40 100 136 8.22e1 SMART
WD40 156 195 2.88e-1 SMART
WD40 218 266 8.29e-1 SMART
low complexity region 367 378 N/A INTRINSIC
WD40 464 505 1.53e2 SMART
Blast:WD40 719 772 1e-25 BLAST
WD40 957 999 1.1e1 SMART
Pfam:Rav1p_C 1102 1877 4.3e-84 PFAM
low complexity region 1922 1942 N/A INTRINSIC
low complexity region 1966 1975 N/A INTRINSIC
low complexity region 1993 2007 N/A INTRINSIC
low complexity region 2147 2158 N/A INTRINSIC
low complexity region 2371 2385 N/A INTRINSIC
low complexity region 2397 2410 N/A INTRINSIC
low complexity region 2449 2466 N/A INTRINSIC
WD40 2735 2770 1.07e1 SMART
WD40 2773 2813 3.7e0 SMART
WD40 2825 2867 1.07e0 SMART
WD40 2873 2912 1.05e-2 SMART
WD40 2915 2954 4.51e-7 SMART
Blast:WD40 2957 3005 9e-26 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000180611
AA Change: V830G

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000137871
Gene: ENSMUSG00000037416
AA Change: V830G

DomainStartEndE-ValueType
WD40 100 136 8.22e1 SMART
WD40 156 195 2.88e-1 SMART
WD40 218 266 8.29e-1 SMART
low complexity region 367 378 N/A INTRINSIC
WD40 464 505 1.53e2 SMART
Blast:WD40 719 772 1e-25 BLAST
WD40 957 999 1.1e1 SMART
low complexity region 1195 1206 N/A INTRINSIC
low complexity region 1258 1271 N/A INTRINSIC
Pfam:Rav1p_C 1287 1876 9.4e-72 PFAM
low complexity region 1922 1942 N/A INTRINSIC
low complexity region 1966 1975 N/A INTRINSIC
low complexity region 1993 2007 N/A INTRINSIC
low complexity region 2147 2158 N/A INTRINSIC
low complexity region 2385 2398 N/A INTRINSIC
low complexity region 2437 2454 N/A INTRINSIC
WD40 2723 2758 1.07e1 SMART
WD40 2761 2801 3.7e0 SMART
WD40 2813 2855 1.07e0 SMART
WD40 2861 2900 1.05e-2 SMART
WD40 2903 2942 4.51e-7 SMART
Blast:WD40 2945 2993 9e-26 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the WD repeat superfamily of proteins, which have regulatory functions. This gene is expressed in many tissue types including several types of eye tissue, and it has been associated with ocular phenotypes. In addition, it is upregulated in cultured cells that overexpress growth factor independence 1B, a transcription factor that is essential for hematopoietic cell development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 379 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700086D15Rik A G 11: 65,044,114 (GRCm39) W27R unknown Het
1700086D15Rik A G 11: 65,044,080 (GRCm39) F38S unknown Het
1700086D15Rik A C 11: 65,043,809 (GRCm39) V84G unknown Het
1700086D15Rik T A 11: 65,043,794 (GRCm39) Q89L unknown Het
1700086D15Rik A G 11: 65,044,128 (GRCm39) L22P unknown Het
1810065E05Rik C T 11: 58,313,027 (GRCm39) L27F probably benign Het
1810065E05Rik C T 11: 58,316,625 (GRCm39) L202F probably benign Het
1810065E05Rik C T 11: 58,313,060 (GRCm39) L38F possibly damaging Het
2810021J22Rik C T 11: 58,771,361 (GRCm39) A281V probably benign Het
4930438A08Rik A G 11: 58,184,844 (GRCm39) T521A unknown Het
4933427D14Rik G A 11: 72,067,535 (GRCm39) T585I possibly damaging Het
4933427D14Rik T G 11: 72,089,750 (GRCm39) S45R probably damaging Het
4933427D14Rik C A 11: 72,089,360 (GRCm39) A175S probably benign Het
4933427D14Rik G A 11: 72,089,308 (GRCm39) P192L probably benign Het
4933427D14Rik T C 11: 72,086,595 (GRCm39) Q272R probably damaging Het
4933427D14Rik T TCCCCAGC 11: 72,086,590 (GRCm39) probably null Het
4933427D14Rik T G 11: 72,086,580 (GRCm39) K277T probably damaging Het
4933427D14Rik A G 11: 72,086,569 (GRCm39) C281R possibly damaging Het
4933427D14Rik AAAAGTAA AAA 11: 72,086,538 (GRCm39) probably null Het
4933427D14Rik G T 11: 72,080,442 (GRCm39) P408H probably damaging Het
Abca4 G T 3: 121,877,642 (GRCm39) V334L possibly damaging Het
Akap10 T A 11: 61,806,096 (GRCm39) S211C probably benign Het
Alox8 C T 11: 69,076,873 (GRCm39) R536Q probably benign Het
Alox8 A G 11: 69,088,322 (GRCm39) V76A probably benign Het
Aloxe3 A G 11: 69,019,501 (GRCm39) Q138R probably benign Het
Aloxe3 C T 11: 69,039,429 (GRCm39) A667V probably benign Het
Arhgap30 C A 1: 171,235,938 (GRCm39) L771M possibly damaging Het
Aspa G T 11: 73,213,013 (GRCm39) L110I probably benign Het
Atp6v1g3 A G 1: 138,201,582 (GRCm39) K27E possibly damaging Het
Aurkb C T 11: 68,938,692 (GRCm39) R44W probably damaging Het
Aurkb T C 11: 68,938,696 (GRCm39) F45S probably benign Het
B9d1 A T 11: 61,396,029 (GRCm39) probably benign Het
BC034090 A G 1: 155,117,245 (GRCm39) I291T probably benign Het
Borcs6 G A 11: 68,951,453 (GRCm39) R277Q possibly damaging Het
Btbd3 ATCGGGGTCG ATCG 2: 138,126,010 (GRCm39) probably benign Het
Btnl10 C T 11: 58,817,650 (GRCm39) T250I unknown Het
Btnl10 T C 11: 58,810,138 (GRCm39) V93A probably benign Het
Btnl10 AAAGA AAAGAAGA 11: 58,814,753 (GRCm39) probably benign Het
Ccdc42 C T 11: 68,478,017 (GRCm39) probably benign Het
Ccdc92b A G 11: 74,520,880 (GRCm39) M61V possibly damaging Het
Cdh18 A T 15: 23,474,369 (GRCm39) E746D probably benign Het
Chd3 C A 11: 69,239,271 (GRCm39) E1753D probably benign Het
Chd3 A G 11: 69,252,277 (GRCm39) W42R probably benign Het
Cluh CGAGCCTGAGCCTGAGCC CGAGCCTGAGCCTGAGCCTGAGCC 11: 74,560,343 (GRCm39) probably benign Het
Cluh CCC CCCGAGCC 11: 74,560,340 (GRCm39) probably null Het
Cluh AGCC AGCCTGCGCC 11: 74,560,357 (GRCm39) probably benign Het
Cluh GAGCC GAGCCTTAGCC 11: 74,560,356 (GRCm39) probably null Het
Cluh TGAGCCAGAG TGAGCCAGAGCCAGAG 11: 74,560,355 (GRCm39) probably benign Het
Cluh TGAGCC TGAGCCCGAGCC 11: 74,560,349 (GRCm39) probably benign Het
Cluh AGC AGCATGTGC 11: 74,560,345 (GRCm39) probably benign Het
Cnot9 T A 1: 74,556,285 (GRCm39) N27K probably benign Het
Cntrob G A 11: 69,198,882 (GRCm39) P622L probably benign Het
Cntrob C T 11: 69,196,404 (GRCm39) R677H probably benign Het
Cyb5d1 C A 11: 69,286,098 (GRCm39) A8S probably benign Het
Cyb5d1 A G 11: 69,286,028 (GRCm39) L31P probably benign Het
D5Ertd579e G A 5: 36,772,250 (GRCm39) P715L probably damaging Het
Dnah9 G A 11: 66,038,207 (GRCm39) H110Y probably benign Het
Dnah9 A C 11: 65,976,000 (GRCm39) S1350A probably benign Het
Dnttip2 G C 3: 122,070,305 (GRCm39) E507Q probably damaging Het
Dpysl4 A G 7: 138,669,324 (GRCm39) M1V probably null Het
Elac2 T C 11: 64,870,015 (GRCm39) S27P probably benign Het
Epha6 C T 16: 59,474,453 (GRCm39) R1108Q probably damaging Het
Epn2 C A 11: 61,470,460 (GRCm39) probably benign Het
Fam114a2 G A 11: 57,380,940 (GRCm39) A438V probably benign Het
Fam114a2 A G 11: 57,374,858 (GRCm39) S494P probably benign Het
Fam114a2 C T 11: 57,405,060 (GRCm39) G14E probably benign Het
Fam114a2 T C 11: 57,390,623 (GRCm39) N304D probably benign Het
Fam114a2 C T 11: 57,390,581 (GRCm39) V318I probably benign Het
Fam83g G A 11: 61,594,020 (GRCm39) R518Q probably benign Het
Fat2 T G 11: 55,200,625 (GRCm39) K816N probably benign Het
Fat2 TGTACCTCACCCCAGTACCT TGTACCT 11: 55,199,796 (GRCm39) probably null Het
Fbxw10 G A 11: 62,767,671 (GRCm39) V836I probably benign Het
Fbxw10 G C 11: 62,738,118 (GRCm39) R4T probably benign Het
Galnt10 G A 11: 57,656,514 (GRCm39) V233I probably benign Het
Gemin5 T C 11: 58,016,044 (GRCm39) S1321G probably benign Het
Gemin5 C G 11: 58,013,115 (GRCm39) S1446T probably benign Het
Gemin5 C G 11: 58,037,345 (GRCm39) E623D probably benign Het
Gemin5 C G 11: 58,030,401 (GRCm39) C808S probably benign Het
Gemin5 C G 11: 58,030,336 (GRCm39) A830P probably benign Het
Gemin5 T C 11: 58,020,897 (GRCm39) M1097V probably benign Het
Ggnbp2 C T 11: 84,727,478 (GRCm39) R481Q probably benign Het
Gjc2 A G 11: 59,067,318 (GRCm39) V388A unknown Het
Gjc2 ACCCTCCCT ACCCTCCCTCCCT 11: 59,073,561 (GRCm39) probably benign Het
Glod4 C A 11: 76,133,819 (GRCm39) probably null Het
Glod4 T C 11: 76,134,431 (GRCm39) K14E probably benign Het
Glod4 T C 11: 76,134,430 (GRCm39) K14R probably benign Het
Glod4 A G 11: 76,133,836 (GRCm39) V6A probably benign Het
Glp2r A G 11: 67,635,773 (GRCm39) V189A probably benign Het
Glp2r C A 11: 67,661,662 (GRCm39) A13S probably benign Het
Glp2r C A 11: 67,600,394 (GRCm39) R485L probably damaging Het
Glp2r T C 11: 67,631,885 (GRCm39) I281V probably benign Het
Gm12253 A C 11: 58,325,686 (GRCm39) E52D probably benign Het
Gm12253 A C 11: 58,326,237 (GRCm39) E84A probably benign Het
Gm12253 G A 11: 58,326,309 (GRCm39) S108N probably benign Het
Gm12253 G A 11: 58,331,835 (GRCm39) A215T possibly damaging Het
Gm12253 G C 11: 58,325,367 (GRCm39) S13T possibly damaging Het
Gm12253 A G 11: 58,325,658 (GRCm39) E43G probably benign Het
Gm12258 G A 11: 58,749,764 (GRCm39) R313H unknown Het
Gm12258 G A 11: 58,749,776 (GRCm39) G317E unknown Het
Gm12258 A T 11: 58,749,833 (GRCm39) E336V unknown Het
Gm12258 A G 11: 58,750,013 (GRCm39) probably benign Het
Gm12258 T A 11: 58,750,014 (GRCm39) probably benign Het
Gm12258 G C 11: 58,750,690 (GRCm39) G622R unknown Het
Gm12258 T G 11: 58,749,126 (GRCm39) S100R Het
Gm12258 C T 11: 58,749,262 (GRCm39) R146W Het
Gps2 C T 11: 69,807,130 (GRCm39) A60V probably benign Het
Gucy2e C A 11: 69,114,431 (GRCm39) A1033S probably benign Het
Gucy2e C G 11: 69,127,429 (GRCm39) G15R unknown Het
Haspin A G 11: 73,028,777 (GRCm39) L104P probably benign Het
Haspin T C 11: 73,028,174 (GRCm39) Q305R probably benign Het
Hes7 T C 11: 69,013,782 (GRCm39) S214P probably benign Het
Hic1 G A 11: 75,058,352 (GRCm39) T179M probably damaging Het
Htr5a T C 5: 28,056,032 (GRCm39) F341S probably damaging Het
Iba57 CAGA CAGAGA 11: 59,052,329 (GRCm39) probably null Het
Iba57 C G 11: 59,053,865 (GRCm39) G36R unknown Het
Iba57 T C 11: 59,052,384 (GRCm39) T86A unknown Het
Iba57 T C 11: 59,052,381 (GRCm39) T87A unknown Het
Iftap T C 2: 101,440,950 (GRCm39) K18E probably benign Het
Igtp T G 11: 58,097,169 (GRCm39) D113E probably damaging Het
Igtp C G 11: 58,097,944 (GRCm39) L372V probably benign Het
Igtp C G 11: 58,097,791 (GRCm39) L321V possibly damaging Het
Ihh G C 1: 74,990,204 (GRCm39) P57R probably damaging Het
Irgm2 T A 11: 58,110,339 (GRCm39) V10D probably benign Het
Irgm2 C G 11: 58,111,389 (GRCm39) T360S probably benign Het
Irgm2 G T 11: 58,111,238 (GRCm39) A310S possibly damaging Het
Irgm2 A C 11: 58,110,951 (GRCm39) H214P probably benign Het
Irgm2 A G 11: 58,110,389 (GRCm39) N27D probably benign Het
Irgm2 G A 11: 58,110,924 (GRCm39) S205N probably benign Het
Irgm2 G A 11: 58,110,833 (GRCm39) V175I probably benign Het
Irgm2 T C 11: 58,110,780 (GRCm39) L157S probably benign Het
Irgm2 T C 11: 58,110,738 (GRCm39) I143T probably benign Het
Itgae T A 11: 72,994,713 (GRCm39) L22M possibly damaging Het
Itgae C G 11: 73,024,953 (GRCm39) S1028W probably benign Het
Itgae G T 11: 73,012,783 (GRCm39) G705V probably benign Het
Itgae A T 11: 73,012,757 (GRCm39) K696N probably benign Het
Itgae G A 11: 73,008,913 (GRCm39) V465I probably benign Het
Itgae A G 11: 73,006,466 (GRCm39) H378R probably benign Het
Itgae A T 11: 72,994,786 (GRCm39) Q46L probably damaging Het
Kctd10 C A 5: 114,505,458 (GRCm39) D179Y probably damaging Het
Kif1c C T 11: 70,614,940 (GRCm39) P578L probably benign Het
Kmt2d T C 15: 98,749,625 (GRCm39) N2656D unknown Het
Larp1 G A 11: 57,933,166 (GRCm39) V257I probably benign Het
Lin54 T C 5: 100,607,640 (GRCm39) T325A probably benign Het
Llgl1 ACCCCAGCCCTTCTGATTACTGCCCTCCCCAGC ACCCCAGC 11: 60,603,923 (GRCm39) probably null Het
Lypd8 T C 11: 58,273,601 (GRCm39) Y27H probably benign Het
Lypd8 CAATCACCAACA CAATCACCAACAGTTCCCTCGCCTCTGTTACCCCACAAATCACCAACA 11: 58,281,059 (GRCm39) probably benign Het
Lypd8 G A 11: 58,275,489 (GRCm39) E75K probably benign Het
Lypd8 C A 11: 58,275,475 (GRCm39) A70E possibly damaging Het
Lypd8l T G 11: 58,503,397 (GRCm39) S44R probably benign Het
Lypd8l G A 11: 58,499,335 (GRCm39) P161L probably benign Het
Lypd8l A G 11: 58,503,387 (GRCm39) L47P probably benign Het
Mapk7 TGG TGGCGCTGGGGCAGG 11: 61,381,053 (GRCm39) probably benign Het
Mctp1 A C 13: 76,971,161 (GRCm39) N620T probably benign Het
Mfap3 A T 11: 57,418,866 (GRCm39) I9F possibly damaging Het
Mfap3 G A 11: 57,418,902 (GRCm39) G21S probably benign Het
Mrm3 G A 11: 76,134,903 (GRCm39) R102K probably benign Het
Mrm3 C T 11: 76,138,221 (GRCm39) P203L probably benign Het
Mrpl22 G A 11: 58,062,521 (GRCm39) A4T unknown Het
Mrpl55 A G 11: 59,094,999 (GRCm39) probably null Het
Mrpl55 A T 11: 59,095,415 (GRCm39) L26F probably benign Het
Myocd A G 11: 65,075,418 (GRCm39) S697P probably benign Het
Nlgn2 A G 11: 69,719,220 (GRCm39) V210A possibly damaging Het
Nlrp1a T C 11: 70,983,069 (GRCm39) K1299R probably benign Het
Nlrp1a C T 11: 70,988,077 (GRCm39) R1131Q probably damaging Het
Nlrp1a T C 11: 70,990,442 (GRCm39) I1038V probably benign Het
Nlrp1a T C 11: 71,014,914 (GRCm39) E112G probably benign Het
Nlrp1a C G 11: 71,033,355 (GRCm39) probably null Het
Nlrp1b A T 11: 71,073,378 (GRCm39) M155K probably benign Het
Nlrp1b T A 11: 71,073,396 (GRCm39) Q149L probably benign Het
Nlrp1b T C 11: 71,073,503 (GRCm39) I113M probably benign Het
Nlrp1b C G 11: 71,073,370 (GRCm39) E158Q probably benign Het
Nlrp1b T C 11: 71,073,280 (GRCm39) T188A probably benign Het
Nlrp1b A T 11: 71,073,266 (GRCm39) D192E probably benign Het
Nlrp1b A G 11: 71,073,148 (GRCm39) Y232H probably benign Het
Nlrp1b G C 11: 71,073,135 (GRCm39) T236R probably benign Het
Nlrp1b A G 11: 71,072,625 (GRCm39) I406T probably benign Het
Nlrp1b A C 11: 71,072,539 (GRCm39) S435A probably benign Het
Nlrp1b C A 11: 71,072,534 (GRCm39) M436I probably benign Het
Nmur2 T C 11: 55,931,104 (GRCm39) I202M probably benign Het
Nrp1 C A 8: 129,224,419 (GRCm39) H727Q probably damaging Het
Oas1b TCACGCAC TCACGCACGCAC 5: 120,955,843 (GRCm39) probably null Het
Obscn G T 11: 58,984,334 (GRCm39) A1707D possibly damaging Het
Obscn C T 11: 58,984,335 (GRCm39) A1707T probably benign Het
Obscn G A 11: 58,984,385 (GRCm39) A1690V probably benign Het
Obscn C G 11: 58,994,167 (GRCm39) A1572P probably damaging Het
Obscn G A 11: 58,994,364 (GRCm39) A1506V probably benign Het
Obscn T C 11: 59,003,380 (GRCm39) E1306G probably benign Het
Obscn T C 11: 59,013,563 (GRCm39) M1095V probably benign Het
Obscn C T 11: 59,021,449 (GRCm39) R797H probably damaging Het
Obscn C T 11: 59,023,937 (GRCm39) A578T possibly damaging Het
Obscn G A 11: 59,024,066 (GRCm39) P535S probably damaging Het
Obscn C G 11: 59,024,072 (GRCm39) A533P probably benign Het
Obscn T C 11: 59,026,505 (GRCm39) I233V probably benign Het
Obscn C A 11: 58,940,614 (GRCm39) R4593S possibly damaging Het
Obscn T C 11: 58,940,623 (GRCm39) T5307A Het
Obscn G A 11: 58,942,383 (GRCm39) T4372M probably benign Het
Obscn T C 11: 58,943,439 (GRCm39) M4237V probably benign Het
Obscn C T 11: 58,944,594 (GRCm39) R4700Q probably benign Het
Obscn T C 11: 58,944,651 (GRCm39) K4681R probably benign Het
Obscn T C 11: 58,945,044 (GRCm39) E4658G probably benign Het
Obscn C T 11: 58,945,176 (GRCm39) R4614Q probably benign Het
Obscn T C 11: 58,946,331 (GRCm39) D4458G probably damaging Het
Obscn G T 11: 58,946,936 (GRCm39) A4066E possibly damaging Het
Obscn A G 11: 58,947,595 (GRCm39) M4478T Het
Obscn T C 11: 58,954,300 (GRCm39) T4037A Het
Obscn T C 11: 58,954,402 (GRCm39) K3727E probably damaging Het
Obscn G A 11: 58,957,973 (GRCm39) R3576C probably benign Het
Obscn C T 11: 58,958,655 (GRCm39) V3433I probably benign Het
Obscn C A 11: 58,960,757 (GRCm39) A3185S probably benign Het
Obscn C T 11: 58,967,334 (GRCm39) V2792I possibly damaging Het
Obscn G A 11: 58,969,984 (GRCm39) R53C probably damaging Het
Obscn C G 11: 58,970,722 (GRCm39) V2328L probably benign Het
Obscn C A 11: 58,972,698 (GRCm39) G2116V possibly damaging Het
Obscn C T 11: 58,977,505 (GRCm39) R1865H probably benign Het
Obscn T C 11: 58,977,527 (GRCm39) R1858G probably benign Het
Obscn A G 11: 58,984,142 (GRCm39) F1771S probably benign Het
Obscn G A 11: 58,891,715 (GRCm39) A6939V probably benign Het
Obscn C G 11: 58,900,019 (GRCm39) G938A probably benign Het
Obscn G C 11: 58,904,014 (GRCm39) T7320S probably benign Het
Obscn C T 11: 58,921,934 (GRCm39) R5954Q probably damaging Het
Obscn G C 11: 58,929,976 (GRCm39) P5080A probably benign Het
Obscn T A 11: 58,929,990 (GRCm39) Q5075L probably damaging Het
Obscn T C 11: 58,933,776 (GRCm39) T5363A probably benign Het
Obscn G A 11: 58,933,853 (GRCm39) A5337V probably benign Het
Obscn G A 11: 58,933,878 (GRCm39) R5329C probably benign Het
Obscn C T 11: 58,940,306 (GRCm39) D5354N Het
Obscn C T 11: 58,984,239 (GRCm39) V1739M possibly damaging Het
Or10ak13 G C 4: 118,639,284 (GRCm39) T166S possibly damaging Het
Or11l3 G A 11: 58,516,588 (GRCm39) P95S probably benign Het
Or11l3 T G 11: 58,516,619 (GRCm39) K84N probably benign Het
Or11l3 A C 11: 58,516,732 (GRCm39) C46G possibly damaging Het
Or11l3 G A 11: 58,516,075 (GRCm39) S79F probably benign Het
Or11l3 C G 11: 58,516,130 (GRCm39) G61R probably benign Het
Or2ab1 A G 11: 58,488,356 (GRCm39) I39V probably benign Het
Or2ab1 A C 11: 58,488,344 (GRCm39) I35L probably benign Het
Or2ab1 A G 11: 58,488,776 (GRCm39) S179G probably benign Het
Or2ab1 A G 11: 58,488,491 (GRCm39) S84G possibly damaging Het
Or2ak4 C T 11: 58,648,895 (GRCm39) L135F probably benign Het
Or2ak4 G A 11: 58,648,793 (GRCm39) A101T probably benign Het
Or2ak4 A C 11: 58,649,186 (GRCm39) K232Q probably benign Het
Or2ak4 A C 11: 58,649,168 (GRCm39) I226L probably benign Het
Or2ak4 G A 11: 58,649,153 (GRCm39) V221M probably damaging Het
Or2ak4 A G 11: 58,648,931 (GRCm39) S147G probably benign Het
Or2ak5 G A 11: 58,611,922 (GRCm39) probably benign Het
Or2ak6 C T 11: 58,593,153 (GRCm39) L209F possibly damaging Het
Or2ak6 A C 11: 58,592,784 (GRCm39) I86L probably benign Het
Or2ak6 C A 11: 58,593,222 (GRCm39) Q232K probably benign Het
Or2ak7 G A 11: 58,575,083 (GRCm39) R128Q probably benign Het
Or2ak7 G T 11: 58,574,758 (GRCm39) D20Y probably benign Het
Or2ak7 C T 11: 58,575,289 (GRCm39) H197Y probably benign Het
Or2av9 C A 11: 58,380,574 (GRCm39) E336* probably null Het
Or2av9 T C 11: 58,381,314 (GRCm39) Q89R probably benign Het
Or2av9 C T 11: 58,381,123 (GRCm39) A153T probably benign Het
Or2q1 T C 6: 42,794,447 (GRCm39) F14S probably damaging Het
Or2t29 G T 11: 58,434,272 (GRCm39) S23Y probably benign Het
Or2t43 G A 11: 58,457,388 (GRCm39) A261V probably benign Het
Or2t43 C T 11: 58,457,920 (GRCm39) V84I probably benign Het
Or2t43 A T 11: 58,457,521 (GRCm39) S217T probably benign Het
Or2t44 A G 11: 58,677,773 (GRCm39) T238A probably damaging Het
Or2t46 C T 11: 58,471,750 (GRCm39) H27Y probably benign Het
Or2t46 G C 11: 58,472,483 (GRCm39) S271T probably benign Het
Or2t46 T G 11: 58,472,122 (GRCm39) L151V probably benign Het
Or2t46 T C 11: 58,471,757 (GRCm39) V29A probably benign Het
Or2t47 T C 11: 58,442,387 (GRCm39) K226R probably benign Het
Or2t47 C T 11: 58,442,940 (GRCm39) A42T probably benign Het
Or2t47 C T 11: 58,442,801 (GRCm39) S88N probably benign Het
Or2t49 GGTGGATTGGTATGTGGAT GGTGGAT 11: 58,393,212 (GRCm39) probably benign Het
Or2t49 C T 11: 58,393,396 (GRCm39) M1I probably null Het
Or2t49 C G 11: 58,393,287 (GRCm39) V38L probably benign Het
Or2w3 T G 11: 58,557,342 (GRCm39) I319R probably benign Het
Or2w3b T C 11: 58,623,475 (GRCm39) H172R probably benign Het
Or2w3b C A 11: 58,624,048 (GRCm39) probably benign Het
Or5af2 A G 11: 58,707,887 (GRCm39) I18V probably benign Het
Or5af2 C G 11: 58,708,644 (GRCm39) P270R probably benign Het
Or5af2 T C 11: 58,708,508 (GRCm39) C225R probably benign Het
Or5af2 A C 11: 58,708,220 (GRCm39) I129L probably benign Het
Or5af2 T C 11: 58,708,122 (GRCm39) V96A probably benign Het
Or6c66b C T 10: 129,377,246 (GRCm39) A280V probably benign Het
Or9e1 G C 11: 58,731,907 (GRCm39) probably benign Het
Or9e1 A G 11: 58,732,615 (GRCm39) H225R probably benign Het
Or9e1 G T 11: 58,731,945 (GRCm39) A2S probably benign Het
Or9e1 G A 11: 58,732,569 (GRCm39) A210T probably benign Het
Ovca2 T C 11: 75,069,528 (GRCm39) T32A probably benign Het
Pbx1 C T 1: 168,012,524 (GRCm39) probably null Het
Pdxk T C 10: 78,280,895 (GRCm39) T182A probably benign Het
Pimreg G A 11: 71,935,979 (GRCm39) R154H probably damaging Het
Pimreg TCACA TCA 11: 71,935,801 (GRCm39) probably benign Het
Pitpnm3 C T 11: 72,010,969 (GRCm39) R21Q probably benign Het
Pitpnm3 T C 11: 71,954,955 (GRCm39) K520E probably benign Het
Ppp1r12b C G 1: 134,883,262 (GRCm39) V87L probably benign Het
Prpsap2 A C 11: 61,647,078 (GRCm39) V21G possibly damaging Het
Rabep1 C CT 11: 70,830,910 (GRCm39) probably null Het
Rai1 A G 11: 60,078,389 (GRCm39) N818D probably benign Het
Rap1gap2 C T 11: 74,487,721 (GRCm39) E52K probably benign Het
Rc3h2 G A 2: 37,299,568 (GRCm39) A154V possibly damaging Het
Rgs21 C T 1: 144,395,529 (GRCm39) A120T possibly damaging Het
Rnf112 A G 11: 61,341,775 (GRCm39) L343P unknown Het
Rnf167 C CACAGGGA 11: 70,541,646 (GRCm39) probably null Het
Rtn4rl1 C T 11: 75,156,863 (GRCm39) P432S probably benign Het
Slc2a4 GCC G 11: 69,834,819 (GRCm39) probably null Het
Slc2a4 GGCCG GG 11: 69,834,818 (GRCm39) probably benign Het
Slc41a1 A G 1: 131,767,972 (GRCm39) M179V probably benign Het
Slc6a4 A G 11: 76,903,858 (GRCm39) K152R probably benign Het
Slc6a4 G A 11: 76,901,382 (GRCm39) G39E probably benign Het
Smcr8 T C 11: 60,669,932 (GRCm39) V360A probably benign Het
Smcr8 C A 11: 60,670,699 (GRCm39) R616S probably benign Het
Smcr8 A G 11: 60,668,806 (GRCm39) probably benign Het
Smg6 G T 11: 75,047,092 (GRCm39) A1262S probably benign Het
Sowaha A C 11: 53,369,279 (GRCm39) L486V possibly damaging Het
Spns3 G A 11: 72,440,917 (GRCm39) P40S probably benign Het
Spns3 T C 11: 72,440,986 (GRCm39) S17G probably benign Het
Spns3 T C 11: 72,440,863 (GRCm39) I58V probably benign Het
Srebf1 C T 11: 60,097,061 (GRCm39) V256M probably benign Het
Tekt1 T C 11: 72,250,597 (GRCm39) Q33R probably benign Het
Timm22 T G 11: 76,297,943 (GRCm39) V18G probably benign Het
Tmem102 G C 11: 69,695,927 (GRCm39) R45G probably benign Het
Tmem102 C G 11: 69,695,902 (GRCm39) G53A possibly damaging Het
Tmem11 A G 11: 60,766,658 (GRCm39) probably benign Het
Tmem245 C T 4: 56,937,901 (GRCm39) V216I probably benign Het
Tom1l2 C T 11: 60,132,682 (GRCm39) A414T probably benign Het
Top3a C T 11: 60,641,410 (GRCm39) G425S probably benign Het
Trim16 C A 11: 62,731,675 (GRCm39) D515E probably benign Het
Trim16 T C 11: 62,731,572 (GRCm39) V481A probably benign Het
Trim16 G A 11: 62,727,643 (GRCm39) E322K probably benign Het
Trim16 GA GAAAA 11: 62,711,520 (GRCm39) probably benign Het
Trim16 GAA GAACAA 11: 62,711,517 (GRCm39) probably benign Het
Trim16 TGAAGA TGAAGAAGA 11: 62,711,516 (GRCm39) probably benign Het
Trim16 G C 11: 62,711,502 (GRCm39) V58L probably benign Het
Trim16 C T 11: 62,711,428 (GRCm39) A33V probably benign Het
Trim17 A G 11: 58,861,272 (GRCm39) N259S probably benign Het
Trim17 G A 11: 58,856,331 (GRCm39) M129I probably benign Het
Trim58 A G 11: 58,542,486 (GRCm39) N482S probably benign Het
Trim58 C A 11: 58,531,684 (GRCm39) L131M possibly damaging Het
Trmt1l A G 1: 151,333,331 (GRCm39) N642S possibly damaging Het
Trpv1 C A 11: 73,145,117 (GRCm39) D734E probably benign Het
Trpv1 C G 11: 73,131,427 (GRCm39) P322A possibly damaging Het
Trpv3 A G 11: 73,174,502 (GRCm39) T290A probably benign Het
Trpv3 C T 11: 73,160,513 (GRCm39) A9V probably benign Het
Trpv3 G A 11: 73,169,803 (GRCm39) A125T probably benign Het
Ttll13 G A 7: 79,908,491 (GRCm39) R576H probably damaging Het
Tvp23b A C 11: 62,772,769 (GRCm39) N7H possibly damaging Het
Usp43 C T 11: 67,747,332 (GRCm39) G792S probably benign Het
Usp43 AGGGC AGGGCAGGGGATGAACCTCGGGC 11: 67,746,545 (GRCm39) probably benign Het
Utrn C T 10: 12,545,491 (GRCm39) R1718H probably damaging Het
Vamp2 G A 11: 68,980,889 (GRCm39) G124R possibly damaging Het
Vamp2 C T 11: 68,979,411 (GRCm39) probably benign Het
Vmn1r80 A C 7: 11,927,360 (GRCm39) K157Q probably damaging Het
Xaf1 T C 11: 72,199,881 (GRCm39) L206S unknown Het
Xaf1 G C 11: 72,199,856 (GRCm39) V198L unknown Het
Xaf1 G GATGGCCAA 11: 72,199,847 (GRCm39) probably null Het
Xaf1 GGCT GGCTGGCCAGCT 11: 72,199,846 (GRCm39) probably null Het
Xaf1 T G 11: 72,199,792 (GRCm39) C176W unknown Het
Xaf1 A G 11: 72,199,476 (GRCm39) E71G probably benign Het
Xaf1 C A 11: 72,197,434 (GRCm39) L137I probably benign Het
Xaf1 G C 11: 72,197,429 (GRCm39) C135S probably damaging Het
Xaf1 G A 11: 72,197,426 (GRCm39) R134H probably benign Het
Zfp286 G A 11: 62,675,782 (GRCm39) T60M probably damaging Het
Zfp286 A G 11: 62,678,795 (GRCm39) V44A probably benign Het
Zfp287 C T 11: 62,604,633 (GRCm39) R758H probably benign Het
Zfp287 G A 11: 62,613,757 (GRCm39) R225* probably null Het
Zfp287 C G 11: 62,606,175 (GRCm39) C244S probably benign Het
Zfp39 A G 11: 58,782,123 (GRCm39) I213T probably benign Het
Zfp39 T A 11: 58,781,967 (GRCm39) H265L probably damaging Het
Zfp39 T A 11: 58,781,751 (GRCm39) K337M probably benign Het
Zfp39 A G 11: 58,781,605 (GRCm39) S386P probably benign Het
Zfp39 G T 11: 58,781,597 (GRCm39) N388K probably benign Het
Zfp39 T C 11: 58,781,526 (GRCm39) N412S possibly damaging Het
Zfp39 T C 11: 58,781,274 (GRCm39) D496G possibly damaging Het
Zfp39 G C 11: 58,781,273 (GRCm39) D496E probably benign Het
Zfp39 G C 11: 58,781,130 (GRCm39) T544R possibly damaging Het
Zfp39 A C 11: 58,780,873 (GRCm39) Y630D probably benign Het
Zfp39 G C 11: 58,780,871 (GRCm39) Y630* probably null Het
Zfp39 T G 11: 58,791,409 (GRCm39) S93R probably benign Het
Zfp39 G T 11: 58,791,407 (GRCm39) S93R probably benign Het
Zfp39 T C 11: 58,782,142 (GRCm39) K207E probably benign Het
Zfp672 G T 11: 58,220,452 (GRCm39) T49K unknown Het
Zfp692 G T 11: 58,199,859 (GRCm39) E149D probably benign Het
Zfp692 G A 11: 58,200,844 (GRCm39) V242I probably benign Het
Zzef1 G A 11: 72,780,008 (GRCm39) R1927H probably benign Het
Other mutations in Dmxl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Dmxl1 APN 18 49,984,534 (GRCm39) missense probably damaging 1.00
IGL00668:Dmxl1 APN 18 50,072,620 (GRCm39) missense possibly damaging 0.64
IGL00740:Dmxl1 APN 18 50,050,735 (GRCm39) missense probably benign 0.00
IGL00969:Dmxl1 APN 18 50,045,792 (GRCm39) missense probably benign 0.02
IGL01113:Dmxl1 APN 18 50,045,818 (GRCm39) missense probably benign 0.01
IGL01384:Dmxl1 APN 18 49,990,401 (GRCm39) missense probably benign
IGL01475:Dmxl1 APN 18 50,004,781 (GRCm39) missense probably damaging 1.00
IGL01559:Dmxl1 APN 18 50,054,005 (GRCm39) missense probably damaging 0.99
IGL01578:Dmxl1 APN 18 50,095,272 (GRCm39) missense probably damaging 1.00
IGL01632:Dmxl1 APN 18 49,996,092 (GRCm39) missense probably damaging 0.99
IGL01814:Dmxl1 APN 18 49,997,935 (GRCm39) missense probably damaging 1.00
IGL01843:Dmxl1 APN 18 50,011,449 (GRCm39) nonsense probably null
IGL01933:Dmxl1 APN 18 50,010,852 (GRCm39) missense probably benign 0.17
IGL01952:Dmxl1 APN 18 50,023,721 (GRCm39) missense probably benign 0.11
IGL02120:Dmxl1 APN 18 50,027,245 (GRCm39) missense possibly damaging 0.83
IGL02162:Dmxl1 APN 18 50,094,230 (GRCm39) missense probably benign 0.00
IGL02213:Dmxl1 APN 18 50,010,741 (GRCm39) splice site probably benign
IGL02261:Dmxl1 APN 18 49,973,566 (GRCm39) missense possibly damaging 0.85
IGL02689:Dmxl1 APN 18 49,997,962 (GRCm39) missense probably damaging 1.00
IGL02892:Dmxl1 APN 18 49,992,187 (GRCm39) missense probably damaging 0.96
IGL03232:Dmxl1 APN 18 50,011,247 (GRCm39) missense probably benign 0.01
IGL03258:Dmxl1 APN 18 50,053,960 (GRCm39) missense probably damaging 1.00
IGL03298:Dmxl1 APN 18 49,997,885 (GRCm39) missense probably benign
capture UTSW 18 50,095,328 (GRCm39) missense probably damaging 1.00
carnivora UTSW 18 49,997,450 (GRCm39) missense probably damaging 0.99
digestion UTSW 18 50,011,326 (GRCm39) missense probably damaging 1.00
drowning UTSW 18 50,011,292 (GRCm39) missense possibly damaging 0.55
hibiscus UTSW 18 50,022,534 (GRCm39) missense probably damaging 1.00
impound UTSW 18 50,026,316 (GRCm39) missense probably benign
pitcher UTSW 18 49,997,215 (GRCm39) missense probably damaging 1.00
PIT4810001:Dmxl1 UTSW 18 50,065,030 (GRCm39) missense probably damaging 1.00
R0001:Dmxl1 UTSW 18 50,021,964 (GRCm39) splice site probably benign
R0027:Dmxl1 UTSW 18 50,090,362 (GRCm39) splice site probably benign
R0042:Dmxl1 UTSW 18 49,997,102 (GRCm39) missense probably benign 0.03
R0042:Dmxl1 UTSW 18 49,997,102 (GRCm39) missense probably benign 0.03
R0046:Dmxl1 UTSW 18 50,011,149 (GRCm39) missense probably benign 0.22
R0046:Dmxl1 UTSW 18 50,011,149 (GRCm39) missense probably benign 0.22
R0257:Dmxl1 UTSW 18 50,088,870 (GRCm39) splice site probably benign
R0349:Dmxl1 UTSW 18 50,012,349 (GRCm39) missense probably damaging 0.99
R0390:Dmxl1 UTSW 18 50,012,429 (GRCm39) missense probably benign 0.14
R0511:Dmxl1 UTSW 18 50,024,534 (GRCm39) nonsense probably null
R0539:Dmxl1 UTSW 18 49,990,497 (GRCm39) splice site probably benign
R0542:Dmxl1 UTSW 18 50,026,761 (GRCm39) missense probably benign 0.05
R0587:Dmxl1 UTSW 18 50,068,374 (GRCm39) missense probably benign 0.39
R0635:Dmxl1 UTSW 18 49,984,490 (GRCm39) splice site probably benign
R0744:Dmxl1 UTSW 18 49,966,215 (GRCm39) missense probably damaging 1.00
R0836:Dmxl1 UTSW 18 49,966,215 (GRCm39) missense probably damaging 1.00
R0845:Dmxl1 UTSW 18 50,026,469 (GRCm39) missense probably damaging 1.00
R1218:Dmxl1 UTSW 18 50,026,678 (GRCm39) missense probably damaging 1.00
R1278:Dmxl1 UTSW 18 50,026,292 (GRCm39) missense probably benign
R1313:Dmxl1 UTSW 18 50,011,550 (GRCm39) missense probably damaging 1.00
R1313:Dmxl1 UTSW 18 50,011,550 (GRCm39) missense probably damaging 1.00
R1349:Dmxl1 UTSW 18 50,021,920 (GRCm39) missense probably damaging 1.00
R1453:Dmxl1 UTSW 18 49,990,316 (GRCm39) missense probably benign 0.05
R1522:Dmxl1 UTSW 18 49,985,434 (GRCm39) missense probably benign 0.05
R1629:Dmxl1 UTSW 18 49,992,353 (GRCm39) critical splice donor site probably null
R1638:Dmxl1 UTSW 18 50,023,834 (GRCm39) nonsense probably null
R1646:Dmxl1 UTSW 18 50,095,328 (GRCm39) missense probably damaging 1.00
R1719:Dmxl1 UTSW 18 50,067,704 (GRCm39) missense probably damaging 1.00
R1732:Dmxl1 UTSW 18 50,036,055 (GRCm39) missense probably benign
R1732:Dmxl1 UTSW 18 50,026,511 (GRCm39) nonsense probably null
R1886:Dmxl1 UTSW 18 49,992,202 (GRCm39) missense probably benign 0.09
R1887:Dmxl1 UTSW 18 49,992,202 (GRCm39) missense probably benign 0.09
R1895:Dmxl1 UTSW 18 50,088,981 (GRCm39) splice site probably null
R1911:Dmxl1 UTSW 18 50,011,230 (GRCm39) missense probably benign 0.00
R2020:Dmxl1 UTSW 18 50,022,625 (GRCm39) nonsense probably null
R2116:Dmxl1 UTSW 18 50,011,884 (GRCm39) missense probably damaging 1.00
R2196:Dmxl1 UTSW 18 50,050,698 (GRCm39) missense probably benign 0.00
R2206:Dmxl1 UTSW 18 50,027,161 (GRCm39) missense probably benign 0.12
R2216:Dmxl1 UTSW 18 50,026,990 (GRCm39) missense probably benign 0.00
R2255:Dmxl1 UTSW 18 49,979,706 (GRCm39) missense probably benign 0.34
R2333:Dmxl1 UTSW 18 50,053,043 (GRCm39) splice site probably null
R2343:Dmxl1 UTSW 18 50,023,745 (GRCm39) missense probably damaging 1.00
R2496:Dmxl1 UTSW 18 50,013,858 (GRCm39) missense possibly damaging 0.51
R3757:Dmxl1 UTSW 18 50,068,384 (GRCm39) missense probably damaging 0.98
R3758:Dmxl1 UTSW 18 50,068,384 (GRCm39) missense probably damaging 0.98
R3783:Dmxl1 UTSW 18 49,998,189 (GRCm39) missense probably damaging 1.00
R3786:Dmxl1 UTSW 18 49,998,189 (GRCm39) missense probably damaging 1.00
R3787:Dmxl1 UTSW 18 49,998,189 (GRCm39) missense probably damaging 1.00
R3885:Dmxl1 UTSW 18 50,011,326 (GRCm39) missense probably damaging 1.00
R3886:Dmxl1 UTSW 18 50,011,326 (GRCm39) missense probably damaging 1.00
R3887:Dmxl1 UTSW 18 50,011,326 (GRCm39) missense probably damaging 1.00
R3888:Dmxl1 UTSW 18 50,011,326 (GRCm39) missense probably damaging 1.00
R3889:Dmxl1 UTSW 18 50,011,326 (GRCm39) missense probably damaging 1.00
R4014:Dmxl1 UTSW 18 49,997,029 (GRCm39) missense probably benign
R4033:Dmxl1 UTSW 18 49,984,498 (GRCm39) missense possibly damaging 0.95
R4096:Dmxl1 UTSW 18 50,094,264 (GRCm39) missense probably damaging 1.00
R4366:Dmxl1 UTSW 18 50,011,084 (GRCm39) nonsense probably null
R4406:Dmxl1 UTSW 18 50,022,620 (GRCm39) missense probably damaging 1.00
R4412:Dmxl1 UTSW 18 49,981,828 (GRCm39) missense probably benign
R4454:Dmxl1 UTSW 18 50,026,399 (GRCm39) missense probably benign 0.01
R4459:Dmxl1 UTSW 18 50,094,283 (GRCm39) missense possibly damaging 0.80
R4569:Dmxl1 UTSW 18 49,985,427 (GRCm39) missense probably damaging 1.00
R4570:Dmxl1 UTSW 18 49,985,427 (GRCm39) missense probably damaging 1.00
R4606:Dmxl1 UTSW 18 50,095,248 (GRCm39) missense probably damaging 0.98
R4649:Dmxl1 UTSW 18 50,011,698 (GRCm39) missense probably damaging 0.99
R4683:Dmxl1 UTSW 18 50,011,088 (GRCm39) missense probably damaging 1.00
R4782:Dmxl1 UTSW 18 49,996,059 (GRCm39) missense probably damaging 1.00
R4878:Dmxl1 UTSW 18 49,984,543 (GRCm39) missense probably damaging 1.00
R4879:Dmxl1 UTSW 18 50,022,534 (GRCm39) missense probably damaging 1.00
R4881:Dmxl1 UTSW 18 50,090,348 (GRCm39) intron probably benign
R4885:Dmxl1 UTSW 18 50,011,862 (GRCm39) missense probably damaging 0.99
R4916:Dmxl1 UTSW 18 50,010,764 (GRCm39) missense probably damaging 1.00
R5022:Dmxl1 UTSW 18 50,028,194 (GRCm39) missense probably damaging 0.99
R5056:Dmxl1 UTSW 18 50,003,990 (GRCm39) missense probably benign 0.00
R5177:Dmxl1 UTSW 18 50,026,651 (GRCm39) missense probably damaging 0.99
R5342:Dmxl1 UTSW 18 50,084,302 (GRCm39) missense probably damaging 0.96
R5421:Dmxl1 UTSW 18 49,996,186 (GRCm39) critical splice donor site probably null
R5433:Dmxl1 UTSW 18 50,000,966 (GRCm39) splice site probably null
R5484:Dmxl1 UTSW 18 50,022,531 (GRCm39) missense probably damaging 1.00
R5598:Dmxl1 UTSW 18 49,997,545 (GRCm39) missense probably benign 0.04
R5633:Dmxl1 UTSW 18 50,010,764 (GRCm39) missense probably damaging 1.00
R5638:Dmxl1 UTSW 18 50,024,693 (GRCm39) missense possibly damaging 0.95
R5694:Dmxl1 UTSW 18 50,027,324 (GRCm39) missense probably damaging 1.00
R5696:Dmxl1 UTSW 18 50,065,008 (GRCm39) nonsense probably null
R5706:Dmxl1 UTSW 18 50,090,462 (GRCm39) critical splice donor site probably null
R5745:Dmxl1 UTSW 18 49,979,653 (GRCm39) missense probably benign
R5876:Dmxl1 UTSW 18 50,004,051 (GRCm39) missense possibly damaging 0.70
R6054:Dmxl1 UTSW 18 49,990,453 (GRCm39) missense probably benign 0.00
R6145:Dmxl1 UTSW 18 50,045,833 (GRCm39) missense possibly damaging 0.90
R6189:Dmxl1 UTSW 18 50,026,402 (GRCm39) missense probably benign 0.33
R6213:Dmxl1 UTSW 18 49,996,082 (GRCm39) missense possibly damaging 0.93
R6219:Dmxl1 UTSW 18 50,035,434 (GRCm39) missense probably damaging 0.99
R6221:Dmxl1 UTSW 18 50,004,799 (GRCm39) missense probably damaging 0.96
R6276:Dmxl1 UTSW 18 49,979,653 (GRCm39) missense probably benign
R6319:Dmxl1 UTSW 18 49,985,367 (GRCm39) missense probably benign 0.00
R6426:Dmxl1 UTSW 18 49,997,645 (GRCm39) missense probably damaging 0.99
R6567:Dmxl1 UTSW 18 49,992,246 (GRCm39) missense probably damaging 0.99
R6739:Dmxl1 UTSW 18 50,011,313 (GRCm39) missense probably benign 0.03
R6743:Dmxl1 UTSW 18 50,013,847 (GRCm39) missense possibly damaging 0.95
R6776:Dmxl1 UTSW 18 50,027,041 (GRCm39) missense probably damaging 1.00
R6827:Dmxl1 UTSW 18 50,054,091 (GRCm39) missense probably damaging 1.00
R6828:Dmxl1 UTSW 18 50,054,091 (GRCm39) missense probably damaging 1.00
R6829:Dmxl1 UTSW 18 50,054,091 (GRCm39) missense probably damaging 1.00
R6830:Dmxl1 UTSW 18 50,054,091 (GRCm39) missense probably damaging 1.00
R6833:Dmxl1 UTSW 18 50,088,890 (GRCm39) missense probably damaging 0.99
R6834:Dmxl1 UTSW 18 50,088,890 (GRCm39) missense probably damaging 0.99
R6856:Dmxl1 UTSW 18 49,985,355 (GRCm39) nonsense probably null
R6857:Dmxl1 UTSW 18 49,997,902 (GRCm39) missense probably damaging 0.99
R6881:Dmxl1 UTSW 18 50,068,372 (GRCm39) missense probably benign 0.00
R6882:Dmxl1 UTSW 18 49,976,851 (GRCm39) critical splice acceptor site probably null
R6892:Dmxl1 UTSW 18 50,053,969 (GRCm39) missense probably damaging 0.98
R6897:Dmxl1 UTSW 18 49,996,124 (GRCm39) missense possibly damaging 0.51
R6897:Dmxl1 UTSW 18 49,984,562 (GRCm39) missense probably null 0.99
R6917:Dmxl1 UTSW 18 49,997,215 (GRCm39) missense probably damaging 1.00
R7192:Dmxl1 UTSW 18 50,088,920 (GRCm39) missense probably damaging 0.99
R7447:Dmxl1 UTSW 18 49,997,681 (GRCm39) missense probably damaging 0.99
R7460:Dmxl1 UTSW 18 50,011,679 (GRCm39) missense probably benign 0.00
R7570:Dmxl1 UTSW 18 50,027,024 (GRCm39) missense possibly damaging 0.82
R7626:Dmxl1 UTSW 18 50,035,861 (GRCm39) missense probably benign
R7629:Dmxl1 UTSW 18 49,992,337 (GRCm39) missense probably damaging 1.00
R7644:Dmxl1 UTSW 18 50,026,619 (GRCm39) missense probably benign
R7688:Dmxl1 UTSW 18 50,088,938 (GRCm39) missense probably benign 0.03
R7689:Dmxl1 UTSW 18 49,979,685 (GRCm39) missense probably benign 0.00
R7712:Dmxl1 UTSW 18 50,026,528 (GRCm39) missense probably damaging 0.99
R7808:Dmxl1 UTSW 18 50,011,382 (GRCm39) missense probably benign 0.00
R7834:Dmxl1 UTSW 18 50,054,044 (GRCm39) missense probably damaging 1.00
R7848:Dmxl1 UTSW 18 49,973,557 (GRCm39) missense possibly damaging 0.88
R7849:Dmxl1 UTSW 18 50,094,214 (GRCm39) missense probably benign 0.00
R7881:Dmxl1 UTSW 18 49,997,450 (GRCm39) missense probably damaging 0.99
R7884:Dmxl1 UTSW 18 50,026,474 (GRCm39) missense possibly damaging 0.65
R8073:Dmxl1 UTSW 18 50,011,500 (GRCm39) missense probably damaging 1.00
R8089:Dmxl1 UTSW 18 50,021,897 (GRCm39) missense probably damaging 0.99
R8266:Dmxl1 UTSW 18 49,976,878 (GRCm39) missense probably benign 0.17
R8371:Dmxl1 UTSW 18 50,031,781 (GRCm39) missense probably benign 0.08
R8402:Dmxl1 UTSW 18 50,011,409 (GRCm39) missense probably benign
R8402:Dmxl1 UTSW 18 50,011,393 (GRCm39) nonsense probably null
R8402:Dmxl1 UTSW 18 50,011,394 (GRCm39) missense probably benign 0.09
R8423:Dmxl1 UTSW 18 49,998,183 (GRCm39) missense probably damaging 1.00
R8678:Dmxl1 UTSW 18 50,004,759 (GRCm39) nonsense probably null
R8702:Dmxl1 UTSW 18 49,992,202 (GRCm39) missense probably benign 0.09
R8749:Dmxl1 UTSW 18 50,088,937 (GRCm39) missense probably damaging 1.00
R8813:Dmxl1 UTSW 18 50,090,406 (GRCm39) missense probably damaging 0.99
R8877:Dmxl1 UTSW 18 50,011,292 (GRCm39) missense possibly damaging 0.55
R8945:Dmxl1 UTSW 18 50,072,639 (GRCm39) missense probably damaging 1.00
R8971:Dmxl1 UTSW 18 50,026,741 (GRCm39) missense probably damaging 1.00
R8971:Dmxl1 UTSW 18 49,997,575 (GRCm39) missense possibly damaging 0.96
R8978:Dmxl1 UTSW 18 50,055,679 (GRCm39) missense probably benign 0.37
R8987:Dmxl1 UTSW 18 50,026,919 (GRCm39) missense
R9011:Dmxl1 UTSW 18 49,997,240 (GRCm39) missense probably damaging 1.00
R9124:Dmxl1 UTSW 18 50,072,639 (GRCm39) missense probably damaging 1.00
R9131:Dmxl1 UTSW 18 50,072,639 (GRCm39) missense probably damaging 1.00
R9132:Dmxl1 UTSW 18 50,072,639 (GRCm39) missense probably damaging 1.00
R9156:Dmxl1 UTSW 18 50,072,639 (GRCm39) missense probably damaging 1.00
R9165:Dmxl1 UTSW 18 50,011,992 (GRCm39) missense probably damaging 1.00
R9244:Dmxl1 UTSW 18 50,026,316 (GRCm39) missense probably benign
R9254:Dmxl1 UTSW 18 50,024,567 (GRCm39) missense possibly damaging 0.67
R9262:Dmxl1 UTSW 18 49,976,919 (GRCm39) missense probably benign 0.03
R9335:Dmxl1 UTSW 18 49,992,187 (GRCm39) missense probably damaging 0.96
R9375:Dmxl1 UTSW 18 50,091,477 (GRCm39) missense probably damaging 1.00
R9379:Dmxl1 UTSW 18 50,024,567 (GRCm39) missense possibly damaging 0.67
R9434:Dmxl1 UTSW 18 50,010,788 (GRCm39) missense probably damaging 0.98
R9470:Dmxl1 UTSW 18 50,026,777 (GRCm39) missense possibly damaging 0.69
R9500:Dmxl1 UTSW 18 50,011,271 (GRCm39) missense probably damaging 1.00
R9507:Dmxl1 UTSW 18 50,024,567 (GRCm39) missense possibly damaging 0.94
R9617:Dmxl1 UTSW 18 49,998,228 (GRCm39) missense probably damaging 1.00
R9642:Dmxl1 UTSW 18 50,013,825 (GRCm39) missense probably damaging 1.00
RF009:Dmxl1 UTSW 18 50,026,461 (GRCm39) missense probably damaging 0.96
X0025:Dmxl1 UTSW 18 49,997,435 (GRCm39) missense probably damaging 0.98
X0066:Dmxl1 UTSW 18 50,052,966 (GRCm39) missense probably damaging 1.00
Z1088:Dmxl1 UTSW 18 50,054,032 (GRCm39) missense probably benign
Z1188:Dmxl1 UTSW 18 50,001,070 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCTGTATTCGAATCATTCCTGTGTAG -3'
(R):5'- TACCAACCTGAAATACAACTTGAGG -3'

Sequencing Primer
(F):5'- GAAGTGTTTAACATTGTCAGTCAGC -3'
(R):5'- AAGCTGCAAATACTTATCATC -3'
Posted On 2021-03-08