Incidental Mutation 'Z1191:Hic1'
ID 667379
Institutional Source Beutler Lab
Gene Symbol Hic1
Ensembl Gene ENSMUSG00000043099
Gene Name hypermethylated in cancer 1
Synonyms HIC-1
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.368) question?
Stock # Z1191 ()
Quality Score 221.999
Status Not validated
Chromosome 11
Chromosomal Location 75055391-75060345 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 75058352 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 179 (T179M)
Ref Sequence ENSEMBL: ENSMUSP00000053483 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045281] [ENSMUST00000055619]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000045281
SMART Domains Protein: ENSMUSP00000043555
Gene: ENSMUSG00000038290

DomainStartEndE-ValueType
internal_repeat_1 42 99 7.68e-6 PROSPERO
internal_repeat_1 135 188 7.68e-6 PROSPERO
low complexity region 212 227 N/A INTRINSIC
low complexity region 257 271 N/A INTRINSIC
low complexity region 376 390 N/A INTRINSIC
low complexity region 417 426 N/A INTRINSIC
low complexity region 436 453 N/A INTRINSIC
low complexity region 538 549 N/A INTRINSIC
coiled coil region 574 600 N/A INTRINSIC
Pfam:EST1 637 742 1.8e-18 PFAM
Pfam:EST1_DNA_bind 750 1106 1.6e-78 PFAM
coiled coil region 1197 1234 N/A INTRINSIC
PINc 1245 1396 2.85e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000055619
AA Change: T179M

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000053483
Gene: ENSMUSG00000043099
AA Change: T179M

DomainStartEndE-ValueType
low complexity region 71 81 N/A INTRINSIC
low complexity region 192 200 N/A INTRINSIC
BTB 207 313 6.94e-24 SMART
low complexity region 318 340 N/A INTRINSIC
low complexity region 350 370 N/A INTRINSIC
Blast:BTB 375 398 1e-7 BLAST
low complexity region 415 437 N/A INTRINSIC
low complexity region 442 453 N/A INTRINSIC
low complexity region 464 486 N/A INTRINSIC
low complexity region 519 542 N/A INTRINSIC
ZnF_C2H2 597 619 1.08e-1 SMART
ZnF_C2H2 667 689 1.18e-2 SMART
ZnF_C2H2 695 717 9.36e-6 SMART
ZnF_C2H2 723 745 4.54e-4 SMART
ZnF_C2H2 751 773 5.21e-4 SMART
low complexity region 774 804 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130145
SMART Domains Protein: ENSMUSP00000120229
Gene: ENSMUSG00000038290

DomainStartEndE-ValueType
coiled coil region 35 61 N/A INTRINSIC
Pfam:EST1 99 204 1.3e-19 PFAM
Pfam:EST1_DNA_bind 212 339 7.3e-37 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene functions as a growth regulatory and tumor repressor gene. Hypermethylation or deletion of the region of this gene have been associated with tumors and the contiguous-gene syndrome, Miller-Dieker syndrome. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit varying abnormalities, such as acrania, exencephaly, cleft palate, limb defects, and omphalocele, and die perinatally. Heterozygotes develop tumors, including lymphomas, sarcomas, and epithelial cancers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 441 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700086D15Rik A G 11: 65,044,114 (GRCm39) W27R unknown Het
1700086D15Rik A G 11: 65,044,080 (GRCm39) F38S unknown Het
1700086D15Rik A C 11: 65,043,809 (GRCm39) V84G unknown Het
1700086D15Rik T A 11: 65,043,794 (GRCm39) Q89L unknown Het
1700086D15Rik A G 11: 65,044,128 (GRCm39) L22P unknown Het
1810065E05Rik C T 11: 58,313,027 (GRCm39) L27F probably benign Het
1810065E05Rik C T 11: 58,316,625 (GRCm39) L202F probably benign Het
1810065E05Rik C T 11: 58,313,060 (GRCm39) L38F possibly damaging Het
2810021J22Rik C T 11: 58,771,361 (GRCm39) A281V probably benign Het
4930438A08Rik A G 11: 58,184,844 (GRCm39) T521A unknown Het
4933427D14Rik G A 11: 72,067,535 (GRCm39) T585I possibly damaging Het
4933427D14Rik T G 11: 72,089,750 (GRCm39) S45R probably damaging Het
4933427D14Rik C A 11: 72,089,360 (GRCm39) A175S probably benign Het
4933427D14Rik G A 11: 72,089,308 (GRCm39) P192L probably benign Het
4933427D14Rik T C 11: 72,086,595 (GRCm39) Q272R probably damaging Het
4933427D14Rik T TCCCCAGC 11: 72,086,590 (GRCm39) probably null Het
4933427D14Rik T G 11: 72,086,580 (GRCm39) K277T probably damaging Het
4933427D14Rik A G 11: 72,086,569 (GRCm39) C281R possibly damaging Het
4933427D14Rik AAAAGTAA AAA 11: 72,086,538 (GRCm39) probably null Het
4933427D14Rik G T 11: 72,080,442 (GRCm39) P408H probably damaging Het
Adgrf5 C A 17: 43,755,926 (GRCm39) A628E probably benign Het
Akap10 T A 11: 61,806,096 (GRCm39) S211C probably benign Het
Alox8 C T 11: 69,076,873 (GRCm39) R536Q probably benign Het
Alox8 A G 11: 69,088,322 (GRCm39) V76A probably benign Het
Aloxe3 A G 11: 69,019,501 (GRCm39) Q138R probably benign Het
Aloxe3 C T 11: 69,039,429 (GRCm39) A667V probably benign Het
Arhgap21 C T 2: 20,886,283 (GRCm39) R308K probably benign Het
Arih1 T C 9: 59,393,605 (GRCm39) Y9C unknown Het
Asb9 A C X: 163,322,660 (GRCm39) *291Y probably null Het
Aspa G T 11: 73,213,013 (GRCm39) L110I probably benign Het
Atoh1 C A 6: 64,706,364 (GRCm39) H20N probably benign Het
Aurkb C T 11: 68,938,692 (GRCm39) R44W probably damaging Het
Aurkb T C 11: 68,938,696 (GRCm39) F45S probably benign Het
B9d1 A T 11: 61,396,029 (GRCm39) probably benign Het
Borcs6 G A 11: 68,951,453 (GRCm39) R277Q possibly damaging Het
Btnl10 T C 11: 58,810,138 (GRCm39) V93A probably benign Het
Btnl10 C T 11: 58,817,650 (GRCm39) T250I unknown Het
Btnl10 AGAC AGACGAC 11: 58,814,755 (GRCm39) probably benign Het
Btnl10 AAAGA AAAGAAGA 11: 58,814,753 (GRCm39) probably benign Het
Car10 G T 11: 93,195,462 (GRCm39) G90W probably damaging Het
Ccdc42 C T 11: 68,478,017 (GRCm39) probably benign Het
Ccdc92b A G 11: 74,520,880 (GRCm39) M61V possibly damaging Het
Ccdc93 T G 1: 121,403,797 (GRCm39) L309V probably benign Het
Celsr2 C T 3: 108,321,865 (GRCm39) G316S possibly damaging Het
Chd3 A G 11: 69,252,277 (GRCm39) W42R probably benign Het
Chd3 C A 11: 69,239,271 (GRCm39) E1753D probably benign Het
Chl1 T C 6: 103,660,172 (GRCm39) L350S probably damaging Het
Chrna7 G A 7: 62,755,941 (GRCm39) P202S probably benign Het
Chst8 C T 7: 34,447,606 (GRCm39) R4Q probably damaging Het
Cluh CGAGCCTGAGCCTGAGCC CGAGCCTGAGCCTGAGCCTGAGCC 11: 74,560,343 (GRCm39) probably benign Het
Cluh TGAGCC TGAGCCCGAGCC 11: 74,560,349 (GRCm39) probably benign Het
Cluh GCCTGA GCCTGAACCTGA 11: 74,560,352 (GRCm39) probably benign Het
Cluh GAGCC GAGCCTAAGCC 11: 74,560,356 (GRCm39) probably benign Het
Cluh CC CCACGAGC 11: 74,560,340 (GRCm39) probably benign Het
Cntrob G A 11: 69,198,882 (GRCm39) P622L probably benign Het
Cntrob C T 11: 69,196,404 (GRCm39) R677H probably benign Het
Cyb5d1 C A 11: 69,286,098 (GRCm39) A8S probably benign Het
Cyb5d1 A G 11: 69,286,028 (GRCm39) L31P probably benign Het
Dnah9 G A 11: 66,038,207 (GRCm39) H110Y probably benign Het
Dnah9 A C 11: 65,976,000 (GRCm39) S1350A probably benign Het
Elac2 T C 11: 64,870,015 (GRCm39) S27P probably benign Het
Epn2 C A 11: 61,470,460 (GRCm39) probably benign Het
Fam114a2 G A 11: 57,380,940 (GRCm39) A438V probably benign Het
Fam114a2 C T 11: 57,390,581 (GRCm39) V318I probably benign Het
Fam114a2 T C 11: 57,390,623 (GRCm39) N304D probably benign Het
Fam114a2 C T 11: 57,405,060 (GRCm39) G14E probably benign Het
Fam114a2 A G 11: 57,374,858 (GRCm39) S494P probably benign Het
Fam83g G A 11: 61,594,020 (GRCm39) R518Q probably benign Het
Fat2 T G 11: 55,200,625 (GRCm39) K816N probably benign Het
Fat2 TGTACCTCACCCCAGTACCT TGTACCT 11: 55,199,796 (GRCm39) probably null Het
Fbxw10 G C 11: 62,738,118 (GRCm39) R4T probably benign Het
Fbxw10 G A 11: 62,767,671 (GRCm39) V836I probably benign Het
Foxl2 G C 9: 98,838,122 (GRCm39) G137R probably damaging Het
Gabrg2 T C 11: 41,807,104 (GRCm39) I378V probably benign Het
Galnt10 G A 11: 57,656,514 (GRCm39) V233I probably benign Het
Garre1 G A 7: 33,938,583 (GRCm39) A984V probably benign Het
Garre1 C T 7: 33,945,185 (GRCm39) R565K probably benign Het
Garre1 C T 7: 33,938,533 (GRCm39) V1001M probably benign Het
Gcn1 C T 5: 115,713,352 (GRCm39) P105L possibly damaging Het
Gemin5 T C 11: 58,016,044 (GRCm39) S1321G probably benign Het
Gemin5 T C 11: 58,020,897 (GRCm39) M1097V probably benign Het
Gemin5 C G 11: 58,030,336 (GRCm39) A830P probably benign Het
Gemin5 C G 11: 58,030,401 (GRCm39) C808S probably benign Het
Gemin5 C G 11: 58,037,345 (GRCm39) E623D probably benign Het
Gemin5 C G 11: 58,013,115 (GRCm39) S1446T probably benign Het
Gjc2 A G,T 11: 59,067,318 (GRCm39) V388E unknown Het
Gjc2 ACCCTCCCT ACCCTCCCTCCCT 11: 59,073,561 (GRCm39) probably benign Het
Gjc2 T C 11: 59,067,259 (GRCm39) S408G unknown Het
Glp2r C G 11: 67,600,472 (GRCm39) G459A probably benign Het
Glp2r C T 11: 67,630,993 (GRCm39) V295I probably benign Het
Glp2r A G 11: 67,631,878 (GRCm39) V283A probably benign Het
Glp2r T C 11: 67,631,885 (GRCm39) I281V probably benign Het
Glp2r T C 11: 67,633,129 (GRCm39) T235A probably benign Het
Glp2r A G 11: 67,635,773 (GRCm39) V189A probably benign Het
Glp2r C A 11: 67,661,662 (GRCm39) A13S probably benign Het
Glp2r C A 11: 67,600,394 (GRCm39) R485L probably damaging Het
Glp2r C A 11: 67,600,470 (GRCm39) V460F probably benign Het
Gm12253 A C 11: 58,325,686 (GRCm39) E52D probably benign Het
Gm12253 A C 11: 58,326,237 (GRCm39) E84A probably benign Het
Gm12253 G A 11: 58,326,309 (GRCm39) S108N probably benign Het
Gm12253 G A 11: 58,331,835 (GRCm39) A215T possibly damaging Het
Gm12253 G C 11: 58,325,367 (GRCm39) S13T possibly damaging Het
Gm12253 A G 11: 58,325,658 (GRCm39) E43G probably benign Het
Gm12258 G C 11: 58,750,690 (GRCm39) G622R unknown Het
Gm12258 T A 11: 58,750,014 (GRCm39) probably benign Het
Gm12258 A G 11: 58,750,013 (GRCm39) probably benign Het
Gm12258 C T 11: 58,749,262 (GRCm39) R146W Het
Gm12258 A T 11: 58,749,833 (GRCm39) E336V unknown Het
Gm12258 G A 11: 58,749,776 (GRCm39) G317E unknown Het
Gm12258 G A 11: 58,749,764 (GRCm39) R313H unknown Het
Gm12258 T G 11: 58,749,126 (GRCm39) S100R Het
Gm21886 ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG 18: 80,133,040 (GRCm39) probably benign Het
Gm6096 G A 7: 33,950,817 (GRCm39) V119I possibly damaging Het
Gm6096 G A 7: 33,950,811 (GRCm39) A117T possibly damaging Het
Gpatch1 C T 7: 34,997,079 (GRCm39) R373Q possibly damaging Het
Gpatch1 C T 7: 34,980,797 (GRCm39) G908R unknown Het
Gpatch1 G C 7: 35,017,770 (GRCm39) D23E probably benign Het
Gpi1 T C 7: 33,926,662 (GRCm39) N95D probably benign Het
Gps2 C T 11: 69,807,130 (GRCm39) A60V probably benign Het
Grxcr1 G T 5: 68,323,532 (GRCm39) C270F probably damaging Het
Gucy2e C G 11: 69,127,429 (GRCm39) G15R unknown Het
Gucy2e C A 11: 69,114,431 (GRCm39) A1033S probably benign Het
Guk1 G A 11: 59,082,747 (GRCm39) probably benign Het
Haspin T C 11: 73,028,174 (GRCm39) Q305R probably benign Het
Haspin A G 11: 73,028,777 (GRCm39) L104P probably benign Het
Hes7 T C 11: 69,013,782 (GRCm39) S214P probably benign Het
Iba57 A AGC 11: 59,052,332 (GRCm39) probably null Het
Iba57 CAGA CAGAGA 11: 59,052,329 (GRCm39) probably null Het
Iba57 C G 11: 59,053,865 (GRCm39) G36R unknown Het
Iba57 T C 11: 59,052,384 (GRCm39) T86A unknown Het
Iba57 T C 11: 59,052,381 (GRCm39) T87A unknown Het
Igf1r GCTGGAGATGGA GCTGGAGATGGACCTGGAGATGGA 7: 67,875,921 (GRCm39) probably benign Het
Igf1r GGAGCTGGAGAT GGAGCTGGAGATCGAGCTGGAGAT 7: 67,875,918 (GRCm39) probably benign Het
Igf1r AGGAGCTGGAGATGGAGC AGGAGCTGGAGATGGAGCTGGAGATGGAGC 7: 67,875,917 (GRCm39) probably benign Het
Igtp C G 11: 58,097,791 (GRCm39) L321V possibly damaging Het
Igtp T G 11: 58,097,169 (GRCm39) D113E probably damaging Het
Igtp C G 11: 58,097,944 (GRCm39) L372V probably benign Het
Il2rg A G X: 100,308,987 (GRCm39) F307L probably damaging Het
Inpp5d C G 1: 87,611,492 (GRCm39) Q315E probably benign Het
Irgm2 T A 11: 58,110,339 (GRCm39) V10D probably benign Het
Irgm2 C G 11: 58,111,389 (GRCm39) T360S probably benign Het
Irgm2 G T 11: 58,111,238 (GRCm39) A310S possibly damaging Het
Irgm2 A G 11: 58,110,389 (GRCm39) N27D probably benign Het
Irgm2 T C 11: 58,110,738 (GRCm39) I143T probably benign Het
Irgm2 T C 11: 58,110,780 (GRCm39) L157S probably benign Het
Irgm2 G A 11: 58,110,833 (GRCm39) V175I probably benign Het
Irgm2 G A 11: 58,110,924 (GRCm39) S205N probably benign Het
Irgm2 A C 11: 58,110,951 (GRCm39) H214P probably benign Het
Itgae A T 11: 72,994,786 (GRCm39) Q46L probably damaging Het
Itgae A G 11: 73,006,466 (GRCm39) H378R probably benign Het
Itgae G A 11: 73,008,913 (GRCm39) V465I probably benign Het
Itgae A T 11: 73,012,757 (GRCm39) K696N probably benign Het
Itgae G T 11: 73,012,783 (GRCm39) G705V probably benign Het
Itgae C G 11: 73,024,953 (GRCm39) S1028W probably benign Het
Itgae T A 11: 72,994,713 (GRCm39) L22M possibly damaging Het
Kif1c C T 11: 70,614,940 (GRCm39) P578L probably benign Het
Krt26 C T 11: 99,228,643 (GRCm39) G30R probably damaging Het
Lama1 A G 17: 68,105,639 (GRCm39) D2049G Het
Larp1 G A 11: 57,933,166 (GRCm39) V257I probably benign Het
Lgr6 C T 1: 134,921,748 (GRCm39) A199T probably damaging Het
Llgl1 ACCCCAGCCCTTCTGATTACTGCCCTCCCCAGC ACCCCAGC 11: 60,603,923 (GRCm39) probably null Het
Lypd8 C A 11: 58,275,475 (GRCm39) A70E possibly damaging Het
Lypd8 G A 11: 58,275,489 (GRCm39) E75K probably benign Het
Lypd8 CAATCACCAACA CAATCACCAACAGTTCCCTCGCCTCTGTTACCCCACAAATCACCAACA 11: 58,281,059 (GRCm39) probably benign Het
Lypd8 T C 11: 58,273,601 (GRCm39) Y27H probably benign Het
Lypd8l A G 11: 58,503,387 (GRCm39) L47P probably benign Het
Lypd8l T G 11: 58,503,397 (GRCm39) S44R probably benign Het
Lypd8l G A 11: 58,499,335 (GRCm39) P161L probably benign Het
Malrd1 G A 2: 16,047,037 (GRCm39) S1721N unknown Het
Mapk7 TGGGGCAGGGGCAGGGGCAGG TGGCGCTGGGGCAGGGGCAGGGGCAGGGGCAGG 11: 61,381,053 (GRCm39) probably benign Het
Mapk7 CGCTGGTGCTGG CGCTGGTGCTGGTGCTGG 11: 61,381,038 (GRCm39) probably benign Het
Mctp2 A G 7: 71,835,568 (GRCm39) L543P probably damaging Het
Mfap3 G A 11: 57,418,902 (GRCm39) G21S probably benign Het
Mfap3 A T 11: 57,418,866 (GRCm39) I9F possibly damaging Het
Mrpl22 G A 11: 58,062,521 (GRCm39) A4T unknown Het
Mrpl55 A G 11: 59,094,999 (GRCm39) probably null Het
Mrpl55 A T 11: 59,095,415 (GRCm39) L26F probably benign Het
Myh1 A C 11: 67,095,272 (GRCm39) T211P probably benign Het
Myh8 A C 11: 67,188,312 (GRCm39) N991T probably benign Het
Myo6 G T 9: 80,149,509 (GRCm39) E152* probably null Het
Myocd A G 11: 65,075,418 (GRCm39) S697P probably benign Het
Nlgn2 A G 11: 69,719,220 (GRCm39) V210A possibly damaging Het
Nlrp1a T C 11: 71,014,914 (GRCm39) E112G probably benign Het
Nlrp1a T C 11: 70,990,442 (GRCm39) I1038V probably benign Het
Nlrp1a C T 11: 70,988,077 (GRCm39) R1131Q probably damaging Het
Nlrp1a T C 11: 70,983,069 (GRCm39) K1299R probably benign Het
Nlrp1a C G 11: 71,033,355 (GRCm39) probably null Het
Nlrp1b C A 11: 71,072,534 (GRCm39) M436I probably benign Het
Nlrp1b T C 11: 71,073,503 (GRCm39) I113M probably benign Het
Nlrp1b T A 11: 71,073,396 (GRCm39) Q149L probably benign Het
Nlrp1b A T 11: 71,073,378 (GRCm39) M155K probably benign Het
Nlrp1b C G 11: 71,073,370 (GRCm39) E158Q probably benign Het
Nlrp1b T C 11: 71,073,280 (GRCm39) T188A probably benign Het
Nlrp1b A T 11: 71,073,266 (GRCm39) D192E probably benign Het
Nlrp1b A G 11: 71,073,148 (GRCm39) Y232H probably benign Het
Nlrp1b G C 11: 71,073,135 (GRCm39) T236R probably benign Het
Nlrp1b A G 11: 71,072,625 (GRCm39) I406T probably benign Het
Nlrp1b A C 11: 71,072,539 (GRCm39) S435A probably benign Het
Nmur2 T C 11: 55,931,104 (GRCm39) I202M probably benign Het
Obscn G T 11: 58,984,334 (GRCm39) A1707D possibly damaging Het
Obscn C T 11: 58,984,335 (GRCm39) A1707T probably benign Het
Obscn G A 11: 58,984,385 (GRCm39) A1690V probably benign Het
Obscn C T 11: 58,990,735 (GRCm39) A1613T possibly damaging Het
Obscn T C 11: 58,990,755 (GRCm39) H1606R probably benign Het
Obscn C G 11: 58,994,167 (GRCm39) A1572P probably damaging Het
Obscn T C 11: 58,994,340 (GRCm39) H1514R probably benign Het
Obscn G A 11: 58,994,364 (GRCm39) A1506V probably benign Het
Obscn T C 11: 59,003,380 (GRCm39) E1306G probably benign Het
Obscn T C 11: 59,003,462 (GRCm39) M1279V probably benign Het
Obscn T C 11: 59,013,563 (GRCm39) M1095V probably benign Het
Obscn A G 11: 59,013,664 (GRCm39) V1061A probably benign Het
Obscn C T 11: 59,018,892 (GRCm39) A949T probably benign Het
Obscn C T 11: 59,018,895 (GRCm39) V973M probably damaging Het
Obscn C T 11: 59,019,075 (GRCm39) A888T probably damaging Het
Obscn T C 11: 59,020,513 (GRCm39) M844V probably benign Het
Obscn G T 11: 59,020,663 (GRCm39) L794M probably benign Het
Obscn C T 11: 59,021,449 (GRCm39) R797H probably damaging Het
Obscn C T 11: 59,023,937 (GRCm39) A578T possibly damaging Het
Obscn G A 11: 59,024,066 (GRCm39) P535S probably damaging Het
Obscn C G 11: 59,024,072 (GRCm39) A533P probably benign Het
Obscn T C 11: 59,026,505 (GRCm39) I233V probably benign Het
Obscn G A 11: 58,933,878 (GRCm39) R5329C probably benign Het
Obscn C T 11: 58,940,306 (GRCm39) D5354N Het
Obscn C A 11: 58,940,614 (GRCm39) R4593S possibly damaging Het
Obscn T C 11: 58,940,623 (GRCm39) T5307A Het
Obscn G A 11: 58,942,383 (GRCm39) T4372M probably benign Het
Obscn T C 11: 58,943,439 (GRCm39) M4237V probably benign Het
Obscn C T 11: 58,944,594 (GRCm39) R4700Q probably benign Het
Obscn T C 11: 58,944,651 (GRCm39) K4681R probably benign Het
Obscn T C 11: 58,945,044 (GRCm39) E4658G probably benign Het
Obscn C T 11: 58,945,176 (GRCm39) R4614Q probably benign Het
Obscn T C 11: 58,945,660 (GRCm39) T4184A probably benign Het
Obscn C T 11: 58,946,283 (GRCm39) R4474H probably damaging Het
Obscn T C 11: 58,946,331 (GRCm39) D4458G probably damaging Het
Obscn C T 11: 58,946,340 (GRCm39) R4455K probably benign Het
Obscn G T 11: 58,946,936 (GRCm39) A4066E possibly damaging Het
Obscn A G 11: 58,947,595 (GRCm39) M4478T Het
Obscn C A 11: 58,951,823 (GRCm39) G3977W probably damaging Het
Obscn C T 11: 58,952,388 (GRCm39) G3894R probably benign Het
Obscn C T 11: 58,952,408 (GRCm39) R3887K probably benign Het
Obscn G C 11: 58,952,959 (GRCm39) P4115A probably benign Het
Obscn C T 11: 58,952,965 (GRCm39) D4113N probably damaging Het
Obscn CCACACACACACAC CCACACACACAC 11: 58,954,279 (GRCm39) probably null Het
Obscn T C 11: 58,954,300 (GRCm39) T4037A Het
Obscn G A 11: 58,891,715 (GRCm39) A6939V probably benign Het
Obscn C G 11: 58,900,019 (GRCm39) G938A probably benign Het
Obscn G C 11: 58,904,014 (GRCm39) T7320S probably benign Het
Obscn C T 11: 58,921,934 (GRCm39) R5954Q probably damaging Het
Obscn G C 11: 58,929,976 (GRCm39) P5080A probably benign Het
Obscn T A 11: 58,929,990 (GRCm39) Q5075L probably damaging Het
Obscn T C 11: 58,932,601 (GRCm39) I4869V probably benign Het
Obscn T A 11: 58,932,674 (GRCm39) probably null Het
Obscn T C 11: 58,933,776 (GRCm39) T5363A probably benign Het
Obscn G A 11: 58,933,853 (GRCm39) A5337V probably benign Het
Obscn T C 11: 58,954,402 (GRCm39) K3727E probably damaging Het
Obscn C T 11: 58,984,239 (GRCm39) V1739M possibly damaging Het
Obscn A G 11: 58,984,142 (GRCm39) F1771S probably benign Het
Obscn T C 11: 58,981,573 (GRCm39) H1815R probably benign Het
Obscn A G 11: 58,977,565 (GRCm39) V1845A probably benign Het
Obscn T C 11: 58,977,527 (GRCm39) R1858G probably benign Het
Obscn C T 11: 58,977,505 (GRCm39) R1865H probably benign Het
Obscn C A 11: 58,972,698 (GRCm39) G2116V possibly damaging Het
Obscn C G 11: 58,970,722 (GRCm39) V2328L probably benign Het
Obscn G A 11: 58,969,984 (GRCm39) R53C probably damaging Het
Obscn C T 11: 58,967,334 (GRCm39) V2792I possibly damaging Het
Obscn C A 11: 58,960,757 (GRCm39) A3185S probably benign Het
Obscn C T 11: 58,958,655 (GRCm39) V3433I probably benign Het
Obscn G A 11: 58,957,973 (GRCm39) R3576C probably benign Het
Or11l3 G A 11: 58,516,075 (GRCm39) S79F probably benign Het
Or11l3 A C 11: 58,516,732 (GRCm39) C46G possibly damaging Het
Or11l3 T G 11: 58,516,619 (GRCm39) K84N probably benign Het
Or11l3 G A 11: 58,516,588 (GRCm39) P95S probably benign Het
Or11l3 C G 11: 58,516,130 (GRCm39) G61R probably benign Het
Or2ab1 A C 11: 58,488,344 (GRCm39) I35L probably benign Het
Or2ab1 A G 11: 58,488,776 (GRCm39) S179G probably benign Het
Or2ab1 A G 11: 58,488,491 (GRCm39) S84G possibly damaging Het
Or2ab1 A G 11: 58,488,356 (GRCm39) I39V probably benign Het
Or2ak4 C T 11: 58,648,895 (GRCm39) L135F probably benign Het
Or2ak4 G A 11: 58,648,793 (GRCm39) A101T probably benign Het
Or2ak4 A C 11: 58,649,186 (GRCm39) K232Q probably benign Het
Or2ak4 A C 11: 58,649,168 (GRCm39) I226L probably benign Het
Or2ak4 G A 11: 58,649,153 (GRCm39) V221M probably damaging Het
Or2ak4 A G 11: 58,648,931 (GRCm39) S147G probably benign Het
Or2ak5 G A 11: 58,611,922 (GRCm39) probably benign Het
Or2ak6 C T 11: 58,593,153 (GRCm39) L209F possibly damaging Het
Or2ak6 A C 11: 58,592,784 (GRCm39) I86L probably benign Het
Or2ak6 C A 11: 58,593,222 (GRCm39) Q232K probably benign Het
Or2ak7 G T 11: 58,574,758 (GRCm39) D20Y probably benign Het
Or2ak7 T C 11: 58,575,548 (GRCm39) L283P probably benign Het
Or2ak7 G A 11: 58,575,541 (GRCm39) V281I probably benign Het
Or2ak7 C T 11: 58,575,289 (GRCm39) H197Y probably benign Het
Or2ak7 G A 11: 58,575,083 (GRCm39) R128Q probably benign Het
Or2ak7 G A 11: 58,574,941 (GRCm39) V81M probably benign Het
Or2ak7 T C 11: 58,574,815 (GRCm39) F39L probably benign Het
Or2av9 T C 11: 58,381,314 (GRCm39) Q89R probably benign Het
Or2av9 C A 11: 58,380,574 (GRCm39) E336* probably null Het
Or2av9 C T 11: 58,381,123 (GRCm39) A153T probably benign Het
Or2t29 G T 11: 58,434,272 (GRCm39) S23Y probably benign Het
Or2t43 C T 11: 58,457,920 (GRCm39) V84I probably benign Het
Or2t43 G A 11: 58,457,388 (GRCm39) A261V probably benign Het
Or2t43 A T 11: 58,457,521 (GRCm39) S217T probably benign Het
Or2t44 A G 11: 58,677,773 (GRCm39) T238A probably damaging Het
Or2t46 G A 11: 58,471,828 (GRCm39) V53I probably benign Het
Or2t46 T G 11: 58,472,122 (GRCm39) L151V probably benign Het
Or2t46 G C 11: 58,472,483 (GRCm39) S271T probably benign Het
Or2t46 C T 11: 58,471,750 (GRCm39) H27Y probably benign Het
Or2t46 T C 11: 58,471,757 (GRCm39) V29A probably benign Het
Or2t47 C T 11: 58,442,940 (GRCm39) A42T probably benign Het
Or2t47 T C 11: 58,442,387 (GRCm39) K226R probably benign Het
Or2t47 C T 11: 58,442,801 (GRCm39) S88N probably benign Het
Or2t49 C A 11: 58,392,936 (GRCm39) V155F probably benign Het
Or2t49 GGTGGATTGGTATGTGGAT GGTGGAT 11: 58,393,212 (GRCm39) probably benign Het
Or2t49 C G 11: 58,393,287 (GRCm39) V38L probably benign Het
Or2t49 C T 11: 58,393,396 (GRCm39) M1I probably null Het
Or2t49 T C 11: 58,392,474 (GRCm39) M309V probably benign Het
Or2t49 T C 11: 58,392,927 (GRCm39) I158V probably benign Het
Or2w3 T G 11: 58,557,342 (GRCm39) I319R probably benign Het
Or2w3b T G 11: 58,623,200 (GRCm39) N264H probably benign Het
Or2w3b C A 11: 58,624,048 (GRCm39) probably benign Het
Or2w3b T C 11: 58,623,475 (GRCm39) H172R probably benign Het
Or2w3b G A 11: 58,623,295 (GRCm39) A232V probably benign Het
Or5af2 T C 11: 58,708,122 (GRCm39) V96A probably benign Het
Or5af2 A G 11: 58,707,887 (GRCm39) I18V probably benign Het
Or5af2 C G 11: 58,708,644 (GRCm39) P270R probably benign Het
Or5af2 T C 11: 58,708,508 (GRCm39) C225R probably benign Het
Or5af2 C G 11: 58,708,243 (GRCm39) H136Q probably benign Het
Or5af2 A C 11: 58,708,220 (GRCm39) I129L probably benign Het
Or6c69 G C 10: 129,747,826 (GRCm39) A107G possibly damaging Het
Or8g17 T A 9: 38,930,229 (GRCm39) S203C probably damaging Het
Or8k33 T C 2: 86,384,471 (GRCm39) probably benign Het
Or9e1 G T 11: 58,731,945 (GRCm39) A2S probably benign Het
Or9e1 G C 11: 58,731,907 (GRCm39) probably benign Het
Or9e1 A G 11: 58,732,615 (GRCm39) H225R probably benign Het
Or9e1 C T 11: 58,732,032 (GRCm39) L31F probably benign Het
Or9e1 T C 11: 58,732,084 (GRCm39) I48T probably benign Het
Or9e1 G A 11: 58,732,569 (GRCm39) A210T probably benign Het
Ovca2 T C 11: 75,069,528 (GRCm39) T32A probably benign Het
Pimreg G A 11: 71,935,979 (GRCm39) R154H probably damaging Het
Pimreg TCACA TCA 11: 71,935,801 (GRCm39) probably benign Het
Pitpnm3 C T 11: 72,010,969 (GRCm39) R21Q probably benign Het
Pitpnm3 T C 11: 71,954,955 (GRCm39) K520E probably benign Het
Prpsap2 A C 11: 61,647,078 (GRCm39) V21G possibly damaging Het
Rabep1 C CT 11: 70,830,910 (GRCm39) probably null Het
Rai1 A G 11: 60,078,389 (GRCm39) N818D probably benign Het
Rap1gap2 C T 11: 74,487,721 (GRCm39) E52K probably benign Het
Rbm6 G T 9: 107,655,171 (GRCm39) S1020Y probably damaging Het
Rhpn2 G T 7: 35,084,826 (GRCm39) E573D probably benign Het
Rnf112 A G 11: 61,341,775 (GRCm39) L343P unknown Het
Rnf167 CTT CACAGGGATT 11: 70,541,646 (GRCm39) probably null Het
Rpp40 C T 13: 36,080,739 (GRCm39) V355I probably benign Het
Rtn4rl1 C T 11: 75,156,863 (GRCm39) P432S probably benign Het
Setd5 C A 6: 113,091,957 (GRCm39) N259K probably benign Het
Shisa6 TGGCCGC TGGCCGCGGCCGC 11: 66,416,517 (GRCm39) probably benign Het
Sidt1 A G 16: 44,078,294 (GRCm39) probably null Het
Slc2a4 GCC G 11: 69,834,819 (GRCm39) probably null Het
Slc2a4 GGCCG GG 11: 69,834,818 (GRCm39) probably benign Het
Slc39a9 G C 12: 80,691,502 (GRCm39) probably benign Het
Slc7a10 A G 7: 34,885,956 (GRCm39) H17R probably benign Het
Smcr8 T C 11: 60,669,932 (GRCm39) V360A probably benign Het
Smcr8 A G 11: 60,668,806 (GRCm39) probably benign Het
Smcr8 C A 11: 60,670,699 (GRCm39) R616S probably benign Het
Smg6 G T 11: 75,047,092 (GRCm39) A1262S probably benign Het
Sp140 G C 1: 85,569,524 (GRCm39) R378T probably damaging Het
Spns3 T C 11: 72,440,863 (GRCm39) I58V probably benign Het
Spns3 T C 11: 72,440,986 (GRCm39) S17G probably benign Het
Spns3 G A 11: 72,440,917 (GRCm39) P40S probably benign Het
Srebf1 C T 11: 60,097,061 (GRCm39) V256M probably benign Het
Sycp2 C A 2: 177,992,662 (GRCm39) R1296L probably benign Het
Tbata G C 10: 61,022,172 (GRCm39) E337D probably benign Het
Tekt1 T C 11: 72,250,597 (GRCm39) Q33R probably benign Het
Thop1 C T 10: 80,909,043 (GRCm39) R25C probably damaging Het
Tmem102 C G 11: 69,695,902 (GRCm39) G53A possibly damaging Het
Tmem102 G C 11: 69,695,927 (GRCm39) R45G probably benign Het
Tmem11 A G 11: 60,766,658 (GRCm39) probably benign Het
Tom1l2 C T 11: 60,132,682 (GRCm39) A414T probably benign Het
Top3a C T 11: 60,641,410 (GRCm39) G425S probably benign Het
Trim16 C T 11: 62,711,428 (GRCm39) A33V probably benign Het
Trim16 C A 11: 62,731,675 (GRCm39) D515E probably benign Het
Trim16 T C 11: 62,731,572 (GRCm39) V481A probably benign Het
Trim16 G A 11: 62,727,643 (GRCm39) E322K probably benign Het
Trim16 TGAAGA TGAAGAAGA 11: 62,711,516 (GRCm39) probably benign Het
Trim16 G C 11: 62,711,502 (GRCm39) V58L probably benign Het
Trim17 G A 11: 58,856,331 (GRCm39) M129I probably benign Het
Trim17 A G 11: 58,861,272 (GRCm39) N259S probably benign Het
Trim58 C A 11: 58,531,684 (GRCm39) L131M possibly damaging Het
Trim58 A G 11: 58,542,486 (GRCm39) N482S probably benign Het
Trpv1 C G 11: 73,131,427 (GRCm39) P322A possibly damaging Het
Trpv1 C A 11: 73,145,117 (GRCm39) D734E probably benign Het
Trpv3 G A 11: 73,169,803 (GRCm39) A125T probably benign Het
Trpv3 C T 11: 73,160,513 (GRCm39) A9V probably benign Het
Trpv3 A G 11: 73,174,502 (GRCm39) T290A probably benign Het
Tshz3 T C 7: 36,468,341 (GRCm39) I110T probably benign Het
Tshz3 A G 7: 36,469,999 (GRCm39) S663G probably benign Het
Tvp23b A C 11: 62,772,769 (GRCm39) N7H possibly damaging Het
Ubap2l G T 3: 89,916,543 (GRCm39) H915Q unknown Het
Usp43 C T 11: 67,747,332 (GRCm39) G792S probably benign Het
Usp43 AGGGC AGGGCAGGGGATGAACCTCGGGC 11: 67,746,545 (GRCm39) probably benign Het
Utrn C T 10: 12,545,491 (GRCm39) R1718H probably damaging Het
Vamp2 C T 11: 68,979,411 (GRCm39) probably benign Het
Vamp2 G A 11: 68,980,889 (GRCm39) G124R possibly damaging Het
Wfdc6b C T 2: 164,455,591 (GRCm39) probably benign Het
Xaf1 T TAGCCAGCC 11: 72,199,849 (GRCm39) probably null Het
Xaf1 GGCT GGCTGGCCAGCT 11: 72,199,846 (GRCm39) probably null Het
Xaf1 T G 11: 72,199,792 (GRCm39) C176W unknown Het
Xaf1 A G 11: 72,199,476 (GRCm39) E71G probably benign Het
Xaf1 C A 11: 72,197,434 (GRCm39) L137I probably benign Het
Xaf1 G C 11: 72,197,429 (GRCm39) C135S probably damaging Het
Xaf1 G A 11: 72,197,426 (GRCm39) R134H probably benign Het
Xaf1 T C 11: 72,199,881 (GRCm39) L206S unknown Het
Xaf1 G C 11: 72,199,856 (GRCm39) V198L unknown Het
Zbtb1 A G 12: 76,432,023 (GRCm39) K3R probably benign Het
Zfp286 G A 11: 62,675,782 (GRCm39) T60M probably damaging Het
Zfp286 A G 11: 62,678,795 (GRCm39) V44A probably benign Het
Zfp287 C G 11: 62,606,175 (GRCm39) C244S probably benign Het
Zfp287 G A 11: 62,613,757 (GRCm39) R225* probably null Het
Zfp287 C T 11: 62,604,633 (GRCm39) R758H probably benign Het
Zfp39 G C 11: 58,781,130 (GRCm39) T544R possibly damaging Het
Zfp39 A C 11: 58,780,873 (GRCm39) Y630D probably benign Het
Zfp39 G C 11: 58,780,871 (GRCm39) Y630* probably null Het
Zfp39 T G 11: 58,791,409 (GRCm39) S93R probably benign Het
Zfp39 G T 11: 58,791,407 (GRCm39) S93R probably benign Het
Zfp39 T C 11: 58,782,142 (GRCm39) K207E probably benign Het
Zfp39 A G 11: 58,782,123 (GRCm39) I213T probably benign Het
Zfp39 T A 11: 58,781,967 (GRCm39) H265L probably damaging Het
Zfp39 T A 11: 58,781,751 (GRCm39) K337M probably benign Het
Zfp39 G C 11: 58,781,273 (GRCm39) D496E probably benign Het
Zfp39 T C 11: 58,781,274 (GRCm39) D496G possibly damaging Het
Zfp39 T C 11: 58,781,526 (GRCm39) N412S possibly damaging Het
Zfp39 G T 11: 58,781,597 (GRCm39) N388K probably benign Het
Zfp39 A G 11: 58,781,605 (GRCm39) S386P probably benign Het
Zfp39 A C 11: 58,781,702 (GRCm39) H353Q probably damaging Het
Zfp39 A C 11: 58,781,712 (GRCm39) V350G probably benign Het
Zfp39 A G 11: 58,781,724 (GRCm39) V346A probably benign Het
Zfp536 C T 7: 37,178,985 (GRCm39) G1207S probably benign Het
Zfp536 T A 7: 37,179,908 (GRCm39) Y899F probably benign Het
Zfp536 T C 7: 37,179,498 (GRCm39) T1036A probably benign Het
Zfp672 G T 11: 58,220,452 (GRCm39) T49K unknown Het
Zfp672 C A 11: 58,220,786 (GRCm39) probably benign Het
Zfp692 G T 11: 58,199,859 (GRCm39) E149D probably benign Het
Zfp692 G A 11: 58,200,844 (GRCm39) V242I probably benign Het
Zzef1 G A 11: 72,780,008 (GRCm39) R1927H probably benign Het
Other mutations in Hic1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01110:Hic1 APN 11 75,056,345 (GRCm39) missense possibly damaging 0.96
cough UTSW 11 75,057,143 (GRCm39) missense possibly damaging 0.93
Cup UTSW 11 75,058,200 (GRCm39) missense probably damaging 0.97
Undulate UTSW 11 75,057,042 (GRCm39) missense possibly damaging 0.96
R0138:Hic1 UTSW 11 75,058,169 (GRCm39) missense probably damaging 0.99
R0331:Hic1 UTSW 11 75,056,316 (GRCm39) missense possibly damaging 0.53
R0491:Hic1 UTSW 11 75,057,136 (GRCm39) missense possibly damaging 0.86
R0521:Hic1 UTSW 11 75,057,713 (GRCm39) missense possibly damaging 0.68
R0744:Hic1 UTSW 11 75,056,627 (GRCm39) missense possibly damaging 0.52
R1766:Hic1 UTSW 11 75,056,620 (GRCm39) nonsense probably null
R2070:Hic1 UTSW 11 75,059,885 (GRCm39) missense possibly damaging 0.68
R2211:Hic1 UTSW 11 75,060,210 (GRCm39) missense possibly damaging 0.59
R5418:Hic1 UTSW 11 75,057,425 (GRCm39) splice site probably null
R6047:Hic1 UTSW 11 75,057,675 (GRCm39) missense possibly damaging 0.94
R6076:Hic1 UTSW 11 75,058,154 (GRCm39) missense probably damaging 1.00
R6415:Hic1 UTSW 11 75,057,143 (GRCm39) missense possibly damaging 0.93
R6633:Hic1 UTSW 11 75,060,324 (GRCm39) missense unknown
R7122:Hic1 UTSW 11 75,060,056 (GRCm39) missense probably benign
R7308:Hic1 UTSW 11 75,057,977 (GRCm39) missense probably damaging 1.00
R7761:Hic1 UTSW 11 75,058,200 (GRCm39) missense probably damaging 0.97
R7778:Hic1 UTSW 11 75,057,042 (GRCm39) missense possibly damaging 0.96
R7824:Hic1 UTSW 11 75,057,042 (GRCm39) missense possibly damaging 0.96
R8230:Hic1 UTSW 11 75,056,411 (GRCm39) missense possibly damaging 0.85
R8419:Hic1 UTSW 11 75,057,096 (GRCm39) missense possibly damaging 0.96
R8752:Hic1 UTSW 11 75,060,206 (GRCm39) missense probably benign 0.00
R8832:Hic1 UTSW 11 75,057,728 (GRCm39) missense possibly damaging 0.86
R8857:Hic1 UTSW 11 75,056,228 (GRCm39) missense probably benign 0.33
R9068:Hic1 UTSW 11 75,060,332 (GRCm39) missense unknown
R9157:Hic1 UTSW 11 75,057,053 (GRCm39) missense possibly damaging 0.96
R9497:Hic1 UTSW 11 75,060,131 (GRCm39) missense possibly damaging 0.92
R9594:Hic1 UTSW 11 75,056,757 (GRCm39) missense possibly damaging 0.71
RF029:Hic1 UTSW 11 75,060,268 (GRCm39) small deletion probably benign
RF043:Hic1 UTSW 11 75,060,281 (GRCm39) small deletion probably benign
Z1186:Hic1 UTSW 11 75,058,352 (GRCm39) missense probably damaging 0.99
Z1187:Hic1 UTSW 11 75,058,352 (GRCm39) missense probably damaging 0.99
Z1188:Hic1 UTSW 11 75,058,352 (GRCm39) missense probably damaging 0.99
Z1189:Hic1 UTSW 11 75,058,352 (GRCm39) missense probably damaging 0.99
Z1190:Hic1 UTSW 11 75,058,352 (GRCm39) missense probably damaging 0.99
Z1191:Hic1 UTSW 11 75,060,276 (GRCm39) small deletion probably benign
Z1191:Hic1 UTSW 11 75,060,275 (GRCm39) frame shift probably null
Z1191:Hic1 UTSW 11 75,060,274 (GRCm39) frame shift probably null
Z1192:Hic1 UTSW 11 75,060,276 (GRCm39) small deletion probably benign
Z1192:Hic1 UTSW 11 75,058,352 (GRCm39) missense probably damaging 0.99
Predicted Primers
Posted On 2021-03-08