Incidental Mutation 'Z1191:Cntrob'
ID 667297
Institutional Source Beutler Lab
Gene Symbol Cntrob
Ensembl Gene ENSMUSG00000032782
Gene Name centrobin, centrosomal BRCA2 interacting protein
Synonyms Nip2, 9830165K03Rik, Lip8
Accession Numbers
Essential gene? Probably non essential (E-score: 0.175) question?
Stock # Z1191 ()
Quality Score 221.999
Status Not validated
Chromosome 11
Chromosomal Location 69190313-69214601 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 69196404 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 677 (R677H)
Ref Sequence ENSEMBL: ENSMUSP00000090651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092973] [ENSMUST00000123176] [ENSMUST00000130780]
AlphaFold Q8CB62
Predicted Effect probably benign
Transcript: ENSMUST00000092973
AA Change: R677H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000090651
Gene: ENSMUSG00000032782
AA Change: R677H

coiled coil region 191 218 N/A INTRINSIC
coiled coil region 249 557 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123176
Predicted Effect probably benign
Transcript: ENSMUST00000130780
SMART Domains Protein: ENSMUSP00000134842
Gene: ENSMUSG00000032782

low complexity region 50 64 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135979
Predicted Effect probably benign
Transcript: ENSMUST00000176938
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein that interacts with BRCA2, and is required for centriole duplication and cytokinesis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 443 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700086D15Rik A G 11: 65,044,114 (GRCm39) W27R unknown Het
1700086D15Rik A G 11: 65,044,080 (GRCm39) F38S unknown Het
1700086D15Rik A C 11: 65,043,809 (GRCm39) V84G unknown Het
1700086D15Rik T A 11: 65,043,794 (GRCm39) Q89L unknown Het
1700086D15Rik A G 11: 65,044,128 (GRCm39) L22P unknown Het
1810065E05Rik C T 11: 58,313,027 (GRCm39) L27F probably benign Het
1810065E05Rik C T 11: 58,316,625 (GRCm39) L202F probably benign Het
1810065E05Rik C T 11: 58,313,060 (GRCm39) L38F possibly damaging Het
2810021J22Rik C T 11: 58,771,361 (GRCm39) A281V probably benign Het
4930438A08Rik A G 11: 58,184,844 (GRCm39) T521A unknown Het
4933427D14Rik G A 11: 72,067,535 (GRCm39) T585I possibly damaging Het
4933427D14Rik T G 11: 72,089,750 (GRCm39) S45R probably damaging Het
4933427D14Rik C A 11: 72,089,360 (GRCm39) A175S probably benign Het
4933427D14Rik G A 11: 72,089,308 (GRCm39) P192L probably benign Het
4933427D14Rik T C 11: 72,086,595 (GRCm39) Q272R probably damaging Het
4933427D14Rik T TCCCCAGC 11: 72,086,590 (GRCm39) probably null Het
4933427D14Rik T G 11: 72,086,580 (GRCm39) K277T probably damaging Het
4933427D14Rik A G 11: 72,086,569 (GRCm39) C281R possibly damaging Het
4933427D14Rik AAAAGTAA AAA 11: 72,086,538 (GRCm39) probably null Het
4933427D14Rik G T 11: 72,080,442 (GRCm39) P408H probably damaging Het
Adgrf5 C A 17: 43,755,926 (GRCm39) A628E probably benign Het
Akap10 T A 11: 61,806,096 (GRCm39) S211C probably benign Het
Alox8 C T 11: 69,076,873 (GRCm39) R536Q probably benign Het
Alox8 A G 11: 69,088,322 (GRCm39) V76A probably benign Het
Aloxe3 A G 11: 69,019,501 (GRCm39) Q138R probably benign Het
Aloxe3 C T 11: 69,039,429 (GRCm39) A667V probably benign Het
Arhgap21 C T 2: 20,886,283 (GRCm39) R308K probably benign Het
Arih1 T C 9: 59,393,605 (GRCm39) Y9C unknown Het
Asb9 A C X: 163,322,660 (GRCm39) *291Y probably null Het
Aspa G T 11: 73,213,013 (GRCm39) L110I probably benign Het
Atoh1 C A 6: 64,706,364 (GRCm39) H20N probably benign Het
Aurkb C T 11: 68,938,692 (GRCm39) R44W probably damaging Het
Aurkb T C 11: 68,938,696 (GRCm39) F45S probably benign Het
B9d1 A T 11: 61,396,029 (GRCm39) probably benign Het
Borcs6 G A 11: 68,951,453 (GRCm39) R277Q possibly damaging Het
Btnl10 AAAGA AAAGAAGA 11: 58,814,753 (GRCm39) probably benign Het
Btnl10 T C 11: 58,810,138 (GRCm39) V93A probably benign Het
Btnl10 C T 11: 58,817,650 (GRCm39) T250I unknown Het
Btnl10 AGAC AGACGAC 11: 58,814,755 (GRCm39) probably benign Het
Car10 G T 11: 93,195,462 (GRCm39) G90W probably damaging Het
Ccdc42 C T 11: 68,478,017 (GRCm39) probably benign Het
Ccdc92b A G 11: 74,520,880 (GRCm39) M61V possibly damaging Het
Ccdc93 T G 1: 121,403,797 (GRCm39) L309V probably benign Het
Celsr2 C T 3: 108,321,865 (GRCm39) G316S possibly damaging Het
Chd3 C A 11: 69,239,271 (GRCm39) E1753D probably benign Het
Chd3 A G 11: 69,252,277 (GRCm39) W42R probably benign Het
Chl1 T C 6: 103,660,172 (GRCm39) L350S probably damaging Het
Chrna7 G A 7: 62,755,941 (GRCm39) P202S probably benign Het
Chst8 C T 7: 34,447,606 (GRCm39) R4Q probably damaging Het
Cluh CC CCACGAGC 11: 74,560,340 (GRCm39) probably benign Het
Cluh GAGCC GAGCCTAAGCC 11: 74,560,356 (GRCm39) probably benign Het
Cluh GCCTGA GCCTGAACCTGA 11: 74,560,352 (GRCm39) probably benign Het
Cluh TGAGCC TGAGCCCGAGCC 11: 74,560,349 (GRCm39) probably benign Het
Cyb5d1 A G 11: 69,286,028 (GRCm39) L31P probably benign Het
Cyb5d1 C A 11: 69,286,098 (GRCm39) A8S probably benign Het
Dnah9 A C 11: 65,976,000 (GRCm39) S1350A probably benign Het
Dnah9 G A 11: 66,038,207 (GRCm39) H110Y probably benign Het
Elac2 T C 11: 64,870,015 (GRCm39) S27P probably benign Het
Epn2 C A 11: 61,470,460 (GRCm39) probably benign Het
Fam114a2 C T 11: 57,390,581 (GRCm39) V318I probably benign Het
Fam114a2 T C 11: 57,390,623 (GRCm39) N304D probably benign Het
Fam114a2 C T 11: 57,405,060 (GRCm39) G14E probably benign Het
Fam114a2 A G 11: 57,374,858 (GRCm39) S494P probably benign Het
Fam114a2 G A 11: 57,380,940 (GRCm39) A438V probably benign Het
Fam83g G A 11: 61,594,020 (GRCm39) R518Q probably benign Het
Fat2 TGTACCTCACCCCAGTACCT TGTACCT 11: 55,199,796 (GRCm39) probably null Het
Fat2 T G 11: 55,200,625 (GRCm39) K816N probably benign Het
Fbxw10 G A 11: 62,767,671 (GRCm39) V836I probably benign Het
Fbxw10 G C 11: 62,738,118 (GRCm39) R4T probably benign Het
Foxl2 G C 9: 98,838,122 (GRCm39) G137R probably damaging Het
Gabrg2 T C 11: 41,807,104 (GRCm39) I378V probably benign Het
Galnt10 G A 11: 57,656,514 (GRCm39) V233I probably benign Het
Garre1 C T 7: 33,945,185 (GRCm39) R565K probably benign Het
Garre1 C T 7: 33,938,533 (GRCm39) V1001M probably benign Het
Garre1 G A 7: 33,938,583 (GRCm39) A984V probably benign Het
Gcn1 C T 5: 115,713,352 (GRCm39) P105L possibly damaging Het
Gemin5 T C 11: 58,016,044 (GRCm39) S1321G probably benign Het
Gemin5 T C 11: 58,020,897 (GRCm39) M1097V probably benign Het
Gemin5 C G 11: 58,030,336 (GRCm39) A830P probably benign Het
Gemin5 C G 11: 58,013,115 (GRCm39) S1446T probably benign Het
Gemin5 C G 11: 58,037,345 (GRCm39) E623D probably benign Het
Gemin5 C G 11: 58,030,401 (GRCm39) C808S probably benign Het
Gjc2 T C 11: 59,067,259 (GRCm39) S408G unknown Het
Gjc2 A G,T 11: 59,067,318 (GRCm39) V388E unknown Het
Gjc2 ACCCTCCCT ACCCTCCCTCCCT 11: 59,073,561 (GRCm39) probably benign Het
Glp2r C G 11: 67,600,472 (GRCm39) G459A probably benign Het
Glp2r C T 11: 67,630,993 (GRCm39) V295I probably benign Het
Glp2r A G 11: 67,631,878 (GRCm39) V283A probably benign Het
Glp2r C A 11: 67,600,470 (GRCm39) V460F probably benign Het
Glp2r T C 11: 67,631,885 (GRCm39) I281V probably benign Het
Glp2r T C 11: 67,633,129 (GRCm39) T235A probably benign Het
Glp2r A G 11: 67,635,773 (GRCm39) V189A probably benign Het
Glp2r C A 11: 67,661,662 (GRCm39) A13S probably benign Het
Glp2r C A 11: 67,600,394 (GRCm39) R485L probably damaging Het
Gm12253 A C 11: 58,325,686 (GRCm39) E52D probably benign Het
Gm12253 A C 11: 58,326,237 (GRCm39) E84A probably benign Het
Gm12253 G A 11: 58,326,309 (GRCm39) S108N probably benign Het
Gm12253 G A 11: 58,331,835 (GRCm39) A215T possibly damaging Het
Gm12253 G C 11: 58,325,367 (GRCm39) S13T possibly damaging Het
Gm12253 A G 11: 58,325,658 (GRCm39) E43G probably benign Het
Gm12258 G A 11: 58,749,764 (GRCm39) R313H unknown Het
Gm12258 G A 11: 58,749,776 (GRCm39) G317E unknown Het
Gm12258 A T 11: 58,749,833 (GRCm39) E336V unknown Het
Gm12258 A G 11: 58,750,013 (GRCm39) probably benign Het
Gm12258 T A 11: 58,750,014 (GRCm39) probably benign Het
Gm12258 G C 11: 58,750,690 (GRCm39) G622R unknown Het
Gm12258 T G 11: 58,749,126 (GRCm39) S100R Het
Gm12258 C T 11: 58,749,262 (GRCm39) R146W Het
Gm6096 G A 7: 33,950,817 (GRCm39) V119I possibly damaging Het
Gm6096 G A 7: 33,950,811 (GRCm39) A117T possibly damaging Het
Gpatch1 C T 7: 34,997,079 (GRCm39) R373Q possibly damaging Het
Gpatch1 C T 7: 34,980,797 (GRCm39) G908R unknown Het
Gpatch1 G C 7: 35,017,770 (GRCm39) D23E probably benign Het
Gpi1 T C 7: 33,926,662 (GRCm39) N95D probably benign Het
Gps2 C T 11: 69,807,130 (GRCm39) A60V probably benign Het
Grxcr1 G T 5: 68,323,532 (GRCm39) C270F probably damaging Het
Gucy2e C G 11: 69,127,429 (GRCm39) G15R unknown Het
Gucy2e C A 11: 69,114,431 (GRCm39) A1033S probably benign Het
Guk1 G A 11: 59,082,747 (GRCm39) probably benign Het
Haspin A G 11: 73,028,777 (GRCm39) L104P probably benign Het
Haspin T C 11: 73,028,174 (GRCm39) Q305R probably benign Het
Hes7 T C 11: 69,013,782 (GRCm39) S214P probably benign Het
Hic1 GGGAGG GGG 11: 75,060,276 (GRCm39) probably benign Het
Hic1 GGGGAGGG GGGG 11: 75,060,275 (GRCm39) probably null Het
Hic1 GGGGGAGGGGA GGGGGA 11: 75,060,274 (GRCm39) probably null Het
Hic1 G A 11: 75,058,352 (GRCm39) T179M probably damaging Het
Iba57 CAGA CAGAGA 11: 59,052,329 (GRCm39) probably null Het
Iba57 C G 11: 59,053,865 (GRCm39) G36R unknown Het
Iba57 T C 11: 59,052,384 (GRCm39) T86A unknown Het
Iba57 T C 11: 59,052,381 (GRCm39) T87A unknown Het
Iba57 A AGC 11: 59,052,332 (GRCm39) probably null Het
Igf1r GGAGCTGGAGAT GGAGCTGGAGATCGAGCTGGAGAT 7: 67,875,918 (GRCm39) probably benign Het
Igf1r GCTGGAGATGGA GCTGGAGATGGACCTGGAGATGGA 7: 67,875,921 (GRCm39) probably benign Het
Igtp T G 11: 58,097,169 (GRCm39) D113E probably damaging Het
Igtp C G 11: 58,097,791 (GRCm39) L321V possibly damaging Het
Igtp C G 11: 58,097,944 (GRCm39) L372V probably benign Het
Il2rg A G X: 100,308,987 (GRCm39) F307L probably damaging Het
Inpp5d C G 1: 87,611,492 (GRCm39) Q315E probably benign Het
Irgm2 T C 11: 58,110,738 (GRCm39) I143T probably benign Het
Irgm2 T C 11: 58,110,780 (GRCm39) L157S probably benign Het
Irgm2 G A 11: 58,110,833 (GRCm39) V175I probably benign Het
Irgm2 G A 11: 58,110,924 (GRCm39) S205N probably benign Het
Irgm2 A C 11: 58,110,951 (GRCm39) H214P probably benign Het
Irgm2 G T 11: 58,111,238 (GRCm39) A310S possibly damaging Het
Irgm2 C G 11: 58,111,389 (GRCm39) T360S probably benign Het
Irgm2 T A 11: 58,110,339 (GRCm39) V10D probably benign Het
Irgm2 A G 11: 58,110,389 (GRCm39) N27D probably benign Het
Itgae A T 11: 72,994,786 (GRCm39) Q46L probably damaging Het
Itgae A G 11: 73,006,466 (GRCm39) H378R probably benign Het
Itgae G A 11: 73,008,913 (GRCm39) V465I probably benign Het
Itgae A T 11: 73,012,757 (GRCm39) K696N probably benign Het
Itgae G T 11: 73,012,783 (GRCm39) G705V probably benign Het
Itgae C G 11: 73,024,953 (GRCm39) S1028W probably benign Het
Itgae T A 11: 72,994,713 (GRCm39) L22M possibly damaging Het
Kif1c C T 11: 70,614,940 (GRCm39) P578L probably benign Het
Krt26 C T 11: 99,228,643 (GRCm39) G30R probably damaging Het
Lama1 A G 17: 68,105,639 (GRCm39) D2049G Het
Larp1 G A 11: 57,933,166 (GRCm39) V257I probably benign Het
Lgr6 C T 1: 134,921,748 (GRCm39) A199T probably damaging Het
Lypd8 C A 11: 58,275,475 (GRCm39) A70E possibly damaging Het
Lypd8 G A 11: 58,275,489 (GRCm39) E75K probably benign Het
Lypd8 T C 11: 58,273,601 (GRCm39) Y27H probably benign Het
Lypd8l A G 11: 58,503,387 (GRCm39) L47P probably benign Het
Lypd8l T G 11: 58,503,397 (GRCm39) S44R probably benign Het
Lypd8l G A 11: 58,499,335 (GRCm39) P161L probably benign Het
Malrd1 G A 2: 16,047,037 (GRCm39) S1721N unknown Het
Mapk7 CGCTGGTGCTGG CGCTGGTGCTGGTGCTGG 11: 61,381,038 (GRCm39) probably benign Het
Mctp2 A G 7: 71,835,568 (GRCm39) L543P probably damaging Het
Mfap3 A T 11: 57,418,866 (GRCm39) I9F possibly damaging Het
Mfap3 G A 11: 57,418,902 (GRCm39) G21S probably benign Het
Mrpl22 G A 11: 58,062,521 (GRCm39) A4T unknown Het
Mrpl55 A G 11: 59,094,999 (GRCm39) probably null Het
Mrpl55 A T 11: 59,095,415 (GRCm39) L26F probably benign Het
Myh1 A C 11: 67,095,272 (GRCm39) T211P probably benign Het
Myh8 A C 11: 67,188,312 (GRCm39) N991T probably benign Het
Myo6 G T 9: 80,149,509 (GRCm39) E152* probably null Het
Myocd A G 11: 65,075,418 (GRCm39) S697P probably benign Het
Nlgn2 A G 11: 69,719,220 (GRCm39) V210A possibly damaging Het
Nlrp1a T C 11: 71,014,914 (GRCm39) E112G probably benign Het
Nlrp1a T C 11: 70,990,442 (GRCm39) I1038V probably benign Het
Nlrp1a C T 11: 70,988,077 (GRCm39) R1131Q probably damaging Het
Nlrp1a T C 11: 70,983,069 (GRCm39) K1299R probably benign Het
Nlrp1a C G 11: 71,033,355 (GRCm39) probably null Het
Nlrp1b C A 11: 71,072,534 (GRCm39) M436I probably benign Het
Nlrp1b T C 11: 71,073,503 (GRCm39) I113M probably benign Het
Nlrp1b T A 11: 71,073,396 (GRCm39) Q149L probably benign Het
Nlrp1b A T 11: 71,073,378 (GRCm39) M155K probably benign Het
Nlrp1b C G 11: 71,073,370 (GRCm39) E158Q probably benign Het
Nlrp1b T C 11: 71,073,280 (GRCm39) T188A probably benign Het
Nlrp1b A T 11: 71,073,266 (GRCm39) D192E probably benign Het
Nlrp1b A G 11: 71,073,148 (GRCm39) Y232H probably benign Het
Nlrp1b G C 11: 71,073,135 (GRCm39) T236R probably benign Het
Nlrp1b A G 11: 71,072,625 (GRCm39) I406T probably benign Het
Nlrp1b A C 11: 71,072,539 (GRCm39) S435A probably benign Het
Nmur2 T C 11: 55,931,104 (GRCm39) I202M probably benign Het
Obscn G T 11: 58,984,334 (GRCm39) A1707D possibly damaging Het
Obscn C T 11: 58,984,335 (GRCm39) A1707T probably benign Het
Obscn G A 11: 58,984,385 (GRCm39) A1690V probably benign Het
Obscn C T 11: 58,990,735 (GRCm39) A1613T possibly damaging Het
Obscn T C 11: 58,990,755 (GRCm39) H1606R probably benign Het
Obscn C G 11: 58,994,167 (GRCm39) A1572P probably damaging Het
Obscn T C 11: 58,994,340 (GRCm39) H1514R probably benign Het
Obscn G A 11: 58,994,364 (GRCm39) A1506V probably benign Het
Obscn T C 11: 59,003,380 (GRCm39) E1306G probably benign Het
Obscn T C 11: 59,003,462 (GRCm39) M1279V probably benign Het
Obscn T C 11: 59,013,563 (GRCm39) M1095V probably benign Het
Obscn A G 11: 59,013,664 (GRCm39) V1061A probably benign Het
Obscn C T 11: 59,018,892 (GRCm39) A949T probably benign Het
Obscn C T 11: 59,018,895 (GRCm39) V973M probably damaging Het
Obscn C T 11: 59,019,075 (GRCm39) A888T probably damaging Het
Obscn T C 11: 59,020,513 (GRCm39) M844V probably benign Het
Obscn G T 11: 59,020,663 (GRCm39) L794M probably benign Het
Obscn C T 11: 59,021,449 (GRCm39) R797H probably damaging Het
Obscn C T 11: 59,023,937 (GRCm39) A578T possibly damaging Het
Obscn G A 11: 59,024,066 (GRCm39) P535S probably damaging Het
Obscn C G 11: 59,024,072 (GRCm39) A533P probably benign Het
Obscn T C 11: 59,026,505 (GRCm39) I233V probably benign Het
Obscn G A 11: 58,933,878 (GRCm39) R5329C probably benign Het
Obscn C T 11: 58,940,306 (GRCm39) D5354N Het
Obscn C A 11: 58,940,614 (GRCm39) R4593S possibly damaging Het
Obscn T C 11: 58,940,623 (GRCm39) T5307A Het
Obscn G A 11: 58,942,383 (GRCm39) T4372M probably benign Het
Obscn T C 11: 58,943,439 (GRCm39) M4237V probably benign Het
Obscn C T 11: 58,944,594 (GRCm39) R4700Q probably benign Het
Obscn T C 11: 58,944,651 (GRCm39) K4681R probably benign Het
Obscn T C 11: 58,945,044 (GRCm39) E4658G probably benign Het
Obscn C T 11: 58,945,176 (GRCm39) R4614Q probably benign Het
Obscn T C 11: 58,945,660 (GRCm39) T4184A probably benign Het
Obscn C T 11: 58,946,283 (GRCm39) R4474H probably damaging Het
Obscn T C 11: 58,946,331 (GRCm39) D4458G probably damaging Het
Obscn C T 11: 58,946,340 (GRCm39) R4455K probably benign Het
Obscn G T 11: 58,946,936 (GRCm39) A4066E possibly damaging Het
Obscn A G 11: 58,947,595 (GRCm39) M4478T Het
Obscn C A 11: 58,951,823 (GRCm39) G3977W probably damaging Het
Obscn C T 11: 58,952,388 (GRCm39) G3894R probably benign Het
Obscn C T 11: 58,952,408 (GRCm39) R3887K probably benign Het
Obscn G C 11: 58,952,959 (GRCm39) P4115A probably benign Het
Obscn C T 11: 58,952,965 (GRCm39) D4113N probably damaging Het
Obscn CCACACACACACAC CCACACACACAC 11: 58,954,279 (GRCm39) probably null Het
Obscn T C 11: 58,954,300 (GRCm39) T4037A Het
Obscn G A 11: 58,891,715 (GRCm39) A6939V probably benign Het
Obscn C G 11: 58,900,019 (GRCm39) G938A probably benign Het
Obscn G C 11: 58,904,014 (GRCm39) T7320S probably benign Het
Obscn C T 11: 58,921,934 (GRCm39) R5954Q probably damaging Het
Obscn G C 11: 58,929,976 (GRCm39) P5080A probably benign Het
Obscn T A 11: 58,929,990 (GRCm39) Q5075L probably damaging Het
Obscn T C 11: 58,932,601 (GRCm39) I4869V probably benign Het
Obscn T A 11: 58,932,674 (GRCm39) probably null Het
Obscn T C 11: 58,933,776 (GRCm39) T5363A probably benign Het
Obscn G A 11: 58,933,853 (GRCm39) A5337V probably benign Het
Obscn T C 11: 58,954,402 (GRCm39) K3727E probably damaging Het
Obscn C T 11: 58,984,239 (GRCm39) V1739M possibly damaging Het
Obscn A G 11: 58,984,142 (GRCm39) F1771S probably benign Het
Obscn T C 11: 58,981,573 (GRCm39) H1815R probably benign Het
Obscn A G 11: 58,977,565 (GRCm39) V1845A probably benign Het
Obscn T C 11: 58,977,527 (GRCm39) R1858G probably benign Het
Obscn C T 11: 58,977,505 (GRCm39) R1865H probably benign Het
Obscn C A 11: 58,972,698 (GRCm39) G2116V possibly damaging Het
Obscn C G 11: 58,970,722 (GRCm39) V2328L probably benign Het
Obscn G A 11: 58,969,984 (GRCm39) R53C probably damaging Het
Obscn C T 11: 58,967,334 (GRCm39) V2792I possibly damaging Het
Obscn C A 11: 58,960,757 (GRCm39) A3185S probably benign Het
Obscn C T 11: 58,958,655 (GRCm39) V3433I probably benign Het
Obscn G A 11: 58,957,973 (GRCm39) R3576C probably benign Het
Or11l3 G A 11: 58,516,075 (GRCm39) S79F probably benign Het
Or11l3 A C 11: 58,516,732 (GRCm39) C46G possibly damaging Het
Or11l3 T G 11: 58,516,619 (GRCm39) K84N probably benign Het
Or11l3 G A 11: 58,516,588 (GRCm39) P95S probably benign Het
Or11l3 C G 11: 58,516,130 (GRCm39) G61R probably benign Het
Or2ab1 A C 11: 58,488,344 (GRCm39) I35L probably benign Het
Or2ab1 A G 11: 58,488,776 (GRCm39) S179G probably benign Het
Or2ab1 A G 11: 58,488,491 (GRCm39) S84G possibly damaging Het
Or2ab1 A G 11: 58,488,356 (GRCm39) I39V probably benign Het
Or2ak4 C T 11: 58,648,895 (GRCm39) L135F probably benign Het
Or2ak4 G A 11: 58,648,793 (GRCm39) A101T probably benign Het
Or2ak4 A C 11: 58,649,186 (GRCm39) K232Q probably benign Het
Or2ak4 A C 11: 58,649,168 (GRCm39) I226L probably benign Het
Or2ak4 G A 11: 58,649,153 (GRCm39) V221M probably damaging Het
Or2ak4 A G 11: 58,648,931 (GRCm39) S147G probably benign Het
Or2ak5 G A 11: 58,611,922 (GRCm39) probably benign Het
Or2ak6 C T 11: 58,593,153 (GRCm39) L209F possibly damaging Het
Or2ak6 A C 11: 58,592,784 (GRCm39) I86L probably benign Het
Or2ak6 C A 11: 58,593,222 (GRCm39) Q232K probably benign Het
Or2ak7 G T 11: 58,574,758 (GRCm39) D20Y probably benign Het
Or2ak7 T C 11: 58,575,548 (GRCm39) L283P probably benign Het
Or2ak7 G A 11: 58,575,541 (GRCm39) V281I probably benign Het
Or2ak7 C T 11: 58,575,289 (GRCm39) H197Y probably benign Het
Or2ak7 G A 11: 58,575,083 (GRCm39) R128Q probably benign Het
Or2ak7 G A 11: 58,574,941 (GRCm39) V81M probably benign Het
Or2ak7 T C 11: 58,574,815 (GRCm39) F39L probably benign Het
Or2av9 T C 11: 58,381,314 (GRCm39) Q89R probably benign Het
Or2av9 C A 11: 58,380,574 (GRCm39) E336* probably null Het
Or2av9 C T 11: 58,381,123 (GRCm39) A153T probably benign Het
Or2t29 G T 11: 58,434,272 (GRCm39) S23Y probably benign Het
Or2t43 C T 11: 58,457,920 (GRCm39) V84I probably benign Het
Or2t43 G A 11: 58,457,388 (GRCm39) A261V probably benign Het
Or2t43 A T 11: 58,457,521 (GRCm39) S217T probably benign Het
Or2t44 A G 11: 58,677,773 (GRCm39) T238A probably damaging Het
Or2t46 G A 11: 58,471,828 (GRCm39) V53I probably benign Het
Or2t46 T G 11: 58,472,122 (GRCm39) L151V probably benign Het
Or2t46 G C 11: 58,472,483 (GRCm39) S271T probably benign Het
Or2t46 C T 11: 58,471,750 (GRCm39) H27Y probably benign Het
Or2t46 T C 11: 58,471,757 (GRCm39) V29A probably benign Het
Or2t47 C T 11: 58,442,940 (GRCm39) A42T probably benign Het
Or2t47 T C 11: 58,442,387 (GRCm39) K226R probably benign Het
Or2t47 C T 11: 58,442,801 (GRCm39) S88N probably benign Het
Or2t49 C A 11: 58,392,936 (GRCm39) V155F probably benign Het
Or2t49 GGTGGATTGGTATGTGGAT GGTGGAT 11: 58,393,212 (GRCm39) probably benign Het
Or2t49 C G 11: 58,393,287 (GRCm39) V38L probably benign Het
Or2t49 C T 11: 58,393,396 (GRCm39) M1I probably null Het
Or2t49 T C 11: 58,392,474 (GRCm39) M309V probably benign Het
Or2t49 T C 11: 58,392,927 (GRCm39) I158V probably benign Het
Or2w3 T G 11: 58,557,342 (GRCm39) I319R probably benign Het
Or2w3b T G 11: 58,623,200 (GRCm39) N264H probably benign Het
Or2w3b C A 11: 58,624,048 (GRCm39) probably benign Het
Or2w3b T C 11: 58,623,475 (GRCm39) H172R probably benign Het
Or2w3b G A 11: 58,623,295 (GRCm39) A232V probably benign Het
Or5af2 T C 11: 58,708,122 (GRCm39) V96A probably benign Het
Or5af2 A G 11: 58,707,887 (GRCm39) I18V probably benign Het
Or5af2 C G 11: 58,708,644 (GRCm39) P270R probably benign Het
Or5af2 T C 11: 58,708,508 (GRCm39) C225R probably benign Het
Or5af2 C G 11: 58,708,243 (GRCm39) H136Q probably benign Het
Or5af2 A C 11: 58,708,220 (GRCm39) I129L probably benign Het
Or6c69 G C 10: 129,747,826 (GRCm39) A107G possibly damaging Het
Or8g17 T A 9: 38,930,229 (GRCm39) S203C probably damaging Het
Or8k33 T C 2: 86,384,471 (GRCm39) probably benign Het
Or9e1 G T 11: 58,731,945 (GRCm39) A2S probably benign Het
Or9e1 G C 11: 58,731,907 (GRCm39) probably benign Het
Or9e1 A G 11: 58,732,615 (GRCm39) H225R probably benign Het
Or9e1 C T 11: 58,732,032 (GRCm39) L31F probably benign Het
Or9e1 T C 11: 58,732,084 (GRCm39) I48T probably benign Het
Or9e1 G A 11: 58,732,569 (GRCm39) A210T probably benign Het
Ovca2 T C 11: 75,069,528 (GRCm39) T32A probably benign Het
Pimreg G A 11: 71,935,979 (GRCm39) R154H probably damaging Het
Pimreg TCACA TCA 11: 71,935,801 (GRCm39) probably benign Het
Pitpnm3 C T 11: 72,010,969 (GRCm39) R21Q probably benign Het
Pitpnm3 T C 11: 71,954,955 (GRCm39) K520E probably benign Het
Prpsap2 A C 11: 61,647,078 (GRCm39) V21G possibly damaging Het
Rabep1 C CT 11: 70,830,910 (GRCm39) probably null Het
Rai1 A G 11: 60,078,389 (GRCm39) N818D probably benign Het
Rap1gap2 C T 11: 74,487,721 (GRCm39) E52K probably benign Het
Rbm6 G T 9: 107,655,171 (GRCm39) S1020Y probably damaging Het
Rhpn2 G T 7: 35,084,826 (GRCm39) E573D probably benign Het
Rnf112 A G 11: 61,341,775 (GRCm39) L343P unknown Het
Rnf167 CTT CACAGGGATT 11: 70,541,646 (GRCm39) probably null Het
Rpp40 C T 13: 36,080,739 (GRCm39) V355I probably benign Het
Rtn4rl1 C T 11: 75,156,863 (GRCm39) P432S probably benign Het
Setd5 C A 6: 113,091,957 (GRCm39) N259K probably benign Het
Shisa6 TGGCCGC TGGCCGCGGCCGC 11: 66,416,517 (GRCm39) probably benign Het
Sidt1 A G 16: 44,078,294 (GRCm39) probably null Het
Slc2a4 GCC G 11: 69,834,819 (GRCm39) probably null Het
Slc2a4 GGCCG GG 11: 69,834,818 (GRCm39) probably benign Het
Slc39a9 G C 12: 80,691,502 (GRCm39) probably benign Het
Slc7a10 A G 7: 34,885,956 (GRCm39) H17R probably benign Het
Smcr8 T C 11: 60,669,932 (GRCm39) V360A probably benign Het
Smcr8 A G 11: 60,668,806 (GRCm39) probably benign Het
Smcr8 C A 11: 60,670,699 (GRCm39) R616S probably benign Het
Smg6 G T 11: 75,047,092 (GRCm39) A1262S probably benign Het
Sp140 G C 1: 85,569,524 (GRCm39) R378T probably damaging Het
Spns3 T C 11: 72,440,863 (GRCm39) I58V probably benign Het
Spns3 T C 11: 72,440,986 (GRCm39) S17G probably benign Het
Spns3 G A 11: 72,440,917 (GRCm39) P40S probably benign Het
Srebf1 C T 11: 60,097,061 (GRCm39) V256M probably benign Het
Sycp2 C A 2: 177,992,662 (GRCm39) R1296L probably benign Het
Tbata G C 10: 61,022,172 (GRCm39) E337D probably benign Het
Tekt1 T C 11: 72,250,597 (GRCm39) Q33R probably benign Het
Thop1 C T 10: 80,909,043 (GRCm39) R25C probably damaging Het
Tmem102 C G 11: 69,695,902 (GRCm39) G53A possibly damaging Het
Tmem102 G C 11: 69,695,927 (GRCm39) R45G probably benign Het
Tmem11 A G 11: 60,766,658 (GRCm39) probably benign Het
Tom1l2 C T 11: 60,132,682 (GRCm39) A414T probably benign Het
Top3a C T 11: 60,641,410 (GRCm39) G425S probably benign Het
Trim16 C T 11: 62,711,428 (GRCm39) A33V probably benign Het
Trim16 C A 11: 62,731,675 (GRCm39) D515E probably benign Het
Trim16 T C 11: 62,731,572 (GRCm39) V481A probably benign Het
Trim16 G A 11: 62,727,643 (GRCm39) E322K probably benign Het
Trim16 TGAAGA TGAAGAAGA 11: 62,711,516 (GRCm39) probably benign Het
Trim16 G C 11: 62,711,502 (GRCm39) V58L probably benign Het
Trim17 G A 11: 58,856,331 (GRCm39) M129I probably benign Het
Trim17 A G 11: 58,861,272 (GRCm39) N259S probably benign Het
Trim58 C A 11: 58,531,684 (GRCm39) L131M possibly damaging Het
Trim58 A G 11: 58,542,486 (GRCm39) N482S probably benign Het
Trpv1 C G 11: 73,131,427 (GRCm39) P322A possibly damaging Het
Trpv1 C A 11: 73,145,117 (GRCm39) D734E probably benign Het
Trpv3 G A 11: 73,169,803 (GRCm39) A125T probably benign Het
Trpv3 C T 11: 73,160,513 (GRCm39) A9V probably benign Het
Trpv3 A G 11: 73,174,502 (GRCm39) T290A probably benign Het
Tshz3 T C 7: 36,468,341 (GRCm39) I110T probably benign Het
Tshz3 A G 7: 36,469,999 (GRCm39) S663G probably benign Het
Tvp23b A C 11: 62,772,769 (GRCm39) N7H possibly damaging Het
Ubap2l G T 3: 89,916,543 (GRCm39) H915Q unknown Het
Usp43 C T 11: 67,747,332 (GRCm39) G792S probably benign Het
Usp43 AGGGC AGGGCAGGGGATGAACCTCGGGC 11: 67,746,545 (GRCm39) probably benign Het
Utrn C T 10: 12,545,491 (GRCm39) R1718H probably damaging Het
Vamp2 C T 11: 68,979,411 (GRCm39) probably benign Het
Vamp2 G A 11: 68,980,889 (GRCm39) G124R possibly damaging Het
Wfdc6b C T 2: 164,455,591 (GRCm39) probably benign Het
Xaf1 T TAGCCAGCC 11: 72,199,849 (GRCm39) probably null Het
Xaf1 GGCT GGCTGGCCAGCT 11: 72,199,846 (GRCm39) probably null Het
Xaf1 T G 11: 72,199,792 (GRCm39) C176W unknown Het
Xaf1 A G 11: 72,199,476 (GRCm39) E71G probably benign Het
Xaf1 C A 11: 72,197,434 (GRCm39) L137I probably benign Het
Xaf1 G C 11: 72,197,429 (GRCm39) C135S probably damaging Het
Xaf1 G A 11: 72,197,426 (GRCm39) R134H probably benign Het
Xaf1 T C 11: 72,199,881 (GRCm39) L206S unknown Het
Xaf1 G C 11: 72,199,856 (GRCm39) V198L unknown Het
Zbtb1 A G 12: 76,432,023 (GRCm39) K3R probably benign Het
Zfp286 G A 11: 62,675,782 (GRCm39) T60M probably damaging Het
Zfp286 A G 11: 62,678,795 (GRCm39) V44A probably benign Het
Zfp287 C G 11: 62,606,175 (GRCm39) C244S probably benign Het
Zfp287 G A 11: 62,613,757 (GRCm39) R225* probably null Het
Zfp287 C T 11: 62,604,633 (GRCm39) R758H probably benign Het
Zfp39 G C 11: 58,781,130 (GRCm39) T544R possibly damaging Het
Zfp39 A C 11: 58,780,873 (GRCm39) Y630D probably benign Het
Zfp39 G C 11: 58,780,871 (GRCm39) Y630* probably null Het
Zfp39 T G 11: 58,791,409 (GRCm39) S93R probably benign Het
Zfp39 G T 11: 58,791,407 (GRCm39) S93R probably benign Het
Zfp39 T C 11: 58,782,142 (GRCm39) K207E probably benign Het
Zfp39 A G 11: 58,782,123 (GRCm39) I213T probably benign Het
Zfp39 T A 11: 58,781,967 (GRCm39) H265L probably damaging Het
Zfp39 T A 11: 58,781,751 (GRCm39) K337M probably benign Het
Zfp39 G C 11: 58,781,273 (GRCm39) D496E probably benign Het
Zfp39 T C 11: 58,781,274 (GRCm39) D496G possibly damaging Het
Zfp39 T C 11: 58,781,526 (GRCm39) N412S possibly damaging Het
Zfp39 G T 11: 58,781,597 (GRCm39) N388K probably benign Het
Zfp39 A G 11: 58,781,605 (GRCm39) S386P probably benign Het
Zfp39 A C 11: 58,781,702 (GRCm39) H353Q probably damaging Het
Zfp39 A C 11: 58,781,712 (GRCm39) V350G probably benign Het
Zfp39 A G 11: 58,781,724 (GRCm39) V346A probably benign Het
Zfp536 C T 7: 37,178,985 (GRCm39) G1207S probably benign Het
Zfp536 T A 7: 37,179,908 (GRCm39) Y899F probably benign Het
Zfp536 T C 7: 37,179,498 (GRCm39) T1036A probably benign Het
Zfp672 G T 11: 58,220,452 (GRCm39) T49K unknown Het
Zfp672 C A 11: 58,220,786 (GRCm39) probably benign Het
Zfp692 G T 11: 58,199,859 (GRCm39) E149D probably benign Het
Zfp692 G A 11: 58,200,844 (GRCm39) V242I probably benign Het
Zzef1 G A 11: 72,780,008 (GRCm39) R1927H probably benign Het
Other mutations in Cntrob
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02975:Cntrob APN 11 69,210,199 (GRCm39) missense possibly damaging 0.66
IGL03173:Cntrob APN 11 69,200,853 (GRCm39) missense possibly damaging 0.90
groats UTSW 11 69,200,317 (GRCm39) nonsense probably null
BB005:Cntrob UTSW 11 69,191,121 (GRCm39) missense probably damaging 0.97
BB015:Cntrob UTSW 11 69,191,121 (GRCm39) missense probably damaging 0.97
R0270:Cntrob UTSW 11 69,202,167 (GRCm39) missense possibly damaging 0.66
R0501:Cntrob UTSW 11 69,213,694 (GRCm39) missense probably damaging 1.00
R1749:Cntrob UTSW 11 69,213,700 (GRCm39) missense probably damaging 0.99
R1775:Cntrob UTSW 11 69,211,693 (GRCm39) missense possibly damaging 0.90
R1900:Cntrob UTSW 11 69,198,880 (GRCm39) missense probably benign 0.27
R1967:Cntrob UTSW 11 69,211,789 (GRCm39) missense probably damaging 0.97
R2495:Cntrob UTSW 11 69,213,749 (GRCm39) missense probably damaging 0.96
R3121:Cntrob UTSW 11 69,213,526 (GRCm39) nonsense probably null
R3780:Cntrob UTSW 11 69,193,708 (GRCm39) missense probably damaging 0.97
R4449:Cntrob UTSW 11 69,196,375 (GRCm39) missense probably benign 0.29
R4696:Cntrob UTSW 11 69,211,714 (GRCm39) missense probably damaging 1.00
R4841:Cntrob UTSW 11 69,206,220 (GRCm39) missense possibly damaging 0.92
R4842:Cntrob UTSW 11 69,206,220 (GRCm39) missense possibly damaging 0.92
R4908:Cntrob UTSW 11 69,211,732 (GRCm39) missense probably damaging 0.97
R4982:Cntrob UTSW 11 69,202,188 (GRCm39) splice site probably null
R5168:Cntrob UTSW 11 69,190,816 (GRCm39) missense possibly damaging 0.66
R5187:Cntrob UTSW 11 69,212,717 (GRCm39) missense possibly damaging 0.62
R5307:Cntrob UTSW 11 69,205,576 (GRCm39) missense possibly damaging 0.66
R5473:Cntrob UTSW 11 69,213,579 (GRCm39) missense possibly damaging 0.81
R5903:Cntrob UTSW 11 69,200,201 (GRCm39) missense possibly damaging 0.83
R6643:Cntrob UTSW 11 69,202,248 (GRCm39) missense possibly damaging 0.46
R6742:Cntrob UTSW 11 69,213,749 (GRCm39) missense probably damaging 0.96
R6964:Cntrob UTSW 11 69,200,317 (GRCm39) nonsense probably null
R7020:Cntrob UTSW 11 69,193,918 (GRCm39) critical splice donor site probably null
R7425:Cntrob UTSW 11 69,205,560 (GRCm39) nonsense probably null
R7928:Cntrob UTSW 11 69,191,121 (GRCm39) missense probably damaging 0.97
R7946:Cntrob UTSW 11 69,206,047 (GRCm39) missense possibly damaging 0.82
R8348:Cntrob UTSW 11 69,190,679 (GRCm39) missense unknown
R8448:Cntrob UTSW 11 69,190,679 (GRCm39) missense unknown
R8539:Cntrob UTSW 11 69,211,652 (GRCm39) missense possibly damaging 0.94
R9259:Cntrob UTSW 11 69,211,665 (GRCm39) missense possibly damaging 0.81
R9415:Cntrob UTSW 11 69,193,741 (GRCm39) missense possibly damaging 0.66
R9553:Cntrob UTSW 11 69,205,679 (GRCm39) missense probably benign 0.00
R9626:Cntrob UTSW 11 69,202,167 (GRCm39) missense possibly damaging 0.66
R9628:Cntrob UTSW 11 69,213,782 (GRCm39) missense possibly damaging 0.66
R9801:Cntrob UTSW 11 69,212,233 (GRCm39) missense possibly damaging 0.82
Z1177:Cntrob UTSW 11 69,202,275 (GRCm39) missense possibly damaging 0.66
Z1186:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1186:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1187:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1187:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1188:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1188:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1189:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1189:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1190:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1190:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1191:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1192:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1192:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Predicted Primers
Posted On 2021-03-08